Му 2723 10: Библиотека государственных стандартов

Разное

Содержание

Анализ на сальмонеллез. Какие анализы сдавать. Где сдать анализы на сальмонеллез.

Под сальмонеллезами принято подразумевать заболевания, вызываемые комплексом сальмонелл, за исключением возбудителей брюшного тифа и паратифов. Они характеризуются значительным полиморфизмом клинического течения с преимущественным поражением ЖКТ, возможной генерализацией и различной степенью выраженности симптомов общей интоксикации и обезвоживания. Антигенная классификация сальмонелл отражена в схеме Кауфмана-Уайта (2007 г.) и насчитывает 2579 сероваров.

Показания к обследованию. Пациенты с острым диарейным синдромом и явлениями интоксикации.

Этиологическая лабораторная диагностика сальмонеллезов включает выделение культуры патогена, обнаружение АГ и ДНК сальмонелл, определение специфических АТ к АГ возбудителя.

Материал для исследований. Образцы фекалий, рвотные массы и промывные воды желудка, при наличии специальных показаний – желчь, дуоденальное содержимое, кровь.

Сравнительная характеристика методов лабораторной диагностики. «Золотым стандартом» в диагностике сальмонеллезов является выделение чистой культуры патогена при использовании селективных сред обогащения, дифференциально- диагностических сред, с дальнейшей биохимической идентификацией и установлением серовара изолята в реакциях агглютинации (МУ 4.2.2723-10). Средняя длительность исследования составляет 3–4 дня.

Выявление ДНК методом ПЦР является наиболее оперативным методом прямой детекции сальмонелл. Информативность исследований достаточна для диагностики сальмонеллезов в клинической практике, однако не решает эпидемиологических задач – серотипирования патогенов. Наборы реагентов, предназначенные для детекции НК

Salmonella spp., выявляют возбудителей тифа и паратифов.

Для выявление АГ сальмонелл преимущественно используют наборы реагентов, сочетающих этап селективного обогащения и метод ИХА для детекции патогена. Выявление специфических АТ (в отечественной практике наиболее часто применяют метод РПГА) обладает ограниченной информативностью вследствие трудности определения условно-диагностического титра и используется в формате исследования «парных сывороток » в качестве вспомогательного по отношению к культуральному методу исследований. Этот вид исследований является ретроспективным, его преимущество – возможность диагностики на поздних сроках заболевания и после антибиотикотерапии.

Показания к применению различных лабораторных исследований. В острой фазе заболевания целесообразно применение прямых методов лабораторной диагностики – выявление культуры микроорганизма и/или его ДНК. При целенаправленном обследовании пациентов на сальмонеллез предпочтение должно отдаваться классическим методам выделения микроорганизма (культуральные исследования с последующей биохимической идентификацией). При необходимости проведения исследований в короткий промежуток времени, а также при организации скринингового обследования для выявления широкого спектра патогенов целесообразна детекция ДНК микроорганизма. Определение специфических АТ показано на поздних сроках заболевания.

Особенности интерпретации результатов лабораторных исследований. Результаты, полученные при применении прямых способов лабораторной диагностики (выявление сальмонелл, их АГ или ДНК в биологическом материале) являются лабораторным подтверждением этиологии заболевания.

При интерпретации результатов выявления АТ следует учитывать вариабельность так называемого «условно-диагностического» титра, возможность длительного сохранения высокого уровня АТ после перенесенного заболевания и недостаточную специфичность метода РПГА, дающего нередко ложноположительные результаты.

Методические указания | Центр гигиены и эпидемиологии в Республике Саха (Якутия)

Методические указания | Центр гигиены и эпидемиологии в Республике Саха (Якутия)

Методические указания
  • Методические указания МУ 3.1.1.2957-11 «Эпидемиологический надзор, лабораторная диагностика и профилактика ротавирусной инфекции»
  • Методические указания МУ 3.1.1.2969-11 «Эпидемиологический надзор, лабораторная диагностика и профилактика ротавирусной инфекции»
  • Методические указания МУ 2.1.4.2898-11 «Санитарно-эпидемиологические исследования (испытания) материалов, реагентов и оборудования, используемых для водоочистки и водоподготовки»
  • Методические указания МУ 2.1.4.2899-11 «Организация внутреннего контроля качества санитарно-микробиологических исследований воды. Изменение 1 к МУ 2.1.4.1057-01»
  • Методические указания МУК 4.3.2900-11 «Измерение температуры горячей воды систем централизованного горячего водоснабжения»
  • Методические указания МУ 24.2.2723-10 «Лабораторная диагностика сальмонеллезов, обнаружение сальмонелл в пищевых продуктах и объектах окружающей среды» (утв. Главным государственным санитарным врачом РФ 13 августа 2010г.)
  • Методические указания МУ 2.6.1.1868-04 «Внедрение показателей радиационной безопасности о состоянии объектов окружающей среды, в т.ч. продовольственного сырья и пищевых продуктов, в систему социально-гигиенического мониторинга» (утв. Главным государственным санитарным врачом РФ 5 марта 2004 г.)
  • Методические указания МУ 2.6.1.2135-06 «Гигиенические требования по обеспечению радиационной безопасности при лучевой терапии закрытыми радионуклидными источниками (утв. Главным государственным санитарным врачом РФ 8 ноября 2006 г.)
  • Методические указания МУ 2.6.1.2153-06 «Оперативная оценка доз облучения населения при радиоактивном загрязнении территории воздушным путем» (утв. Главным государственным санитарным врачом РФ 4 декабря 2006 г.)
  • Методические указания МУ 3.1.1.2130-06 «Энтеровирусные заболевания: клиника, лабораторная диагностика, эпидемиология, профилактика» (утв. Главным государственным санитарным врачом РФ 9 сентября 2006 г.)
  • Методические указания МУ 3.1.2.2160-07 «Эпидемиологический надзор за коклюшной инфекцией» (утв. Главным государственным санитарным врачом РФ 12 февраля 2007 г.)
  • Методические указания МУ 3.3.1.2075-06 «Основные требования к вакцинным штаммам холерного вибриона» (утв. Главным государственным санитарным врачом РФ 11 июля 2006 г.)
  • Методические указания МУ 3.3.1.2161-07 «Основные требования к вакцинным штаммам туляремийного микроба» (утв. Главным государственным санитарным врачом РФ 12 февраля 2007 г.)
  • Методические указания МУК 4.1.2158-07 «Определение остаточных количеств антибиотиков тетрациклиновой группы и сульфаниламидных препаратов в продуктах животного происхождения методом иммуноферментного анализа» (утв. Главным государственным санитарным врачом РФ 18 января 2007 г.)
  • Методические указания МУК 4.2.2136-06 «Организация и проведение лабораторной диагностики заболеваний, вызванных высоковирулентными штаммами вируса гриппа птиц типа А (ВГПА), у людей» (утв. Главным государственным санитарным врачом РФ 9 ноября 2006 г.)
  • Методические указания МУ 2.3.2.1830-04 «Микробиологическая и молекулярно-генетическая оценка пищевой продукции, полученной с использованием генетически модифицированных микроорганизмов» (утв. Главным государственным санитарным врачом РФ 9 января 2004 г.)
  • Методические указания МУ 2.6.1.1868-04 «Внедрение показателей радиационной безопасности о состоянии объектов окружающей среды, в т.ч. продовольственного сырья и пищевых продуктов, в систему социально-гигиенического мониторинга» (утв. Главным государственным санитарным врачом РФ 5 марта 2004 г.)
  • Методические указания МУ 2.6.1.2135-06 «Гигиенические требования по обеспечению радиационной безопасности при лучевой терапии закрытыми радионуклидными источниками (утв. Главным государственным санитарным врачом РФ 8 ноября 2006 г.)
  • Методические указания МУ 2.6.1.2153-06 «Оперативная оценка доз облучения населения при радиоактивном загрязнении территории воздушным путем» (утв. Главным государственным санитарным врачом РФ 4 декабря 2006 г.)
  • Методические указания МУ 3.1.1.2130-06 «Энтеровирусные заболевания: клиника, лабораторная диагностика, эпидемиология, профилактика» (утв. Главным государственным санитарным врачом РФ 9 сентября 2006 г.)
  • Методические указания МУ 3.1.2.2160-07 «Эпидемиологический надзор за коклюшной инфекцией» (утв. Главным государственным санитарным врачом РФ 12 февраля 2007 г.)
  • Методические указания МУ 3.3.1.2075-06 «Основные требования к вакцинным штаммам холерного вибриона» (утв. Главным государственным санитарным врачом РФ 11 июля 2006 г.)
  • Методические указания МУ 3.3.1.2161-07 «Основные требования к вакцинным штаммам туляремийного микроба» (утв. Главным государственным санитарным врачом РФ 12 февраля 2007 г.)
  • Методические указания МУ 3.3.2.2124-06 «Контроль диагностических питательных сред по биологическим показателям для возбудителей чумы, холеры, сибирской язвы, туляремии, бруцеллеза, легионеллеза» (утв. Федеральной службой по надзору в сфере защиты прав потребителей и благополучия человека, Главным государственным санитарным врачом РФ 17 августа 2006 г.)
  • Методические указания МУ 4.2.2039-05 «Техника сбора и транспортирования биоматериалов в микробиологические лаборатории» (утв. и введены в действие Главным государственным санитарным врачом РФ 23 декабря 2005 г.)
  • Методические указания МУК 4.1.2158-07 «Определение остаточных количеств антибиотиков тетрациклиновой группы и сульфаниламидных препаратов в продуктах животного происхождения методом иммуноферментного анализа» (утв. Главным государственным санитарным врачом РФ 18 января 2007 г.)
  • Методические указания МУК 4.2.2136-06 «Организация и проведение лабораторной диагностики заболеваний, вызванных высоковирулентными штаммами вируса гриппа птиц типа А (ВГПА), у людей» (утв. Главным государственным санитарным врачом РФ 9 ноября 2006 г.)
  • Методические указания МУ 4.2.2723-10


Загрязненность штаммами бактерии Salmonella продуктов питания, реализуемых на рынках г. Алматы Текст научной статьи по специальности «Животноводство и молочное дело»

УДК 616.85-056.4

Ю.А.СИНЯВСКИЙ1, А.Б.БЕРДЫГАЛИЕВ*1, С.Т.БАРМАК1

‘Казахская академия питания, Алматы, Казахстан

ЗАГРЯЗНЕННОСТЬ ШТАММАМИ БАКТЕРИИ SALMONELLA ПРОДУКТОВ ПИТАНИЯ, РЕАЛИЗУЕМЫХ НА РЫНКАХ Г. АЛМАТЫ

АННОТАЦИЯ

Цель: Изучить загрязненность штаммами бактерии Salmonella продуктов питания, реализуемых на рынках г. Алматы.

Методы: лабораторные исследования пищевых продуктов были проведены в соответствии с МУ 4.2.2723-10 «Лабораторная диагностика сальмонеллезов, обнаружение сальмонелл в пищевых продуктах и объектах окружающей среды».

В результате проведенных исследовании установлено, что в пробах пищевого сырья реализуемых на рынках г.Алматы наибольшая доля неудовлетворительных по микробиологическим показателям продуктов приходится на кондитерскую продукцию, на 2-м месте -молоко и молочная продукция, на 3-м — овощи и фрукты (12,2%). Наиболее высокий удельный вес загрязненной бактериями Salmonella пищевой продукции принадлежит кондитерским изделиям (31,6%), молоко и молочная продукция (26,3%), овощи и фрукты (15,8%). Среди исследованных штаммов бактерии Salmonella, преобладали сальмонеллы редких групп.

Ключевые слова: микробиология, безопасность пищевой продукции, эпидемиологический надзор.

Пищевые продукты, представляют серьезную угрозу для здоровья населения развивающиеся и развитых стран. Особенно часто происходит загрязнение такими микроорганизмами как кишечная палочка O157:H7, Salmonella spp. и Listeria monocytogenes, которые являются обычно считаются пищевыми патогенами во многих странах [1-6].

Бактерии рода Salmonella spp., широко распространены в окружающей среде и соответственно в пищевом сырье. Заражение этими патогенами наиболее употребляемых продуктов питания зачастую является основным источником заражения детей. Показатель заболеваемости сальмонеллеза, кампи-лобактериоза на 100 тыс. человек варьирует в разных странах ЕС (сальмонеллез: Португалия 1,6 — Чехия 80,7; Соединённое Королевство Великобритании и Северной Ирландии 0,09 [7]. Полагается, что причиной этому могут быть разные/своеобразные традиции питания, наблюдаемые в каждой стране. Безусловно, не менее важными являются и системы контроля и мониторинга патогенных микроорганизмов в цепи производства пищевых продуктов, используемые в разных государствах. Именно знание эпидемиологической ситуации патогенов в цепи производства пищевых продуктов и правильные профилактические мероприятия по контролю патогенов позволяют уменьшить риск и количество заболеваний детей. Научные эпидемиологические исследования, проведенные в Соединённом Королевстве Великобритании и Северной Ирландии, Финляндиии других странах, в том числе в Российской Федерации подтверждают

факт, что патогенные микроорганизмы широко распространенны в цепи производства пищевых продуктов (от начальных этапов производства, т.е. сырья, до продуктов готовых к употреблению) [8-13]. Однако, необходимо заметить, что большинство проводимых исследований направлены на изучение пищевых продуктов, выпускаемых крупными производителями, при этом, рядовые потребители не менее часто покупают продукты на рынках от мелких производителей. Основная проблема состоит в том, что контроль качества продуктов крупных производителей осуществляется более регулярно и детально, что нельзя сказать о контроле качества продуктов мелких производителей [13-16]. Особенное внимание в данной работе будет уделено определению молекулярной -эпидемиологической ситуации по распространению патогенных микроорганизмов в продуктах питания доступных потребителям на местных рынках.

Сальмонеллез обычно ассоциируются с потреблением домашней птицы и яиц, наряду с этим мяса, не пастеризованного молока или соков, сыра, загрязненных сырых фруктов, овощей, специй и орехов. Известны вспышки сальмонеллеза, связанные с употреблением рыбы и рыбных продуктов, в том числе рыбы горячего копчения и сельди пряного посола, хотя доля их в общем числе вспышек сальмонеллез-ной этиологии невелика [2-5]. / образования

Вестник АГИУВ №4, 2018

Наибольшую опасность как возможные факторы передачи возбудителя инфекции представляют такие продукты и блюда, которые после приготовления не подвергаются термической обработке и могут храниться длительное время, в том числе и при комнатной температуре.

Необходимо учитывать, что в качестве факторов передачи возбудителя инфекции при сальмонеллезах могут оказываться продукты питания, инфицированные небольшими дозами сальмонелл.

Так, известны отдельные случаи заболевания сальмонеллезами и даже вспышки, когда заражающая доза не превышала несколько десятков микроорганизмов.

Следует учитывать и то, что даже при интенсивном размножении сальмонелл в пищевых продуктах они не изменяют ни вкуса, ни запаха, ни их внешнего вида.

Основными критериями эпидемиологической значимости определенных продуктов питания является обнаружение сальмонелл в пищевых продуктах или других объектах внешней среды.

Цель исследования: Изучить загрязненность штаммами бактерии Salmonella продуктов питания, реализуемых на рынках г. Алматы.

Задачи исследования:

1. Исследовать количество неудовлетворительных по микробиологическим показателям продуктов питания.

2. Выявить группы пищевых продуктов, наиболее загрязненных сальмонеллами.

Методология: Оценка

Порядок проведения лабораторных исследований в целях обнаружения сальмонелл в пищевых продуктах был в соответствии с МУ 4.2.2723-10 Лабораторная диагностика сальмонеллезов, обнаружение саль-

монелл в пищевых продуктах и объектах окружающей среды [7].

Отбор пищевых продуктов для исследования проводился в соответствии с ГОСТ 26668-85, Продукты пищевые и вкусовые. Методы отбора проб для микробиологического анализа.

Рекомендуемые в настоящее время стандартные приемы выделения сальмонелл должны соответствовать ISO-6579, однако не исключается возможность использования и некоторых других методов.

Кроме указанных в ISO-6579 сред обогащения, использовались селенитовую среду, или селенит-цистин-бульон, а в качестве дифференциально-диагностических среды Эндо, Плоскирева, Левина, висмут-сульфит агар, XLD-агар. Применялись также, среда Криглера, Triple sugar iron agar. Использовались гидрооксид натрия, соляная кислота, селенитовая среда, забуферная пептонная вода, дифференциально диагностические среды. Для диагностики применялась инструкция по применению набора реагентов «Диагностикум эри-троцитарный сальмонеллезный О-антигенный жидкий» от 22.08.2008 N 6854-Пр/08 и др.

Результаты исследования:

На основе анализа результатов выбраны 184 неудовлетворительных по микробиологическим показателям продуктов, из них 63 пробы (34,2%) импортной пищевой продукции и план отбора проб. В структуре проб продуктов питания, не отвечающих требованиям гигиенических нормативов по микробиологическим показателям, наибольшая доля приходится на кулинарную продукцию — 35,7%, на 2-м месте -молоко и молочная продукция — 16,8%, на 3-м — мясо и мясные продукты (13,7%), далее — овощи и фрукты (12,2%), кондитерские изделия (11,8%), рыба и рыбные продукты (9,8%) и т.д. (таблица 1).

Таблица 1 — Относительное количество неудовлетворительных по микробиологическим показателям продуктов

№ Наименование пищевых продуктов, отобранных для исследования Количество Удельный вес (в %)

1 Кулинарная продукция 68 36,7

2 Молоко и молочная продукция 29 15,8

3 Мясо и мясные продукты 25 13,7

4 Овощи и фрукты 22 12,2

5 Кондитерские изделия 22 11,8

6 Рыба и рыбные продукты 18 9,8

Всего 184 100,0

Из 184 пищевых продуктов в 19 образцах были выявлены сальмонеллы. По данным таблицы 2 видно, что из 19 образов, загрязненных сальмонеллами наи-

больший удельный вес занимали кондитерские изделия (31,6%), молоко и молочная продукция (26,3%), овощи и фрукты (15,8%).

Таблица 2 — Относительное количество образцов загрязненных сальмонеллами

№ Наименование пищевых продуктов, отобранных для исследования Количество Удельный вес (в %)

1 Кулинарная продукция 2 10,5

2 Молоко и молочная продукция 5 26,3

3 Мясо и мясные продукты 2 10,5

4 Овощи и фрукты 3 15,8

5 Кондитерские изделия 6 31,6

6 Рыба и рыбные продукты 1 5,3

Всего 19 100,0

Среди выделенных видов бактериями Salmonella были самыми распространенными Сальмонелла редких групп (таблица 3).

Таблица 3 — Относительное количество образцов загрязненных сальмонеллами

№ Виды выделенных штамов Количество положительных проб

1 Salmonella enteritidis 4

2 Сальмонелла редких групп 10

3 Salmonella virchov 5

Всего 19

Вышеперечисленные группы продуктов питания, зараженные патогенными микроорганизмами, создают особую опасность для детей школьного и дошкольного возраста. Такие продукты очень часто являются источником заражения инфекционными кишечными заболеваниями детей. Помимо госпитализации больных, вызываемых болезнями пищевого происхождения, экономические последствия являются огромными

Сложность эпидемиологического надзора за зо-онозными инфекционными заболеваниями, такими как сальмонеллез заключается в том, что в Республике Казахстан не проводились мониторинг распространенности их генотипов с использованием методов анализа ДНК и генотипирования микроорганизмов. Для оценки современного состояния заболеваемости детей школьного и дошкольного возраста указанными инфекциями и оценки зараженности пищевых

продуктов необходимо определение современных тенденций их эпидемического потенциала, особенностей генетического различия штаммов микроорганизмов, и разработка на этой основе рекомендации по их профилактике.

Таким образом, в пробах пищевого сырья реализуемых на рынках г.Алматы наибольшая доля неудовлетворительных по микробиологическим показателям продуктов приходится на кондитерскую продукцию, на 2-м месте -молоко и молочная продукция, на 3-м — овощи и фрукты (12,2%). Необходимо отметить, что наиболее высокий удельный вес загрязненной бактериями Salmonella пищевой продукции занимали кондитерские изделия (31,6%), молоко и молочная продукция (26,3%), овощи и фрукты (15,8%). Среди исследованных штаммов бактерии Salmonella, 10 были сальмонеллы редких групп.

ЛИТЕРАТУРА

1. Cetinkaya F, Mus T, Yibar A, Guclu N, Tavsanli H, Cibik R (2014). Prevalence, serotype identification by multiplex polymerase chain reaction and antimicrobial resistance patterns of Listeria monocytogenes isolated from retail foods. J Food Saf 34:42-49.

2. Modzelewska-Kapitula M, Maj-Sobotka K (2014) Salmonella spp. occurrence in minced meat, meat preparations and mechanically separated meat in Poland. J Food Saf 34(2):126-131

3. Nowak B, Muffling TV, Chaunchom S, Hartung J (2007) Salmonella contamination in pigs at slaughter and on the farm: a field study using an antibody ELISA test and a PCR technique. Int J Food Microbiol 115:259-267

* [email protected]

ai^^sj казахский медицинский i

уi /университет непрерывного

^^^^ ! образования

Вестник АГИУВ №4, 2018

4. Wang J, Zheng Z, Wang J (2007) Risk assessment of Salmonella in food of animal origin. Chin J Anim Quar 24:23-25.

5. Zhou K, Zhong K, Long C, Han X, Liu S (2014) Development and validation of a predictive model for the growth of Salmonella enterica in chicken meat. J Food Saf 34:326-332

6. EFSA. The European Union Summary Report on Trends and Sources of Zoonoses, Zoonotic Agents and Food-borne Outbreaks in 2011. The EFSA Journal 2013; doi:10.2903/j.efsa.2013.3129.

7. Scharff R. L. Economic burden from health losses due to foodborne illness in the United States. Journal of Food Protection 2012, 75:123-131.

8. Alali W. Q., Gaydashov R., Petrova E., Panin A., Tugarinov O., Kulikovskii A., Mamleeva D., Walls I., Doyle M. P. Prevalence of Salmonella on retail chicken meat in Russian Federation. Journal of Food Protection 2012, 75:1469-73.

9. Buzby J. C., Farah H. A. 2006. Chicken consumption continues longrun rise. AmberWaves 4:5.

10. Little C. L., Richardson J. F., Owen R. J., de Pinna E., Threlfall E. J. Campylobacter and Salmonella in raw-redmeats in the UnitedKingdom: prevalence, characterization and antimicrobial resistancepattern, 2003-2005. Food Microbiology 2008, 25:538-43.

11. Lay K. S.,Vuthy Y., SongP., Phol K., Sarthou J.L. Prevalence, numbers and antimicrobial susceptibilities of Salmonellaserovars and Campylobacter spp. in retail poultry in Phnom Penh, Cambodia. JournalofVeterinaryMedi-calScience 2011, 73:325-329.

12. Fredriksson-Ahomaa M., Korkeala H. Low occurrence of pathogenic Yersinia enterocolitica in clinical, food, and environmental samples: a methodological problem. Clinical Microbiology Reviews 2003, 16:220-229.

13. Nayak R., Stewart T., Nawaz M., Cerniglia C. In vitro antimicrobial susceptibility, genetic diversity and prevalence of UDP-glucose 4-epimerase galE gene in Campylobacter coli and Campylobacter jejuni from Turkey production facilities. FoodMicrobiology 2006, 23:379-392.

14. Old D. C., Chisholm S. A., Crichton P. B., Taylor A. Grouping of Salmonella enterica serotype Montevideo strains by ribotyping and IS200 profiling. Epidemiology andlnfection 2000, 124:375-382.

15. Hayashidani H., Ishiyama Y., Okatani T. A.,YoshidaS., IshikawaM., KatoY., OhtomoY., SaitoM., HorisakaT., KanekoK., OgawaM. Molecular genetic typing of Yersinia enterocolitica O:8 isolated in Japan. Advances in experimental medicine and biology 2003, 529: 363-365.

ТYЙIНДI

Мараты: Алматы ^аласыньщ базарларында сатылатын тама^ eнiмдерiнщ сальмонелла бактерияларыныц штаммдарыныц ластануын зерттеу.адагалау.

SUMMARY

Objective: To study the contamination of Salmonella bacteria strains of food products sold in the markets of Almaty.

Methods: laboratory studies of food products were carried out in accordance with MU 4.2.2723-10 «Laboratory diagnosis of salmonellosis, the detection of Salmonella in food products and environmental objects».

As a result of the study, it was found that in samples of food raw materials sold in the markets of Almaty, the largest share of products unsatisfactory in terms of microbiological indicators is confectionery, in 2nd place is milk and dairy products, and in 3rd place are vegetables and fruits (12 , 2%). The highest proportion of food products contaminated with Salmonella bacteria was confectionery (31.6%), milk and dairy products (26.3%), vegetables and fruits (15.8%). Among the strains of the Salmonella bacterium studied, salmonella of rare groups prevailed.

Keywords: microbiology, food safety, epidemiological surveillance.

Лабораторная диагностика бактериальных болезней животных: Учебное пособие, 1-е изд за 3250 руб.

Учебное издание содержит действующие методические указания, наставления и инструкции по лабораторной диагностике бактериальных болезней животных, утверждённые Министерством сельского хозяйства СССР, РФ и Россельхознадзором РФ. Документы систематизированы по видам животных, в большинстве прошли многолетнюю апробацию в КГБУ «Алтайский краевой ветеринарный центр по предупреждению и диагностике болезней животных» и включены в «Сборник нормативной документации, разрешённой и рекомендуемой для использования в государственных ветеринарных лабораториях при диагностике болезней животных, рыб и пчёл, а также контроля безопасности сырья животного и растительного происхождения, кормов» (08.07.2016 г., № ФС-НВ-2/12559) и «Перечень нормативной документации, разрешённой для использования в государственных ветеринарных лабораториях при диагностике болезней животных, рыб и пчёл, а также контроля безопасности сырья животного и растительного происхождения» (по состоянию на январь 2016 г.). Приводятся краткий словарь использованных ветеринарных терминов, предметный указатель и библиографический список.

Предназначено для студентов, обучающихся по специальности «Ветеринария» и направлению «Ветеринарно-санитарная экспертиза», практических ветеринарных врачей, ветеринарных врачей и лаборантов ветеринарных лабораторий.

 Оглавление

1. Болезни, общие для всех или нескольких видов животных ………. 3

Сибирская язва ………. 3

1.1. Наставление по исследованию кожевенного и мехового сырья на сибирскую язву реакцией преципитации (утверждено 25.05.1971 г.) ………. 3

1.2. Методические указания «Лабораторная диагностика и обнаружение возбудителя сибирской язвы» (МУК 4.2.2413-08) ………. 9

Злокачественный отёк ………. 62

1.3. Методические указания по лабораторным исследованиям на злокачественный отек животных (утверждены 05.01.1984 г. № 115-6а) ………. 62

Столбняк ………. 67

1.4. Методические указания по лабораторной диагностике столбняка (утверждены 02.02.1983 г.) ………. 67

Ботулизм ………. 69

1.5. Методические указания по лабораторной диагностике ботулизма (утверждены 02.11.1982 г. № 115-6а) ………. 69

Пастереллёз ………. 72

1.6. Методические указания по лабораторной диагностике пастереллезов животных и птиц (утверждены 20.08.1992 г., № 22-7/82) ………. 72

Хламидиоз ………. 77

1.7. Методические указания по лабораторной диагностике хламидийных инфекций у животных (утверждены 30.06.1999 г. № 13-7-2/643) ………. 77

Сальмонеллёз ………. 101

1.8. Методические указания «Лабораторная диагностика сальмонеллёзов человека и животных, обнаружение сальмонелл в кормах, продуктах питания и объектах внешней среды» (1990) ………. 101

1.9. Методические указания «Лабораторная диагностика сальмонеллезов, обнаружение сальмонелл в пищевых продуктах и объектах окружающей среды» (МУ 4.2.2723-10) ………. 153

Туберкулёз ………. 184

1.10. Наставление по диагностике туберкулеза животных (утверждено 16.11.2002 г.) ………. 184

Бруцеллёз ………. 223

1.11. Наставление по диагностике бруцеллеза животных (утверждено 29.09.2003 г. № 13-5-02/0850) ………. 223

1.12. Инструкция по применению набора для серологической диагностики бруцеллеза крупного и мелкого рогатого скота в реакции непрямой гемагглютинации (РНГА) (утверждена 25.08.2006 г.) ………. 272

Лептоспироз ………. 278

1.13. Методические указания по лабораторной диагностике лептоспироза животных (рекомендованы 15.10.1975 г., с дополнениями и изменениями от 20.10.1980 г.) ………. 278

1.14. Наставление по применению сывороток групповых агглютинирующих лептоспирозных (утверждено 23.05.1997 г. № 13-7-2/958) ………. 298

Листериоз ………. 300

1.15. Методические рекомендации по лабораторной диагностике листериоза животных и людей (утверждены 13.02.1987 г.) ………. 300

Некробактериоз ………. 347

1.16. Методические указания по лабораторной диагностике некробактериоза (утверждены 01.06.1987 г.) ………. 347

Иерсиниоз ………. 350

1.17. Методические указания по лабораторной диагностике иерсиниоза животных и обнаружению возбудителя болезни в мясном сырье, молоке и растительных кормах (утверждены 03.10.2005 г. № 5-1-14/971) ………. 350

Псевдомоноз ………. 378

1.18. Методические указания по лабораторным исследованиям на псевдомоноз животных и птиц (утверждены 14.11.1988 г. № 432-3) ………. 378

Стрептококкоз ………. 380

1.19. Методические указания по лабораторной диагностике стрептококкоза животных (утверждены 25.09.1990 г.) ………. 380

Стафилококкоз ………. 386

1.20. Методические указания по лабораторной диагностике стафилококкоза животных (утверждены 29.07.1987 г. № 432-3) ………. 386

Риккетсиозы ………. 389

1.21. Методические указания по лабораторной диагностике лихорадки Ку животных (утверждены 13.05.1996 г. № 13-6-2/600) ………. 389

Дерматофитозы ………. 402

1.22. Диагностика дерматофитозов животных. Методические рекомендации (2006) ………. 402

2. Болезни молодняка ………. 415

Смешанные кишечные инфекции ………. 415

2.1. Методические указания по ускоренной индикации морганелл, сальмонелл и энтеропатогенных эшерихий с адгезивными антигенами в патологическом материале, кормах, объектах внешней среды в реакции коагглютинации (утверждены 11.10.1999. № 13-7-2/1758) ………. 415

2.2. Методические указания по бактериологической диагностике смешанной кишечной инфекции молодняка животных, вызываемой патогенными энтеробактериями (утверждены 11.10.1999 г. № 13-7-2/1759) ………. 419

Колибактериоз ………. 428

2.3. Методические указания по бактериологической диагностике колибактериоза (эшерихиоза) животных (утверждены 27.07.2000 г., № 13-7-2/2117) ………. 428

3. Болезни лошадей ………. 435

Сап ………. 435

3.1. Наставление по диагностике сапа (утверждено 26.02.1996 г., № 13-7-2/537, с дополнениями и изменениями от 22.12.1997 г., № 13-7-2/1128) ………. 435

Мыт ………. 444

3.2. Методические указания по лабораторной диагностике мыта (утверждены 16.02.1983 г.) ………. 444

Контагиозный метрит ………. 446

3.3. Методические указания по лабораторной диагностике контагиозного метрита лошадей (утверждены 24.12.1984 г. № 115-6а) ………. 446

4. Болезни жвачных ………. 452

Эмфизематозный карбункул ………. 452

4.1. Методические указания по лабораторной диагностике эмфизематозного карбункула (утверждены 10.10.1982 г. № 115-6а) ………. 452

Брадзот овец ………. 455

4.2. Методические указания по лабораторной диагностике брадзота овец (утверждены 27.04.1984 г. № 115-6а) ………. 455

Инфекционная энтеротоксемия животных и анаэробная дизентерия ягнят ………. 458

4.3. Методические указания по лабораторной диагностике инфекционной энтеротоксемии животных и анаэробной дизентерии ягнят (утверждены 15.02.1984 г.) ………. 458

Кампилобактериоз (вибриоз) ………. 461

4.4. Временная инструкция о мероприятиях по диагностике, профилактике и ликвидации вибриозов крупного рогатого скота и овец (утверждена 05.03.1971 г. с изменениями от 13.05.1976 г. и 06.03.1979 г.) ………. 461

4.5. Наставление по применению антигена кампилобактериозного для реакции агглютинации с вагинальной слизью (РАВС) (утверждено 09.07.1999 г. № 13-7-2/1690) ………. 475

4.6. Методика бактериологической диагностики кампилобактериоза животных (2000) ………. 478

Паратуберкулёз ………. 490

4.7. Наставление по диагностике паратуберкулеза (паратуберкулезного энтерита) животных (утверждено 05.04.2001 г. № 13-5-02/0050) ………. 490

Инфекционный эпидидимит баранов ………. 504

4.8. Наставление по диагностике инфекционной болезни овец, вызываемой бруцелла овис (инфекционный эпидидимит баранов) (утверждено 13.11.1991 г.) ………. 504

Копытная гниль овец ………. 530

4.7. Методические указания по лабораторной диагностике копытной гнили овец (утверждены 25.12.1985 г.) ………. 530

5. Болезни свиней ………. 534

Рожа свиней ………. 534

5.1. Методические указания по лабораторной диагностике рожи (эризипелоида) свиней (утверждены 26.01.2001 г. № 13-5-02/0005) ………. 534

Дизентерия ………. 537

5.2. Методические указания по лабораторным исследованиям на дизентерию свиней, вызываемую трепонемой (утверждены 25.11.1983 г. № 115-6а) ………. 537

Гемофилезные болезни ………. 539

5.3. Временные методические указания по лабораторной диагностике гемофилезного полисерозита свиней (утверждены 17.10.1978 г. № 116-18) ………. 539

5.4. Временные методические указания по лабораторной диагностике гемофилезной плевропневмонии свиней (утверждены 16.04.1981 г. 115-6а) ………. 542

6. Болезни птиц ………. 547

Респираторный микоплазмоз ………. 547

6.1. Наставление по диагностике респираторного микоплазмоза птиц (утверждено 28.12.1969 г.) ………. 547

Орнитоз ………. 554

6.2. Наставление по лабораторной диагностике орнитоза (хламидиоза) птиц (утверждено 26.04.1999 г., № 13-7-2/1573) ………. 554

7. Болезни пчёл ………. 574

Американский гнилец ………. 574

7.1. Методические указания по лабораторной диагностике американского гнильца пчел (утверждены 18.08.1986 г. № 433-6) ………. 574

Европейский гнилец ………. 576

7.2. Методические указания по лабораторной диагностике европейского гнильца пчел (утверждены 15.08.1986 г. № 433-6) ………. 576

Парагнилец ………. 580

7.3. Методические указания по лабораторной диагностике парагнильца пчел (утверждены 18.08.1986 г., № 433-6) ………. 580

Септицемия ………. 582

7.4. Методические указания по лабораторной диагностике септицемии пчел (утверждены 18.08.1986 г. № 433-6) ………. 582

Сальмонеллёз ………. 584

7.5. Методические указания по лабораторной диагностике сальмонеллеза пчел (утверждены 14.08.1986 г., № 433-6) ………. 584

Гафниоз ………. 585

7.6. Методические указания по лабораторной диагностике гафниоза пчёл (рекомендованы 16.05.1978 г.) ………. 585

Порошковидный расплод ………. 588

7.7. Методические указания по бактериологической диагностике порошковидного расплода пчёл (утверждены 14.09.1982 г. № 115-6а) ………. 588

Цитробактероз ………. 589

7.8. Методические указания по лабораторной диагностике цитробактероза пчел (утверждены 05.05.1994 г. № 19-7-2/83) ………. 589

Аспергиллёз ………. 591

7.9. Методические указания по лабораторной диагностике аспергиллеза пчел (утверждены 10.05.1984 г. № 115-6а) ………. 591

Меланоз ………. 592

7.10. Методические указания по лабораторной диагностике меланоза пчёл (утверждены 12.12.1986 г. № 432-5) ………. 592

Аскосфероз ………. 594

7.11. Методические указания по лабораторной диагностике аскосфероза пчёл и выделению возбудителя из пыльцы (перги) (утверждены 09.04.1986 г.) ………. 594

8. Болезни рыб ………. 596

Аэромоноз ………. 596

8.1. Методические указания по лабораторной диагностике аэромоноза (краснухи) карпов (утверждены 23.04.1986 г. № 13-3/5) ………. 596

8.2. Методические указания по определению патогенности аэромонад по степени ДНКазной активности (утверждены 09.12.1997 г. № 13-4-2/1116) ………. 599

Вибриоз ………. 601

8.3. Временная инструкция по борьбе с вибриозом рыб (утверждена 26.05.1998 г. № 13-4-2/1249) ………. 601

Эритродерматит ………. 611

8.4. Методические указания по диагностике эритродерматита карпа (утверждены 09.12.1997 г. № 13-4-2/1115) ………. 611

Псевдомоноз ………. 613

8.5. Инструкция по лабораторной диагностике псевдомонозов рыб (утверждена 22.09.1998 г. № 13-4-2/1403) ………. 613

Иерсиниоз ………. 616

8.6. Временные методические указания по диагностике иерсиниоза лососевых рыб (утверждены 04.10.1999 г. № 13-4-2/1749) ………. 616

Фурункулёз лососёвых рыб ………. 618

8.7. Инструкция о мероприятиях по профилактике и мерам борьбы с фурункулезом лососевых рыб (утверждена 26.11.1997 г. № 13-4-2/1090) ………. 618

9. Обязательный минимум исследований ………. 626

9.1. Методические указания по проведению обязательного минимума исследований в ветеринарных лабораториях при диагностике болезней животных (утверждены 24.06.1971 г.) ………. 626

10. Патоморфологическая диагностика ………. 652

10.1. Методические указания по патоморфологической диагностике болезней животных, птиц и рыб в ветеринарных лабораториях (утверждены 11.09.2000 г. № 13-7-2/2137) ………. 652

11. Определение чувствительности к антибиотикам ………. 687

11.1. Методические указания по определению чувствительности к антибиотикам возбудителей инфекционных болезней сельскохозяйственных животных (утверждены 30.10.1971 г.) ………. 687

Краткий словарь использованных ветеринарных терминов ………. 696 Библиографический список ………. 701 Предметный указатель ………. 702

Отделения профилактических осмотров

 

Будьте внимательны, предложения пройти медицинские  осмотры менее чем за 3-е суток говорит об их фиктивности:

Проведение осмотров в ряде случаев предполагает обязательные бактериологические исследования: на патогенный стафилококк, возбудителей кишечных инфекций. Методики проведения данных исследований утверждены МЗ РФ и включают в себя культивирование/выращивание микроорганизмов в течении 72 часов. Молекулярно-генетические методы исследований (ПЦР) регламентированы только для обследования контактных лиц в очагах инфекций.

В связи с вышеизложенным пройти медицинский осмотр быстрее, чем за 3 суток с соблюдением законодательных требований не представляется возможным.

Основание:

  1. Методические рекомендации от 29.12.2007 №0100/13745-07-34  «Бактериологическая диагностика брюшного тифа и паратифов А,Ви С»;
  2. Приказ МЗ СССР от 22.04.85 № 535 «Об унификации микробиологических (бактериологических) методов исследования, применяемых в клинико-диагностических лабораториях лечебно-профилактических учреждений»;
  3. Методические указания  МЗ СССР №04-23/3 от 17.05.1984 г. «Методические указания по  микробиологической диагностике  заболеваний, вызываемых энтеробактериями»;

Методические указания 4.2.2723-10 «Лабораторная диагностика сальмонеллезов, обнаружение сальмонелл в пищевых продуктах и объектах окружающей среды».

Представленные документы являются действующими в настоящее время.


№2 (ул. Энергетиков д.5)

Первого января 2012 года вступил в силу Приказ № 302-Н Минздравсоцразвития России, предписывающий существенно увеличить состав исследований в рамках ежегодных предварительных и периодических медицинских осмотров. Администрацией и сотрудниками БУЗОО «…

№1 (5-Линия 117А)

Отделение по проведению предварительных и периодических осмотров №1 расположено по адресу: г. Омск, ул.5-я Линия 117-а, 3 этаж, тел. 29-07-99, 36-39-86, 36-42-40. (Лицензия ЛО -55-01-002067 от 22.12.2016 года). Предлагает следующие услуги: Провед…

Нормативный фонд Бактериологического отдела Пятигорский филиал фгбу «Ставропольская мвл»


п/п


Наименование стандарта

1

Сусло виноградное несброженное асептического консервирования

2

ГОСТ Р 52687-2006 Продукты кисломолочные, обогащенные бифидобактериями бифидум

3

ГОСТ 28188-89 Напитки безалкогольные ОТУ

4

МР Обнаружение и идентификация Pseudomonas aeruginosa в объектах окружающей среды (пищевых продуктах, воде, сточных жидкостях)

5

ГОСТ Р 53008-2008 Полуфабрикаты из мяса и пищевых субпродуктов птицы ОТУ

6

ГОСЧТ Р 52186-2003 Консервы. Соки фруктовые восстановленные, ТУ

7

ГОСТ Р 52183-2003 Консервы. Соки овощные. Сок томатный ТУ

8

ГОСТ Р 53972-2010 Овощи соленые и квашеные ОТУ

9

ГОСТ Р 52465-2005 Масло подсолнечное ТУ

10

ГОСТ 26968-86 Сахар Методы микробиологического анализа

11

ГОСТ 21-94 Сахар-песок. ТУ. Правила приемки. Методы анализа

12

ГОСТ Р 51881-2002 Кофе натуральный растворимый ОТУ

13

ГОСТ Р 53944-2010 Пищевые проукты переработки яиц с.х.птицы Методы микробиологического анализа

14

ГОСТ 16290-86 Колбасы варено-копченые ТУ

15

ГОСТ Р 53588-2009 Колбасы полукопченые ТУ

16

ГОСТ Р 54075-2010 Молоко и молочная продукция Методы определения содержания спор мезофильных анаэробных микроорганизмов

17

ГОСТ Р 54004-2010 Продукты пищевые Методы отбора проб для микробиологических испытаний

18

ГОСТ 26669-85 Продукты пищевые Методы микробиологического анализа

19

ГОСТ 31654-2012 Яйца куриные пищевые ТУ

20

ГОСТ 30058-95/ГОСТ Р 50230-92 Восточные сладости типа мягких конфет. ОТУ

21

ГОСТ 15810-96 Изделия кондитерские пряничные ОТУ

22

Стандарт отрасли. Торты и пирожные. ТУ № ОСТ 10-060-95

23

ГОСТ 31805-2012 Изделия хлебобулочные из пшеничной муки. ОТУ

24

ГОСТ 4570-93 Конфеты ОТУ

25

МУ 2.1.4.1184-03.2.1.4. Питьевая вода и водоснабжение населенных мест. Методические указания по внедрению и применению санитарно-эпидемиологических правил и нормативов СанПин 2.1.4.1116-02 «Питьевая вода. Гигиенические требования к качеству воды, расфасованной в ёмкости. Контроль качества»

26

ГОСТ 17.4.3.01-83(СТ СЭВ 3847-82) Охрана почвы. Почвы. Общие требования к отбору проб

27

Методы микробиологического контроля почвы. Методические рекомендации

28

МУ 2.1.7.730-99 «Гигиеническая оценка качества почвы населенных мест»

29

ВетПин 13-5-01/0101 Ветеринарные правила и нормы по безопасности кормов, кормовых добавок и сырья для производства кормов

30

ТУ 9161-002-0139637451-2009 Консервы.»Капуста квашеная» ТУ

31

ГОСТ Р 53415-2009 Вода. Отбор проб для микробиологического анализа

п/п


Наименование нормативного документа

1

ГОСТ 21237-75 Мясо Методы бактериологического анализа

2

ГОСТ Р 51448-99 Мясо и мясные продукты Методы подготовки проб для микробиологических исследований

3

ГОСТ Р 51447-99 Мясо и мясные продукты Методы отбора проб

4

ГОСТ Р 52675-2006 Полуфабрикаты мясные и мясосодержащие ОТУ

5

ГОСТ 31798-2012 Говядина и телятина для производства продуктов детского питания ТУ

6

ТУ 9213-407-00419779-98 Колбасы ливерные ТУ

7

ГОСТ 31499-2012 Консервы мясные фаршевые ТУ

8

ТУ 9216-307-01597945-02 Консервы мясные Мясо ветчинно-рубленное

9

ТУ 10.02.01.306-97 Консервы мясорастительные Голубцы Долма

10

ТУ 9165-017-51361389-01 Вареники быстрозамороженные с разными начинками

11

ТУ 9214-001-00263075-00 Пельмени «Винсадские»

12

ТУ 9146-003-00934798-96 Соевые бобы (орешки) полножирная соя

13

ГОСТ 32190-2013 Масла растительные Правила приемки и методы отбора проб

14

ГОСТ ISO 7218-2011 Микробиология пищевых продуктов и кормов для животных Общие требования и рекомендации по микробиологическим исследованиям

15

ГОСТ 29185-91 Продукты пищевые Методы выявления и определения количества сульфитредуцирующих клостридий

16

ГОСТ 10444.15-94 Продукты пищевые Методы определения количества мезофильных аэробных и факультативно-анаэробных микроорганизмов

17

ГОСТ 10444.8-88 Продукты пищевые Метод определения Bacillus cereus

18

ГОСТ 10444.7-86 Продукты пищевые Методы выявления ботулинических токснов и Clostridium botulinum

19

ГОСТ 10444.9-88 Продукты пищевые Метод определения Clostridium perfringens

20

ГОСТ 608-93 Консервы мясные «Мясо птицы в желе» ТУ

21

ГОСТ Р 54354-2011 Мясо и мясные продукты Общие требования и методы микробиологического анализа

22

ГОСТ 10444.11-2013 Микробиология пищевых продуктов и кормов для животных Методы выявления и подсчета количества мезофильных молочнокислых микроорганизмов

23

Инструкция по предупреждению картофельной болезни хлеба

п/п


Наименование нормативного документа

1

ГОСТ Р 53972-2010 Овощи соленые и квашеные ОТУ

2

ГОСТ Р 53944-2010 Пищевые продукты переработки яиц сельскохозяйственной птицы Методы микробиологического анализа

3

ГОСТ 32012-2012 Молоко и молочная продукция Методы определения содержания спор мезофильных анаэробных микроорганизмов

4

ГОСТ 31904-2012 Продукты пищевые Методы отбора проб для микробиологических испытаний

5

ГОСТ 31936-2012 Полуфабрикаты из мяса и пищевых субпродуктов птицы ОТУ

6

ГОСТ Р 52687-2006 Продукты кисломолочные, обогащенные бифидобактериями бифидум ТУ

7

ГОСТ 16290-86 Колбасы варено-копченые ТУ

8

ГОСТ Р 52183-2003 Консервы. Соки овощные Сок томатный ТУ

9

ГОСТ 1129-2013 Масло подсолнечное ТУ

10

ГОСТ 26968-86 Сахар Методы микробиологического анализа

11

ГОСТ 21-94 Сахар-песок ТУ

12

ГОСТ Р 51881-2002 Кофе натуральный растворимый ОТУ

13

ГОСТ 31785-2012 Колбасы полукопченые ТУ

14

ГОСТ 31654-2012 Яйца куриные пищевые ТУ

15

ГОСТ 26669-85 Продукты пищевые и вкусовые Подготовка проб для микробиологических анализов

16

ГОСТ 30058-95

ГОСТ Р 50230-92 Восточные сладости типа мягких конфет ОТУ


17

ГОСТ 15810-96 Изделия кондитерские пряничные ОТУ

18

ГОСТ 31805-2012 Изделия хлебобулочные из пшеничной муки ОТУ

19

ГОСТ 4570-93 Конфеты ОТУ

20

ГОСТ 28188-89 Напитки безалкогольные ОТУ

21

ГОСТ 32103-2013 Консервы Продукция соковая Соки фруктовые и фруктово-овощные восстановленные ОТУ

22

ГОСТ 27568-87 Сыры сычужные твердые для экспорта ТУ Э

23

ГОСТ Р 54678-2011 Продукты томатные концентрированные ОТУ

п/п


Наименование нормативного документа

1

ГОСТ 10444.12-88 Продукты пищевые Метод определения дрожжей и плесневых грибов

2

ГОСТ 31747-2012 Продукты пищевые Метод выявления и определения количества бактерий группы кишечных палочек

3

ГОСТ 31659-2012 Продукты пищевые Метод выявления бактерий рода Salmonella

4

ГОСТ 10444.15-94 Продукты пищевые Методы определения количества мезофильных аэробных и факультативно-анаэробных микроорганизмов

5

ГОСТ 31942-2012 Вода Отбор проб для микробиологического анализа

6

ГОСТ 30712-2001 Продукты безалкогольной промышленности Методы микробиологического анализа

7

МУ 2.1.4.1184-03 Питьевая вода Гигиенические требования к качеству воды , расфасованной в емкости. Контроль качества

8

МУК 4.2.1018-01 Санитарно-микробиологический анализ питьевой воды

9

ГОСТ 31955-2012 Вода питьевая Обнаружение и количественный учет E.coli и колиформных бактерий Часть 1 Метод мембранной фильтрации

10

ГОСТ 18963-73 Вода питьевая Методы сан.-бактериологического анализа

11

СанПиН 2.1.4.1116-02 Гигиенические требования к качеству воды, расфасованной в емкости. Контроль качества

п/п


Наименование нормативного документа

1

№ 13-5-2/0525 от 15.07.2002г Правила проведения дезинфекции и дезинвазии объектов государственного ветеринарного надзора

2

Санитарные правила для предприятий пищеконцентратной промышленности № 1408-76 от 01.03.1976г

3

Инструкция по проведению ветеринарной дезинфекции, дезинвазии, дезинсекции и дератизации

4

Общая бактериальная загрязненность поверхностей различных объектов и воздуха до механической очистки и после механической очистки

5

Правила бактериологического исследования кормов от 10.06.1975г

6

Инструкция по санитарно-микробиологическому контролю тушек, мяса птицы, птицепродуктов, яиц и яйцепродуктов на птицеводческих и птицеперерабатывающих предприятиях, Москва, 1990г

7

МУ по отбору проб пищевой продукции животного и растительного происхождения , кормов, кормовых добавок с целью лабораторного контроля их качества и безопасности , 21.05.2009г

8

Методика индикации бактерий рода «Протеус» в кормах животного происхождения (дополнение к «Правилам бактериологического исследования кормов» 1975г.)

9

№13-5-02/0914 от 02.02.04г О дополнении в Методические указания по лабораторной диагностике сальмонеллезов в кормах, продуктах питания и объектах внешней среды

10

ГОСТ 6709-72 Вода дистиллированная ТУ

11

ТУ 9182-082-00334586-2007 Барда сухая кормовая ТУ

12

ГОСТ 80-96 Жмых подсолнечный ТУ

13

ГОСТ 27149-95 Жмых соевый кормовой ТУ

14

ГОСТ 25311-82 Мука кормовая животного происхождения Методы бактериологического анализа

15

ГОСТ Р 51848-2001 Продукция комбикормовая Термины и определения

16

ГОСТ Р 51426-99 Микробиология. Корма, комбикорма , комбикормовое сырье Общее руководство по приготовлению разведений для микробиологических исследований

17

ГОСТ Р 52356-2005 Премиксы Номенклатура показателей

18

ТУ 9296-042-00334586-06 Смесь белковая кормовая «Биобардин»

19

МУ 2.1.4.1057-01 Организация внутреннего контроля качества санитарно-микробиологических исследований воды

20

МУК 4.2.1018-01 Санитарно-микробиологический анализ питьевой воды

21

ГОСТ Р 51232-98 Вода питьевая Общие требования к организации и методам контроля качества

22

МУ по санитарно-бактериологической оценке рыбохозяйственных водоемов №13-4-2/1742 от 27 сентября 1999г

23

МУ по лабораторной диагностике иерсиниоза животных и обнаружению возбудителя болезни в мясном сырье, молокеи растительных кормах №5-1-14/971 от 03.10.2005г

24

Временная инструкция о мероприятиях по борьбе с хлоромиксозом карповых рыб №13-4-2/1738 от 21.09.1999г

25

Временные МУ по обнаружению возбудителя сибирской язвы в почве

26

ГОСТ 26029-83 Сперма баранов неразбавленная свежеполученная Технические требования и методы испытаний

27

ГОСТ 20909.1-75, ГОСТ 20909.2-75 Сперма быков неразбавленная Методы отбора проб и микробиологических исследований

28

ГОСТ 23745-79 Сперма быков неразбавленная свежеполученная Технические требования и методы испытаний

29

МУ №115-63 по бактериологическому исследованию молока и секреты вымени коров

30

ГОСТ 31942-2012 Вода Отбор проб для микробиологического анализа

Каталог уникальных научных установок

ГОСТ 26072-89 Животные и птица сельскохозяйственные. Методы лабораторной диагностики туберкулеза

Методика уникальна:  нет

МУ по проведению микологических исследований патологического материала и кормов в ветеринарно-бактериологических лабораториях при диагностике микозов и микотоксикозов сельскохозяйственных животных. Утв. Гос. инспекцией по ветеринарии Министерства с/х СССР 24.07.1959г.

Методика уникальна:  нет

МУ по проведению обязательного минимума исследований в ветеринарных лабораториях при диагностике болезней животных. Утв. ГУВ МСХ СССР 24.06.1971г.

Методика уникальна:  нет

МУ Диагностика пастереллеза с/х животных, птиц, пушных зверей. Утв. 01.12.2016 г..

Наименование организации, аттестовавшей методику:  РАН РФ
Дата аттестации:  01.12.2016
Методика уникальна:  нет

Методические рекомендации по диагностике клостридиозов сельскозхозяйственных животных, утв. РАН РФ 28.08 .2017 г.

Наименование организации, аттестовавшей методику:  РАН РФ
Дата аттестации:  28.08.2017
Методика уникальна:  для России

Методические рекомендации по диагностике манхеймиоза крупного и мелкого рогатого скота, от 28.08.2017 г

Наименование организации, аттестовавшей методику:  РАН РФ
Дата аттестации:  28.08.2017
Методика уникальна:  для России

МУ по диагностике эритродерматита карпа. Утв. Департаментом ветеринарии Минсельхозпрод России от № 13-4-2/1115 от 09.12.1997г

Методика уникальна:  нет

МУ по лабораторной диагностике псевдомонозов рыб. Утв. Департаментом Минсельхозпрод России № 13-4-2/1403 от 22.09.1998г.

Методика уникальна:  нет

МУ по лабораторной диагностике аэромоноза (краснухи) карпов. Утв. Госагропром СССР №13-3/5 от 23.04.1986г

Методика уникальна:  нет

Временная инструкция по борьбе с вибриозом рыб. Утв. Департамент ветеринарии Минсельхозпрод России № 13-4-2/1249 от 26.05.98г

Методика уникальна:  нет

МУ по экспресс — диагностике варроатоза и определению степени поражения пчелинных семей клещами варроа в условиях пасеки. Утв. ГУВ МСХ СССР №115-6а от 16.01.1984г.

Методика уникальна:  нет

МУ по лабораторной диагностике цитробактериоза пчел. Утв. департамент ветеринарии МСХ и продовольствия РФ №19-7-2/83 от 05.05.1994г.

Методика уникальна:  нет

МУ по лабораторной диагностике септицимии пчел. Утв. ГУВ Госагропрома СССР №433-6 от 18.08.1986г.

Методика уникальна:  нет

МУ по лабораторной диагностике американского гнильца пчел. Утв. ГУВ Госагропрома СССР, № 433-6 от 18.08.1986г.

Методика уникальна:  нет

МУ по лабораторной диагностике европейского гнильца пчел. Утв. ГУВ Госагропрома СССР № 433-6 от 15.08.1986г.

Методика уникальна:  нет

МУ по лабораторной диагностике сальмонеллеза пчел. Утв. ГУВ Госагропрома СССР, № 433-6 от 14.08.1986г.

Методика уникальна:  нет

МУ по бактериологической диагностике порошковидного расплода пчел. Утв. ГУВ МСХ СССР, № 115-6а от 14.09.1982г

Методика уникальна:  нет

МУ по лабораторной диагностике гафниоза пчел. Утв. ГУВ МСХ СССР от 16.05.1978г.

Методика уникальна:  нет

ГОСТ 26072-89 Животные и птица сельскохозяйственные. Методы лабораторной диагностики туберкулеза

Методика уникальна:  нет

ГОСТ 26073-84 Животные сельскохозяйственные. Методы лабораторной диагностики паратуберкулеза

Методика уникальна:  нет

ГОСТ 25385-91 Животные сельскохозяйственные. Методы диагностики бруцеллеза; Наставление по диагностике бруцеллеза животных. Утв. ГУВ МСХ РФ, № 13-5-02/0850, от 29.09.2003г.

Методика уникальна:  нет

МУ по выделению, культивированию, поддержанию и идентификации микоплазм. Утв. Главное управление ветеринарии министерства сельского хозяйства СССР 25.01.1971г.

Методика уникальна:  нет

Методические рекомендации Выделение и идентификация бактерий желудочно-кишечного тракта животных. Утв. департамент ветеринарии МСХ РФ 11.05.2004г. №13-5-02/1043

Методика уникальна:  нет

МУ по лабораторной диагностике иерсиниоза животных и обнаружению возбудителя болезни в мясном сырье, молоке и растительных кормах. Утв. Начальник Управления ветеринарии Федерального агентства по сельскому хозяйству 03.10.2005г. № 5-1-14/971

Методика уникальна:  нет

МУ по бактериологической диагностике колибактериоза (эшерихиоза) животных. Утв. Заместитель руководителя Департамента ветеринарии Министерства сельского хозяйства и продовольствия РФ, 27.07.2000г. №13-7-2/2117

Методика уникальна:  нет

МУ по бактериологической диагностике смешанной кишечной инфекции молодняка животных, вызываемой патогенными энтеробактериями. Утв. Заместителем руководителя Департамента ветеринарии Министерства сельского хозяйства и продовольствия РФ 11.10.1999г. №13-7-2/1759

Методика уникальна:  нет

МУ по лабораторной диагностике стрептококкоза животных. Утв. Заместитель начальника Главного управления ветеринарии с Государственной ветеринарной инспекцией при Госкомиссии СМ СССР по продовольствию и закупкам 25.09.1990г.

Методика уникальна:  нет

МУ 4.2.2723-10 Лабораторная диагностика сальмонеллезов, обнаружение сальмонелл в пищевых продуктах и объектах окружающей среды. Утв. Руководителем Федеральной службой по надзору в сфере защиты прав потребителей и благополучия человека 13.08.2010г.

Методика уникальна:  нет

МУ по лабораторным исследованиям на псевдомоноз животных и птиц. Утв. Начальник Главного управления ветеринарии Госагропрома СССР 14.11.1988г. № 432-3

Методика уникальна:  нет

МУ по лабораторной диагностике стафилококкоза животных. Утв. Начальник Главного управления ветеринарии Государственного агропромышленного комитета СССР 30.06.1987г

Методика уникальна:  нет

МУ по лабораторной диагностике некробактериоза. Утв. Начальник Главного управления ветеринарии Госагропрома СССР 01.06.1987г

Методика уникальна:  нет

Методические рекомендации по лабораторной диагностике листериоза животных и людей. Утв. Начальник Главного управления ветеринарии Госагропрома СССР 13.02.1987г., Начальник Главного управления карантинных инфекций Министерства здравоохранения СССР 04.09.1986г

Методика уникальна:  нет

ГОСТ 26503-85 Животные сельскохозяйственные. Методы лабораторной диагностики клостридиозов

Методика уникальна:  нет

2723 (номер)

2 723 ( две тысячи семьсот двадцать три ) — нечетное четырехзначное составное число, следующее за 2722 и предшествующее 2724. В экспоненциальном представлении оно записывается как 2,723 × 10 3 . Сумма цифр равна 14. Всего у него 2 простых делителя и 4 положительных делителя. Есть 2328 натуральных чисел (до 2723), которые взаимно просты с 2723.

  • Prime? Нет
  • Четность номера Нечетный
  • Длина номера 4
  • Сумма цифр 14
  • Цифровой корень 5
Краткое наименование 2 тыс. 723
Полное наименование две тысячи семьсот двадцать три
Научное обозначение 2.723 × 10 3
Инженерное обозначение 2,723 × 10 3

Простые множители 7 × 389

Составное число
ω (н) Особые факторы 2

Общее количество различных простых множителей

Ом (н) Всего факторов 2

Общее количество простых множителей

рад (н) Радикал 2723

Произведение различных простых чисел

λ (п) Лиувиль Лямбда 1

Возвращает четность Ω (n), такую, что λ (n) = (-1) Ω (n)

мк (н) Mobius Mu 1 Возвращает:
  • 1, если n имеет четное число простых множителей (и не содержит квадратов)
  • -1, если n имеет нечетное число простых множителей (и не содержит квадратов)
  • 0, если n имеет квадрат простого множителя
Λ (н) Функция Мангольдта 0

Возвращает log (p), если n является степенью p k любого простого числа p (для любого k> = 1), иначе возвращает 0

Разложение на простые множители 2,723 равно 7 × 389.Поскольку у него всего 2 простых множителя, 2723 — составное число.

4 делителя

Четные делители 0
Нечетные делители 4
4к + 1 делитель 2
4к + 3 делителя 2
. .
τ (н) Всего делителей 4

Общее количество положительных делителей n

σ (п) Сумма делителей 3120

Сумма всех положительных делителей n

с (н) Сумма аликвот 397

Сумма собственных положительных делителей числа n

А (н) Среднее арифметическое 780

Возвращает сумму делителей (σ (n)), деленную на общее количество делителей (τ (n))

G (п) Среднее геометрическое 52.182372502599

Возвращает корень n-й степени от произведения n делителей

H (н) Среднее гармоническое 3,46410256

Возвращает общее количество делителей (τ (n)), деленное на сумму, обратную каждому делителю

Число 2723 можно разделить на 4 положительных делителя (из которых 0 четные, а 4 нечетные).Сумма этих делителей (считая 2723) равна 3120, среднее — 780.

φ (n) Эйлер Тотент 2328

Общее количество натуральных чисел не более n, взаимно простых с n

λ (п) Кармайкл Лямбда 1164

Наименьшее положительное число такое, что λ (n) ≡ 1 (mod n) для всех взаимно простых с n

π (п) Prime Pi ≈ 399

Общее количество простых чисел, меньших или равных n

r 2 (n) Сумма 2 квадратов 0

Количество способов n можно представить как сумму 2 квадратов

Есть 2328 натуральных чисел (меньше 2723), которые взаимно просты с 2723.И есть примерно 399 простых чисел, меньших или равных 2723.

м 2 3 4 5 6 7 8 9
n мод. M 1 2 3 3 5 0 3 5

Число 2723 делится на 7.

С помощью арифметических функций

  • Арифметика
  • Полуприм
  • Недостаток

Выражается через определенные суммы

По силам

Прочие номера

База Система Значение
2 двоичный 101010100011
3 Тройной 10201212
4 Четвертичный 222203
5 Пятидесятилетний 41343
6 Senary 20335
8 восьмеричное 5243
10 Десятичное 2723
12 Двенадцатеричный 16ab
16 Шестнадцатеричный aa3
20 Vigesimal 6g3
36 Base36 23n

Умножение

п × у
n × 2 5446
n × 3 8169
n × 4 10892
n × 5 13615

Отдел

n ÷ y
н ÷ 2 1361.500
н ÷ 3 907,666
n ÷ 4 680,750
н ÷ 5 544.600

Возведение в степень

п г
n 2 7414729
n 3 201067
n 4 54978206143441
n 5 149705655328589843

N-й корень

л √n
2 √n 52.182372502599
3 √n 13.964194217063
4 √n 7.2237367409533
5 √n 4,8641787741133

Круг

Радиус = n

Диаметр 5446
Окружность 17109.11359145
Площадь 23294058.154759

Сфера

Радиус = n

Объем 84572960473,879
Площадь 93176232.619037
Окружность 17109.11359145

Квадрат

Длина = n

Периметр 10892
Площадь 7414729
Диагональ 3850.03419

Куб

Длина = n

Площадь 44488374
Объем 201067
Диагональ пространства 4716.37434

Равносторонний треугольник

Длина = n

Периметр 8169
Площадь 3210671.8380886
Высота 2358.187174505

Треугольная пирамида

Длина = n

Площадь 12842687.352354
Объем 2379450506,8857
Высота 2223.3201898662
мкр5 c315f0320b7cd4ec85756fac52d78076
sha1 21a42ee2d81d86386819818525b2f72224788929
sha256 f7ad345930f818723c294c405bf47acbc2208503caf874626958d8ac327c66da
sha512 12879aa2bd3f8c7c717dba61d1a0dde618e0cad38f0b5df6387dbaf0acc142eab636eb0332e08f52d973023fe3149a0dbcdb46c0b22c98cfdb3d88940c
ripemd-160 640ac4d9e4ba6b2178d3490d16b2a962660b044a

Mycoprotein: воздействие на окружающую среду и аспекты здоровья

  • Ahsan N, Rao RSP, Gruppuso PA, Ramratnam B, Salomon AR (2016) Целевая протеомика: текущее состояние и будущие перспективы количественной оценки пищевых аллергенов.J Proteom 143: 15–23

    CAS Google ученый

  • Анупама, Равиндра П. (2000) Пища с добавленной стоимостью: одноклеточный белок. Biotechnol Adv 18: 459–479

    CAS PubMed Google ученый

  • Asgar MA, Fazilah A, Huda N, Bhat R, Karim AA (2010) Немясные белковые альтернативы в качестве наполнителей мяса и аналогов мяса. Compr Rev Food Sci Food Saf 9: 513–529. https://doi.org/10.1111 / j.1541-4337.2010.00124.x

    CAS Статья Google ученый

  • Огюстин М.А., Райли М., Стокманн Р., Беннетт Л., Каль А., Локетт Т., Осмонд М., Сангуансри П., Стоунхаус В., Заяк И., Кобиак Л. (2016) Роль пищевой промышленности в обеспечении продовольственной безопасности и безопасности питания. Trends Food Sci Technol 56: 115–125

    CAS Google ученый

  • Batool R, Butt MS, Sultan MT, Saeed F, Naz R (2015) Белково-энергетическая недостаточность: фактор риска различных заболеваний.Crit Rev Food Sci Nutr 55: 242–253

    PubMed Google ученый

  • Бхат З.Ф., Фаяз Х. (2011) Проспект культивированного мяса — продвижение альтернативных мясных продуктов. J Food Sci Technol 48 (2): 125–140

    Google ученый

  • Boland MJ, Rae AN, Vereijken JM, Meuwissen MPM, Fischer ARH, van Boekel MAJS, Rutherfurd SM, Gruppen H, Moughan PJ, Hendriks WH (2013) Будущие поставки животного белка для потребления человеком.Trends Food Sci Technol 29: 62–73

    CAS Google ученый

  • Bottin JH, Swann JR, Cropp E, Chambers ES, Ford HE, Ghatei MA, Frost GS (2016) Микопротеин снижает потребление энергии и высвобождение инсулина после приема пищи без изменения концентраций глюкагоноподобного пептида-1 и пептида тирозин-тирозина в организме человека. здоровые взрослые с избыточным весом и ожирением: рандомизированное контролируемое исследование. Br J Nutr 116: 360–374

    CAS PubMed PubMed Central Google ученый

  • Claret A, Guerrero L, Gartzia I, Garcia-Quiroga M, Ginés R (2016) Влияет ли информация на потребительские предпочтения выращиваемой и дикой рыбы? Аквакультура 454: 157–162

    Google ученый

  • Clune S, Crossin E, Verghese K (2017) Систематический обзор выбросов парниковых газов для различных категорий свежих продуктов.J Clean Prod 140: 766–783

    CAS Google ученый

  • Денни А., Эйсбитт Б., Ланн Дж. (2008) Микопротеины и здоровое питание. Бюллетень 33: 298–310. https://doi.org/10.1111/j.1467-3010.2008.00730.x

    Артикул Google ученый

  • Domingo JL (2016) Питательные вещества и химические загрязнители в рыбе и моллюсках уравновешивают пользу для здоровья и риски при регулярном потреблении рыбы.Crit Rev Food Sci Nutr 56 (6): 979–988

    CAS PubMed Google ученый

  • Dunlop MV, Kilroe SP, Bowtell JL, Finnigan TJA, Salmon DL, Wall BT (2017) Микопротеин представляет собой биодоступный и инсулинотропный источник диетического белка неживотного происхождения: исследование зависимости зависимости от дозы. Br J Nutr 118: 673–685

    CAS PubMed Google ученый

  • Данн Дж. А., Уильямс Р. Дж., Мартинес Н. Д. (2002) Сетевая структура и утрата биоразнообразия в пищевых сетях: устойчивость возрастает с соединением.Ecol Lett 5: 558–567. https://doi.org/10.1046/j.1461-0248.2002.00354.x

    Артикул Google ученый

  • Elzerman JE, Hoek AC, van Boekel MAJS, Luning PA (2011) Принятие потребителями и уместность заменителей мяса в контексте еды. Food Qual Prefer 22: 233–240

    Google ученый

  • Эмануэльссон А., Циглер Ф., Пил Л., Скёльд М., Сонессон У. (2014) Учет перелова при оценке жизненного цикла: новые категории воздействия для использования биотических ресурсов.Int J Life Cycle Assess 19 (5): 1156–1168

    Google ученый

  • ФАО (2010) «Климатически оптимальное» сельское хозяйство: политика, практика и финансирование для обеспечения продовольственной безопасности, адаптации и смягчения последствий. Продовольственная и сельскохозяйственная организация, Рим

    Google ученый

  • Fenko A, Backhaus BW, van Hoof JJ (2015) Влияние факторов, связанных с продуктом и человеком, на гедонистические реакции потребителей на соевые продукты.Food Qual Prefer 41: 30–40

    Google ученый

  • Finnigan T, Lemon M, Allan B, Paton I (2010) Микопротеин, анализ жизненного цикла и проблема пищевых продуктов 2030. Asp Appl Biol 102: 81–90

    Google ученый

  • Godfray HCJ, Beddington JR, Crute IR, Haddad L, Lawrence D, Muir JF, Pretty J, Robinson S, Thomas SM, Toulmin C (2010) Продовольственная безопасность: проблема кормления.Billion People Sci 327: 812–818. https://doi.org/10.1126/science.1185383

    CAS Статья Google ученый

  • Godfray HCJ, Aveyard P, Garnett T, Hall JW, Key TJ, Lorimer J, Pierrehumbert RT, Scarborough P, Springmann M, Jebb SA (2018) Потребление мяса, здоровье и окружающая среда. Наука. https://doi.org/10.1126/science.aam5324

    CAS Статья Google ученый

  • Grahl S, Palanisamy M, Strack M, Meier-Dinkel L, Toepfl S, Mörlein D (2018) На пути к более экологичным альтернативам мяса: как технические параметры влияют на сенсорные свойства продуктов экструзии, полученных из сои и водорослей.J Clean Prod 198: 962–971

    Google ученый

  • Guinard J-X, Myrdal Miller A, Mills K, Wong T, Lee SM, Sirimuangmoon C, Schaefer SE, Drescher G (2016) Снижено принятие потребителями блюд, в которых говядина была частично заменена грибами и натрием. Аппетит 105: 449–459

    PubMed Google ученый

  • Гул К., Сингх П., Вани А.А. (2016) Глава 4 — Безопасность мяса и птицы.Регулирование безопасности традиционных и этнических продуктов питания. Academic Press, Сан-Диего, стр. 63–77

    Google ученый

  • Hegde VL, Das JR, Venkatesh YP (2002) Анафилаксия, вызванная употреблением в пищу культивируемых грибов ( Agaricus bisporus ): идентификация аллергена как маннита. Аллергол Инт 51 (2): 121–129

    Google ученый

  • Hoek AC, Luning PA, Weijzen P, Engels W., Kok FJ, de Graaf C (2011) Замена мяса заменителями мяса.Обзор факторов, влияющих на принятие потребителями, связанных с личностью и продуктом. Аппетит 56: 662–673

    PubMed Google ученый

  • Huis A (2013) Потенциал насекомых в качестве пищи и корма для обеспечения продовольственной безопасности. Анну Рев Энтомол 58 (1): 563–583

    PubMed Google ученый

  • Jacobson MF, DePorter J (2018) Побочные реакции, о которых сообщают сами люди, связанные с продуктами, содержащими микопротеин (бренд Quorn).Ann Allergy Asthma Immunol 120 (6): 626–630

    CAS PubMed Google ученый

  • Johnston JL, Fanzo JC, Cogill B (2014) Понимание устойчивых диет: описательный анализ детерминант и процессов, которые влияют на диеты и их влияние на здоровье. Food Secur Environ Sustain Adv Nutr 5: 418–429. https://doi.org/10.3945/an.113.005553

    CAS Статья Google ученый

  • Йонас Д.А., Эльмадфа И., Энгель К.Х., Хеллер К.Дж., Козьяновски Г., Кениг А., Мюллер Д., Нарбонн Дж. Ф., Вакернагель В., Кляйнер Дж. (2001) Вопросы безопасности ДНК в продуктах питания.Энн Нутр Метаб 45: 235–254

    CAS PubMed Google ученый

  • Jungbluth N, Eggenberger S, Nowack K, Keller R (2016) Оценка жизненного цикла блюд на основе вегетарианских источников белка. В материалах: 10-й международной конференции по оценке жизненного цикла пищевых продуктов (LCA Food 2016).

  • Kucuk O (2017) Соевые продукты, изофлавоны и рак груди. Рак 123 (11): 1901–1903

    PubMed Google ученый

  • Кумар П., Чатли М.К., Мехта Н., Сингх П., Малав О.П., Верма А.К. (2017) Аналоги мяса: перспективные для здоровья экологически безопасные заменители мяса.Crit Rev Food Sci Nutr 57 (5): 923–932

    CAS PubMed Google ученый

  • Ли Дж. З., Логан А., Терри С., Спир Дж. Р. (2015) Микробный ответ на производство одноклеточного белка и очистку сточных вод пивоварен. Microb Biotechnol 8: 65–76

    CAS PubMed Google ученый

  • Marlow Foods Ltd. (2019). https://www.quorn.co.uk/recipes. По состоянию на 03 апреля 2019 г.

  • Matassa S, Boon N, Pikaar I, Verstraete W (2016) Микробный белок: будущий устойчивый путь поставок продуктов питания с низким воздействием на окружающую среду.Microb Biotechnol 9 (5): 568–575

    PubMed PubMed Central Google ученый

  • Meinlschmidt P, Ueberham E, Lehmann J, Schweiggert-Weisz U, Eisner P (2016) Иммунореактивность, сенсорные и физико-химические свойства изолята ферментированного соевого белка. Food Chem 205: 229–238

    CAS PubMed Google ученый

  • Mleczek M, Niedzielski P, Siwulski M, Rzymski P, Gąsecka M, Goliński P, Kozak L, Kozubik T (2016) Важность низкого содержания мышьяка в субстрате при выращивании грибов и безопасность конечного продукта питания.Eur Food Res Technol 242 (3): 355–362

    CAS Google ученый

  • Мур Д., Чиу С.В. (2001) Грибковые продукты в пищу. В Пойнтинг, С.Б. и Хайд, К.Д. (ред.) Биологическая эксплуатация мицелиальных грибов. Fungal Divers Res Ser 6: 223–251.

  • Никшич М., Клаус А., Аргиропулос Д. (2016) Глава 22 — Безопасность пищевых продуктов на основе грибов. Регулирование безопасности традиционных и этнических продуктов питания. Academic Press, Сан-Диего, стр. 421–439

    Google ученый

  • Совет министров Северных стран (2014 г.) Рекомендации по питанию Северных стран, 2012 г. — объединение питания и физической активности, Копенгаген 5 (11): 1

  • Ноут MJR, Aidoo KE (2002) Азиатские продукты, ферментированные грибами.В: Промышленное применение. Спрингер, Нью-Йорк, стр. 23–47

    Google ученый

  • Paddon-Jones D, Westman E, Mattes RD, Wolfe RR, Astrup A, Westerterp-Plantenga M (1561S) Белок, контроль веса и насыщение. Am J Clin Nutr 87: 1558S – 1561S. https://doi.org/10.1093/ajcn/87.5.1558S

    CAS Статья PubMed Google ученый

  • Pan AP, Sun QMDS, Bernstein AMMDS, Schulze MBD, Manson JEMDD, Stampfer MJMDD, Willett WCMDD, Hu FBMDP (2012) Потребление красного мяса и смертность: результаты 2 проспективных когортных исследований.Arch Int Med 172: 555–563

    Google ученый

  • Pereira PMCC, Vicente AFRB (2013) Питательный состав мяса и питательная роль в рационе человека. Meat Sci 93 (3): 586–592

    CAS PubMed Google ученый

  • Петраччи М., Берри С. (2017) Оценка качества птицы: атрибуты качества и потребительские ценности. Вудхед Паблишинг, Даксфорд

    Google ученый

  • Piazza J, Ruby MB, Loughnan S, Luong M, Kulik J, Watkins HM, Seigerman M (2015) Рационализация потребления мяса.4Ns. Аппетит 91: 114–128

    PubMed Google ученый

  • Popkin BM, Adair LS, Ng SW (2012) Глобальный переход к питанию и пандемия ожирения в развивающихся странах. Nutr Rev 70: 3–21. https://doi.org/10.1111/j.1753-4887.2011.00456.x

    Артикул PubMed PubMed Central Google ученый

  • Post MJ (2012) Мясо из стволовых клеток: проблемы и перспективы.Meat Sci 92 (3): 297–301

    PubMed Google ученый

  • Raats J (2007) Мясо (заменители), сравнивая воздействие на окружающую среду. Пример сравнения Quorn и свинины, Университет Гронингена

  • Ritchie H, Laird J, Ritchie D (2017) 3f bio: Снижение вдвое стоимости микопротеина за счет интегрированных процессов ферментации. Ind Biotechnol 13: 29–31

    Google ученый

  • Rohrmann S, Overvad K, Bueno-de-Mesquita HB, Jakobsen MU, Egeberg R, Tjønneland A, Nailler L, Boutron-Ruault MC, Clavel-Chapelon F, Krogh V, Palli D, Panico S, Tumino R , Ricceri F, Bergmann MM, Boeing H, Li K, Kaaks R, Khaw KT, Wareham NJ, Crowe FL, Key TJ, Naska A, Trichopoulou A, Trichopoulos D, Leenders M, Peeters PHM, Engeset D, Parr CL, Skeie G, Jakszyn P, Sánchez MJ, Huerta JM, Redondo ML, Barricarte A, Amiano P, Drake I, Sonestedt E, Hallmans G, Johansson I, Fedirko V, Romieux I, Ferrari P, Norat T, Vergnaud AC, Riboli E, Linseisen J (2013) Потребление мяса и смертность — результаты Европейского проспективного исследования рака и питания.BMC Med 11:63. https://doi.org/10.1186/1741-7015-11-63

    Артикул PubMed PubMed Central Google ученый

  • Röös E, Sundberg C, Tidåker P, Strid I, Hansson P-A (2013) Может ли углеродный след служить индикатором воздействия производства мяса на окружающую среду? Ecol Ind 24: 573–581

    Google ученый

  • Ruxton CHS, McMillan B (2010) Влияние микопротеина на уровень холестерина в крови: пилотное исследование.Br Food J 112: 1092–1101

    Google ученый

  • Rzymski P, Niedzielski P, Kaczmarek N, Jurczak T., Klimaszyk P (2015) Междисциплинарный подход к оценке безопасности и токсичности пищевых добавок на основе микроводорослей после клинических случаев отравления. Вредные водоросли 46: 34–42

    CAS Google ученый

  • Sadler MJ (2004) Альтернативы мясу — развитие рынка и польза для здоровья.Trends Food Sci Technol 15: 250–260

    CAS Google ученый

  • Сатари Б., Карими К. (2018) Мукоралеевые грибы для устойчивого производства биоэтанола и биологически активных молекул. Appl Microbiol Biotechnol 102: 1097–1117. https://doi.org/10.1007/s00253-017-8691-9

    CAS Статья PubMed Google ученый

  • Scott LW, Dunn JK, Pownall HJ, Brauchi DJ, McMann MC, Herd JA, Harris KB, Savell JW, Cross HR, Gotto AM Jr (1994) Влияние потребления говядины и курицы на уровни липидов в плазме у мужчин с гиперхолестеринемией .JAMA Intern Med 154 (11): 1261–1267

    CAS Google ученый

  • Siegrist M, Hartmann C (2019) Влияние восприятия устойчивости на потребление экологически чистого мяса и заменителей мяса. Аппетит 132: 196–202

    PubMed Google ученый

  • Slavin J, Green H (2007) Пищевые волокна и сытость. Nutr Bull 32: 32–42

    Google ученый

  • Smetana S, Mathys A, Knoch A, Heinz V (2015) Альтернативы мяса: оценка жизненного цикла большинства известных заменителей мяса.Int J Life Cycle Assess 20: 1254–1267. https://doi.org/10.1007/s11367-015-0931-6

    CAS Статья Google ученый

  • Сметана С., Аганович К., Ирмшер С., Хайнц В. (2018) Использование потоков агропродовольственных отходов для разработки более устойчивых заменителей пищевых продуктов. Разработка устойчивых технологий, продуктов и политики: от науки к инновациям. Springer, Cham, pp. 145–155

    Google ученый

  • Смит Х., Дойл С., Мерфи Р. (2015) Нитчатые грибы как источник природных антиоксидантов.Food Chem 185: 389–397

    CAS PubMed Google ученый

  • Snowdon DA, Phillips RL, Fraser GE (1984) Потребление мяса и смертельная ишемическая болезнь сердца. Пред. Med 13: 490–500

    CAS PubMed Google ученый

  • Sonesson U, Davis J, Flysjö A, Gustavsson J, Witthöft C (2017) Качество белка как функциональная единица — методологическая основа для включения в оценку жизненного цикла пищевых продуктов.J Clean Prod 140: 470–478

    Google ученый

  • Steinfeld H, Gerber P, Wassenaar TD, Castel V, Rosales M, Rosales M, de Haan C (2006) Длинная тень домашнего скота: экологические проблемы и возможности. Food & Agriculture Org

  • Tscharntke T, Clough Y, Wanger TC, Jackson L, Motzke I, Perfecto I, Vandermeer J, Whitbread A (2012) Глобальная продовольственная безопасность, сохранение биоразнообразия и будущее интенсификации сельского хозяйства.Биол Консерв 151: 53–59

    Google ученый

  • Тернбулл WH, Ward T (1995) Микопротеин снижает гликемию и инсулинемию при приеме с пероральным тестом на толерантность к глюкозе. Am J Clin Nutr 61: 135–140. https://doi.org/10.1093/ajcn/61.1.135

    CAS Статья PubMed Google ученый

  • Weinrich R, Elshiewy O (2019) Предпочтение и готовность платить за заменители мяса на основе микроводорослей.Аппетит 142: 104353

    PubMed Google ученый

  • Wiebe M (2002) Микобелок из Fusarium venenatum: хорошо зарекомендовавший себя продукт для употребления в пищу человеком. Appl Microbiol Biotechnol 58: 421–427. https://doi.org/10.1007/s00253-002-0931-x

    CAS Статья PubMed Google ученый

  • Williamson DA, Geiselman PJ, Lovejoy J, Greenway F, Volaufova J, Martin CK, Arnett C, Ortego L (2006) Влияние потребления микопротеина, тофу или курицы на последующее пищевое поведение, голод и безопасность.Аппетит 46: 41–48

    PubMed Google ученый

  • Wouters AG, Rombouts I, Lagrain B, Delcour JA (2016) Влияние казеина и белков яичного белка на структуру продуктов, богатых белком на основе пшеничного глютена. J Sci Food Agric 96: 757–763

    CAS PubMed Google ученый

  • Ослабленные воспалительные реакции при гемохроматозе показывают роль железа в регуляции трансляции цитокинов макрофагов

    Реферат

    Нарушения гомеостаза железа связаны с измененной восприимчивостью к инфекционным заболеваниям, но лежащие в основе молекулярные механизмы плохо изучены.Чтобы изучить этот феномен, мы исследовали врожденный иммунитет к оральной инфекции Salmonella у мышей с нокаутом Hfe ( Hfe — / — ), модели унаследованного от человека гемохроматоза типа I метаболизма железа. Salmonella — и LPS-индуцированные воспалительные ответы были ослаблены у мутантных животных, при этом менее тяжелый энтероколит наблюдался in vivo, а секреция макрофагов TNF-α и IL-6 была измерена in vitro. Экспортер макрофагального железа ферропортин (FPN) был активирован у мышей Hfe — / — , и, соответственно, уровни внутримакрофагального железа были снижены.В соответствии с функциональной важностью этих изменений, аномальная продукция цитокинов мутантными макрофагами может воспроизводиться в клетках дикого типа за счет хелатирования железа и в клеточной линии макрофагов за счет сверхэкспрессии FPN. Результаты анализа конкретных этапов биосинтеза TNF-α и IL-6, включая внутриклеточные концентрации, посттрансляционную стабильность и уровни транскриптов, соответствовали снижению трансляции мРНК цитокинов в макрофагах Hfe — / — .Анализ полирибосомного профиля подтвердил, что повышенная экспрессия макрофагов FPN и низкий уровень внутриклеточного железа нарушают трансляцию специфических транскриптов воспалительных цитокинов. Наши результаты обеспечивают молекулярное понимание иммунной функции при гемохроматозе I типа и других нарушениях гомеостаза железа, а также раскрывают новую роль железа в регуляции воспалительной реакции.

    Железо играет важную роль как в вирулентности патогенов, так и в устойчивости организма к противомикробным препаратам (1). Как следствие, нарушение гомеостаза железа у человека приводит к изменению восприимчивости к инфекционным заболеваниям.Перегрузка железом из пищевых источников, чрезмерный гемолиз или наследственные нарушения обмена веществ предрасполагают к сальмонеллезу, туберкулезу и другим инфекциям (2, 3, 4, 5, 6). Соответственно, дефицит железа связан с относительной устойчивостью к инфекции, тогда как добавки железа обращают этот эффект (7, 8, 9). Исследования на экспериментальных животных в целом подтвердили эти клинические наблюдения, хотя было обнаружено, что истощение запасов железа увеличивает восприимчивость к некоторым патогенам (10, 11, 12, 13).Нарушения иммунного ответа, а также прямые эффекты на рост микробов были предложены в качестве объяснения влияния измененного гомеостаза железа на течение инфекции (1), но лежащие в их основе механизмы не были хорошо охарактеризованы на молекулярном уровне.

    Наследственный гемохроматоз — это группа генетически обусловленных заболеваний, характеризующихся аномальным накоплением железа в различных тканях (14). Наиболее распространенная форма заболевания (тип I) вызывается вариациями Hfe , гена гемохроматоза, который кодирует MHC-подобный белок клеточной поверхности класса I, экспрессируемый на гепатоцитах, макрофагах и клетках крипт кишечника (15).Белок HFE определяет статус железа и регулирует экспрессию гепсидина, секретируемого пептида гепатоцитов, который является основным регулятором гомеостаза железа (16, 17, 18). Производство гепсидина увеличивается при нагрузке железом и воспалении и снижается при дефиците железа, анемии и гипоксии (16, 17). Он связывается с ферропортином (FPN), 3 , белком экспорта железа, экспрессируемым на поверхности макрофагов и на базолатеральной мембране энтероцитов двенадцатиперстной кишки, и вызывает его интернализацию и деградацию (19).Следовательно, гепсидин прерывает экспорт клеточного железа на двух участках: в кишечном эпителии и тканевых макрофагах. HFE-зависимый синтез гепсидина и зависимая от гепсидина понижающая модуляция FPN составляют важную регуляторную петлю, которая помогает поддерживать гомеостаз железа. В отсутствие функционального HFE неадекватно низкие уровни циркулирующего гепсидина приводят к высокой экспрессии FPN, последующему увеличению абсорбции железа из кишечника и высвобождения из фагоцитов, а также к окончательному отложению металла в таких участках, как печень, поджелудочная железа и сердце (14 ).Мыши с нокаутом Hfe воспроизводят несколько признаков гемохроматоза I типа, включая низкий уровень гепсидина и высокий уровень железа в печени (20, 21, 22, 23).

    Как и другие нарушения метаболизма железа, гемохроматоз I типа связан с измененными реакциями на инфекцию. Люди с этим заболеванием имеют повышенный риск заражения патогенами, такими как Yersinia enterocolitica и Vibrio vulnificus (24, 25, 26). Однако было также высказано предположение, что гемохроматоз типа I может обеспечивать защиту от патогенов внутримакрофагов, тем самым обеспечивая преимущество выживания для хозяина во время эпидемий таких организмов.Эта идея использовалась для объяснения необычно высокой частоты вариантов гена Hfe в европейских популяциях (27) и получила поддержку в недавних исследованиях клеточных культур, проведенных нашей группой (28) и другими исследователями (29, 30, 31). . Эти эксперименты показали, что повышенная экспрессия макрофагов FPN, аномалия, которая возникает при гемохроматозе I типа, может подавлять рост Salmonella typhimurium и других патогенов внутри этих клеток за счет снижения внутриклеточной концентрации железа.Хотя эти наблюдения иллюстрируют влияние локальной доступности железа на рост микробов, необходимо также учитывать потенциальные эффекты измененных уровней железа на иммунитет хозяина, чтобы полностью понять, как измененный гомеостаз железа может модулировать течение инфекционного заболевания. Мы решаем эту проблему в настоящей работе, исследуя врожденный иммунный ответ на инфекцию Salmonella у мышей с дефицитом Hfe .

    Материалы и методы

    Животные

    мышей C57BL / 6 дикого типа были приобретены в лаборатории Джексона.Мышей с нокаутом Hfe на фоне C57BL / 6 предоставил доктор Н. К. Эндрюс (Детская больница, Бостон, Массачусетс) (22). Все мыши были выведены и размещены в специальном помещении, свободном от патогенов, в Массачусетской больнице общего профиля. Животным давали воду и стандартный лабораторный корм ad libitum и использовали в возрасте 7–12 недель. Все эксперименты на животных были одобрены институциональным подкомитетом по уходу за исследовательскими животными.

    Salmonella энтероколит модель

    Протокол, описанный Barthel et al.(32) последовали. Вкратце, мышам вводили 20 мг стрептомицина в воде через желудочный зонд с иглой для кормления 21-го размера. Через 24 часа их инфицировали перорально 10 8 КОЕ устойчивого к стрептомицину дикого типа, способного к инвазии штамма SL1344 S. typhimurium , а затем умерщвляли через 48 часов после заражения. Воспаление кишечника оценивали при вскрытии трупа на основании общего вида и длины слепой кишки, гистопатологии и количественного измерения TNF-α и IL-6 на основе ОТ-ПЦР, как подробно описано (33).Уровни мРНК TNF-α и IL-6 были нормализованы по транскрипту, кодирующему рибосомный белок 36B4 домашнего хозяйства. Последовательности праймеров для TNF-α, IL-6 и 36B4 были следующими: TNF-α (смысловой) 5′-ATGAGCACAGAAAGCATGATC-3 ‘и (антисмысловой) 5′-TACAGGCTTGTCACTCGAATT-3′; IL-6 (смысловой) 5’-TAGTCCTTCCTACCCCAATTTCC-3 ‘и (антисмысловой) 5′-TTGGTCCTTAGCCACTCCTTC-3′; и 36B4 (смысловой) 5’-AGATGCAGCAGATCCGCAT-3 ‘и (антисмысловой) 5′-GTTCTTGCCCATCAGCACC-3’. Бактериальную нагрузку у животных, инфицированных Salmonella , оценивали, как описано ранее (33), путем гомогенизации взвешенных порций ткани или фекальных гранул в стерильном 1% Triton X-100 и посева серийных разведений гомогенатов на агар Лурия-Бертани, содержащий 50 мкг. / мл стрептомицина.

    Активация макрофагов

    Вызванные тиогликолатом перитонеальные макрофаги были приготовлены и инфицированы Salmonella (множественность инфекции ∼10: 1) или обработаны LPS (100 нг / мл, Ultra-Pure; List Biological Laboratories) в трех лунках 24-луночной ткани. -культурный планшет, как описано ранее (34). Инфекциям давали возможность продолжаться в течение 1 ч, после чего клетки промывали и помещали в среду, содержащую 100 мкг / мл гентамицина, для уничтожения внеклеточных бактерий.Клеточные супернатанты собирали через 3 часа после начала инфекции или обработки LPS (если не указано иное) и анализировали с помощью ELISA на TNF-α и IL-6 с использованием пар антител, полученных от R&D Systems или BD Pharmingen. Для оценки внутриклеточных уровней цитокинов контрольные и инфицированные Salmonella макрофаги обрабатывали 10 мкг / мл брефельдина А для блокирования секреции. Были приготовлены белковые экстракты, которые использовали для ELISA. Концентрации цитокинов были нормализованы к концентрациям белка в соответствующих клеточных лизатах для корректировки любых межмолекулярных вариаций количества клеток.Тотальную РНК получали с использованием реагента TRIzol (Invitrogen) и количественной ОТ-ПЦР, проводимой для определения уровней мРНК TNF-α, IL-6 и 36B4, следуя ранее описанным методам (33, 34). Количество внутриклеточных Salmonella , выживших через 3 и 24 часа после инфицирования, определяли с помощью анализа защиты от гентамицина, как подробно описано в более ранних публикациях (33, 34). Для оценки жизнеспособности клеток количество лактатдегидрогеназы, высвобожденной в супернатанты, анализировали с использованием набора Cytotox 96 от Promega.

    Определение стабильности белков TNF-α и IL-6

    Перитонеальные макрофаги обрабатывали 100 нг / мл LPS в течение 2 ч в присутствии 10 мкг / мл брефельдина A с последующим добавлением 10 мкг / мл циклогексимида для остановки трансляции. Лизаты клеток готовили сразу или через 4 часа после обработки циклогексимидом, и уровни внутриклеточных цитокинов определяли с помощью ELISA.

    Подготовка селезеночной мембраны и вестерн-блоттинг

    Селезенки мышей дикого типа и мышей с нокаутом Hfe гомогенизировали в 20 мМ HEPES (pH 7.4), 100 мМ KCl, 85 мМ сахароза, 20 мкМ EGTA, содержащие ингибиторы протеаз (Complete Mini; Roche). После центрифугирования при 10 000 × g при 4 ° C в течение 10 минут супернатанты собирали и центрифугировали при 100 000 × g при 4 ° C в течение 10 минут. Полученные осадки промывали и ресуспендировали в буфере RIPA (50 мМ Трис (pH 8,0), 150 мМ NaCl, 1,0% Nonidet P-40, 0,5% дезоксихолата, 0,1% SDS, 2 мМ EDTA), содержащем ингибиторы протеаз. Концентрацию белка в экстрактах детергентов определяли методом Брэдфорда.100 мкг общего белка на дорожку разделяли на 10% SDS-полиакриламидном геле и подвергали иммуноблоттингу с поликлональным антителом против FPN, предоставленным доктором Д. Хейлом (Система здравоохранения для ветеранов Южного Техаса, Сан-Антонио, Техас). Окрашивание блота по Понсо использовали для подтверждения равной загрузки дорожек.

    Кальцеиновый анализ внутриклеточной концентрации железа

    Клетки перитонеального экссудата, вызванные тиогликолатом, окрашивали PE-конъюгированными F4 / 80 Ab (eBioscience) и 0.5 мкМ кальцеин-AM (молекулярные зонды) перед проведением анализа проточной цитометрией с помощью BD FACScan с использованием программного обеспечения CellQuest. Канал флуоресцеина использовали для обнаружения флуоресценции кальцеина после использования характеристик прямого и бокового рассеяния, а также положительности F4 / 80 для входа в макрофаги. В некоторых экспериментах проницаемый для мембран хелатор железа салицилальдегид изоникотиноилгидразон (SIH), предоставленный доктором П. Понка (Университет Макгилла, Монреаль, Квебек, Канада), был добавлен к клеткам при 5 или 10 мкМ за 30 минут до окрашивания кальцеином.

    Анализ профиля полирибосом

    Полирибосомы были отделены от моносом в соответствии с опубликованным протоколом (35). Вкратце, клетки J774 стимулировали LPS в течение указанного времени с добавлением 10 мкг / мл циклогексимида в течение последних 10 минут. Клетки лизировали в гомогенизаторе Dounce в 20 мМ HEPES (pH 7,6), 5 мМ MgCl 2 , 100 мМ KCl, 1 мМ DTT, 100 мкг / мл циклогексимида, 0,5% Nonidet P-40, 1 мМ PMSF, 10 мкг / мл апротинина, 10 мкг / мл лейпептина и ингибитор РНКазы.После раскручивания ядер клеточные экстракты наслаивали на непрерывный градиент 10–50% сахарозы и центрифугировали при 40 000 об / мин в течение 3 ч в роторе SW40Ti. В конце центрифугирования фракции объемом 1 мл собирали из верхней части пробирки и измеряли оптическую плотность каждой фракции при 260 нм. Тотальную РНК получали из всех фракций и использовали для количественного анализа с помощью ОТ-ПЦР на IL-6 и β-актин. Количество транскрипта в каждой фракции выражали как процент от общего количества, присутствующего во всех фракциях.Последовательности праймеров для IL-6 были такими, как указано. Для β-актина были смысловые, 5′-TGGAATCCTGTGGCATCCATGAAAC-3 ‘и антисмысловые, 5′-TAAAACGCAGCTCAGTAACAGTCCG-3′, а для IL-1β были смысловые, 5’-CAACCAACAAGTGATATACCT CATG-3 ‘и антисмысловые CTGCCCTG-3’ и GCCACCCCC 3 ′.

    Статистический анализ

    Двусторонний тест Стьюдента t использовался для сравнения результатов. Значение p <0,05 считалось значимым. Показанные результаты являются средними значениями и, при необходимости, стандартным отклонением.

    Результаты

    Воспаление кишечника, вызванное Salmonella , ослаблено у мышей Hfe — / —

    Чтобы изучить влияние дефицита Hfe на антибактериальный врожденный иммунитет, мы сравнили S. typhimurium -индуцированный энтероколит (32) у мышей Hfe — / — и мышей C57BL6 дикого типа. В этой экспериментальной системе мышам вводят однократную дозу стрептомицина 20 мг перорально, а затем через 24 часа через желудочный зонд заражают устойчивым к стрептомицину вирулентным штаммом SL1344 S.тифимуриум . Развивается сильное воспаление толстой кишки, пик которого наступает примерно через 48 часов после инфицирования, и это наиболее очевидно в слепой кишке. Используя эту модель, мы обнаружили, что воспаление кишечника, индуцированное Salmonella , явно ослаблялось у мышей Hfe — / — , как показано несколькими параметрами. Во-первых, слепые кишки инфицированных животных дикого типа были бледными, толстостенными, сморщенными и лишенными стула, что соответствовало развитию интенсивной воспалительной реакции кишечника.Напротив, органы у мышей с нокаутом были большими, заполненными калом и тонкостенными (рис. 1⇓ A ). Эта разница в макроскопическом внешнем виде была количественно оценена путем измерения длины слепой кишки, которая показала, что нокаутные слепые кишки подверглись значительно меньшей усадке (рис. 1⇓ B ). При микроскопическом исследовании слепые кишки мышей дикого типа демонстрировали заметный отек подслизистой оболочки и выраженный воспалительный инфильтрат, тогда как обе эти особенности были уменьшены у животных с дефицитом Hfe (рис.1⇓ С ). В соответствии с меньшим количеством нейтрофилов и моноцитов, рекрутированных в кишечник мышей с нокаутом, количественный анализ ОТ-ПЦР показал, что уровни мРНК слепой кишки медиаторов воспаления TNF-α и IL-6 были значительно снижены у этих животных (рис. D ). Уменьшение воспаления кишечника у мышей Hfe — / — вряд ли связано со снижением колонизации патогенами кишечника или других тканей, потому что мы извлекли такое же количество Salmonella из мезентериальных лимфатических узлов и печени этих двух животных. групп животных, тогда как количество в кале и селезенке было выше у животных с нокаутом (рис.1⇓ E ).

    РИСУНОК 1.

    Воспаление кишечника, вызванное Salmonella , ослаблено у мышей Hfe — / — . A , Общий вид слепой кишки мышей дикого типа и мышей с нокаутом Hfe (KO) через 48 часов после инфицирования Salmonella . B , Длина слепой кишки мышей дикого типа и Hfe -дефицитных мышей через 48 часов после заражения Salmonella . Ceca от контрольных мышей ( n = 3) и инфицированных мышей ( n = 6) иссекали, и регистрировали максимальную длину органа.*, p = 0,019. C , Гистопатология слепой кишки у мышей дикого типа и мышей с нокаутом Hfe через 48 часов после инфицирования Salmonella . Показано номинальное увеличение × 100. D , уровни мРНК Cecal TNF-α и IL-6 у мышей дикого типа и Hfe — / — . Общую РНК слепой кишки мышей дикого типа и Hfe — / — подвергали количественному анализу RT-PCR с праймерами, специфичными для TNF-α и IL-6. Уровни мРНК каждого цитокина были нормализованы к домашнему транскрипту 36B4 и выражены относительно контроля.*, п = 0,008; и **, p = 0,002. E , количество Salmonella , выделенных из брыжеечных лимфатических узлов (MLN), селезенки, печени и стула мышей дикого типа и мышей с дефицитом Hfe ( n = 9) через 48 часов после заражения. *, p = 0,039; и **, p = 0,044.

    Hfe — / — макрофаги демонстрируют измененный биосинтез воспалительных цитокинов

    Дополнительные эксперименты были направлены на поиск механистического объяснения ослабленного энтероколита Salmonella у мышей Hfe — / — . Salmonella -индуцированное воспаление кишечника у мышей не зависит от Т- и В-лимфоцитов и в значительной степени опосредуется механизмами врожденного иммунитета (32, 36). Эпителиальные клетки, нейтрофилы, макрофаги, дендритные клетки и NK-клетки являются основными участниками врожденного иммунитета в кишечнике и ассоциированной с кишечником лимфоидной ткани после оральной инфекции Salmonella (32, 36, 37, 38). Кроме того, нейтрофилы и макрофаги являются важными источниками медиаторов воспаления, таких как TNF-α (37).Из этих типов клеток только макрофаги экспрессируют ФПН в заметных количествах (экспрессия ФПН в эпителиальных клетках кишечника в значительной степени ограничена двенадцатиперстной кишкой), поэтому на нее, скорее всего, влияет низкий уровень гепсидина, связанный с дефицитом Hfe (14, 20 ). Таким образом, мы предположили, что измененная функция макрофагов может играть роль в ослабленном энтероколите Salmonella у мышей Hfe — / — .

    Чтобы изучить эту возможность, мы приготовили перитонеальные макрофаги, вызванные тиогликолатом, от мышей дикого типа и Hfe — / — и инфицировали их S.typhimurium штамм SL1344. Через 3 часа после заражения количество цитокинов TNF-α и IL-6, секретируемых мутантными макрофагами, было значительно меньше, чем клетками дикого типа (рис. 2⇓ A ). Различия в количестве бактерий, обеспечивающих активирующий стимул, вряд ли могут объяснить более низкий ответ мутантных клеток: количество бактерий, присутствующих в макрофагах Hfe — / — , было лишь незначительно снижено по сравнению с макрофагами дикого типа на уровне 3. ч после заражения и очень похожи через 24 ч после заражения (рис.2⇓ В ). Кроме того, мы также обнаружили значительное снижение секреции TNF-α и IL-6 макрофагами с дефицитом Hfe после 3 часов лечения 100 нг / мл LPS (рис. 2⇓ C ), агониста TLR4, ключевой рецептор распознавания образов, участвующий во взаимодействиях Salmonella с макрофагами (34, 39, 40). Уровни индуцированных Salmonella белков TNF-α и IL-6, которые накапливались внутриклеточно после блокирования секреции брефельдином А, были значительно ниже в макрофагах Hfe — / — (рис.3⇓ A ), предполагая, что изменения секреции цитокинов не влияют на ослабленный ответ этих клеток. Жизнеспособность клеток макрофагов дикого типа и нокаутных макрофагов была сходной как в базовых условиях, так и после стимуляции (данные не показаны), что делает маловероятным, что увеличение количества Salmonella или LPS-индуцированная гибель клеток в последнем может объяснить разница в продукции цитокинов.

    РИСУНОК 2.

    Макрофаги от Hfe — / — мышей экспрессируют сниженные уровни белков TNF-α и IL-6 в ответ на Salmonella и LPS. A , Salmonella -индуцированная (штамм SL1344) секреция белков TNF-α и IL-6 в макрофагах дикого типа и Hfe , нокаутированных через 3 часа после инфицирования. Уровни цитокинов в супернатанте измеряли с помощью ELISA и нормализовали относительно общих концентраций белка в клеточных лизатах. Значимые различия у контрольных мышей ( n = 6) и инфицированных мышей ( n = 9) составляли *, p = 0,007; и **, p = 0,009. B , Количество внутриклеточных Salmonella , выделенных из макрофагов дикого типа, и Hfe , нокаутных макрофагов через 3 или 24 часа после инфицирования.Для контроля ( n = 6), *, p = 0,03. C , секреция белков TNF-α и IL-6 в макрофагах дикого типа и Hfe , индуцированная 3-часовой обработкой 100 нг / мл LPS, определенная, как описано в A . Значимые различия у контрольных мышей ( n = 6) и инфицированных мышей ( n = 6) составляли *, p = 0,003; и **, p = 2 × 10 −5 .

    РИСУНОК 3.

    Макрофаги от Hfe — / — мышей имеют нормальную повышающую регуляцию цитокиновых мРНК в ответ на Salmonella или LPS, несмотря на снижение внутриклеточных уровней белков. A , Salmonella -индуцированные внутриклеточные уровни белка TNF-α и IL-6 через 3 часа после инфицирования после блокирования секреции 10 мкг / мл брефельдина A. Уровни цитокинов в клеточных лизатах определяли, как описано на рис. 2– A . Достоверная разница между контрольными ( n = 3) и инфицированными ( n = 3) мышами была *, p = 0,002; и **, p = 0,0009. B , Salmonella — и LPS-индуцированные уровни мРНК TNF-α и IL-6 в макрофагах дикого типа и Hfe — / — через 3 часа после инфицирования или лечения.Суммарную РНК подвергали количественному анализу RT-PCR с праймерами, специфичными для TNF-α или IL-6. Уровни мРНК TNF-α и IL-6 были нормализованы до 36B4 и выражены относительно контроля ( n = 3).

    Для дальнейшего выяснения механизма, ответственного за снижение продукции воспалительных цитокинов в макрофагах Hfe — / — , мы исследовали уровни мРНК TNF-α и IL-6, индуцированные активацией Salmonella или LPS. Мы обнаружили, что уровни транскриптов были сходными в клетках дикого типа и мутантных клетках через 3 ч после начала активации (рис.3⇑ B ), хотя количества белков в это время были явно ниже в макрофагах Hfe — / — (рис. 2⇑, A и C и 3 A ). . Несоответствие между эффектами дефицита Hfe на количество белка TNF-α и IL-6 по сравнению с мРНК предполагает, что нарушение биосинтеза цитокинов в макрофагах Hfe — / — может быть на уровне трансляции или посттрансляции. стабильность белка.Мы обнаружили, что стабильность внутриклеточного TNF-α и IL-6 существенно не изменилась в мутантных макрофагах, о чем свидетельствует скорость снижения уровней белка после ингибирования трансляции циклогексимидом и блокирования секреции брефельдином A (рис. 4⇓). Таким образом, вместе взятые, наши результаты предполагают снижение трансляции мРНК цитокинов в макрофагах Hfe — / — .

    РИСУНОК 4.

    Стабильность белков TNF-α и IL-6 в макрофагах дикого типа (WT) и Hfe — / — .Клетки обрабатывали 100 нг / мл LPS в течение 2 часов в присутствии 10 мкг / мл брефельдина A, а затем добавляли 10 мкг / мл циклогексимида (CHX) для остановки трансляции, как указано (стрелка). Клеточные лизаты готовили сразу или еще через 4 часа, и внутриклеточный TNF-α и IL-6 измеряли с помощью ELISA. Концентрации цитокинов были нормализованы к концентрации общего белка клеточных лизатов. Макрофаги у мышей, обработанных TNF- ( n = 6) или IL-6- ( n = 3), существенно не изменились.

    Повышенная экспрессия макрофагов FPN снижает продукцию воспалительных цитокинов за счет воздействия на трансляцию

    Гемохроматоз I типа характеризуется низким уровнем гепсидина, что приводит к повышенной экспрессии макрофагального FPN и относительно низким концентрациям железа в этих клетках (14). Мы провели эксперименты, чтобы определить, способствуют ли уровни FPN и внутриклеточного железа снижению выработки цитокинов макрофагами Hfe — / — .Сначала мы исследовали экспрессию FPN у мутантных мышей. Хотя доступное антитело против ФПН не смогло обнаружить экспрессию белка на изолированных перитонеальных макрофагах, вестерн-блот-анализ мембранных фракций, полученных из полных гомогенатов селезенки, подтвердил повышенную экспрессию ФПН у мышей с дефицитом Hfe (от 2 до 3). в несколько раз выше, чем у дикого типа на основании денситометрии) (рис. 5⇓ A ).

    РИСУНОК 5.

    Повышенная экспрессия FPN способствует снижению продукции цитокинов макрофагами Hfe — / — . A , Повышенная экспрессия FPN в препарате селезеночной мембраны мышей дикого типа и Hfe — / — . Мембраны селезенки анализировали вестерн-блоттингом с анти-FPN Ab. Окрашивание блота по Понсо подтвердило равную загрузку дорожек. Число указывает молекулярную массу в килодальтонах. B , LPS-индуцированная секреция белка IL-6 в контрольных клетках J774-GFP.RV и FPN, сверхэкспрессирующие клетки J774-FPN1.RV2. Клетки стимулировали в течение 24 ч 100 нг / мл ЛПС. IL-6 измеряли в супернатантах с помощью ELISA. n = 3, *, p = 0,014. C , LPS-индуцированные уровни мРНК IL-6 в контрольных клетках J774-GFP.RV и FPN, сверхэкспрессирующих J774-FPN1.RV2. Клетки стимулировали в течение 24 ч 100 нг / мл ЛПС. Готовили тотальную РНК и проводили количественную ОТ-ПЦР с праймерами, специфичными для IL-6. Уровни мРНК IL-6 были нормализованы до 36B4 и выражены относительно контроля.

    Чтобы независимо оценить влияние повышенной экспрессии FPN на ответы макрофагов, мы создали клеточную линию макрофагов мышей J774-FPN1.RV2, который стабильно сверхэкспрессирует в ~ 3 раза более высокие уровни FPN, чем контрольная трансдуктная клеточная линия J774-GFP.RV (41). Обе клеточные линии стимулировали LPS в течение 24 часов, и анализировали их экспрессию белка IL-6 и мРНК (мы обнаружили, что продукция TNF-α этими линиями была очень низкой и ее нельзя было эффективно сравнивать). Клетки J774-FPN1.RV2 продуцировали значительно меньшие количества белка IL-6, чем клетки J774-GFP.RV, хотя уровни мРНК были сопоставимы (фиг. 5, B и C ).Аналогичные результаты были получены при 8-часовой стимуляции LPS (данные не показаны). Эти наблюдения напоминают наблюдения, сделанные для макрофагов дикого типа и Hfe — / — , и предполагают, что повышенная экспрессия FPN способствует снижению цитокинового ответа последнего.

    Результаты как с первичными макрофагами (рис. 2⇑ и 3⇑), так и с линиями клеток J774 (рис. 5⇑, B и C ) повышают вероятность FPN-зависимого изменения трансляции цитокинов.Чтобы проверить эту идею, был проведен анализ профиля полирибосом для изучения статуса трансляции мРНК IL-6 в клетках J774-FPN1.RV2 и J774-GFP.RV. Цитоплазматические экстракты, полученные после 24 ч обработки LPS, фракционировали по градиентам сахарозы и оценивали на предмет различий в распределении мРНК IL-6, IL-1β и β-актина (фиг. 6⇓). Приблизительно 70% всей РНК, присутствующей в нефракционированном экстракте, было выделено после фракционирования. Мы обнаружили, что большая часть транскрипта IL-6 присутствовала во фракциях, содержащих тяжелые полирибосомы, в контрольном J774-GFP.Клетки ПЖ, что указывает на то, что он активно транслировался (рис. 6⇓ A ). В клетках J774-FPN1.RV2, сверхэкспрессирующих FPN, наблюдался сдвиг в распределении мРНК IL-6 в сторону более легких фракций (рис. 6– A ). Не было различий между клеточными линиями в распределении мРНК IL-1β или β-актина (фиг. 6⇓, B и C ). Также не было различий в распределении общей РНК по градиенту, что указывает на то, что различия в распределении IL-6 вряд ли являются результатом селективного выделения определенных фракций из J774-GFP.Клетки RV по сравнению с клетками J774-FPN1.RV2 (рис. 6⇓ D ). Эти результаты подтверждают идею о том, что повышенная экспрессия FPN приводит к снижению трансляции специфических транскриптов воспалительных цитокинов, и подтверждают наблюдения в первичных макрофагах.

    РИСУНОК 6. Анализ профиля полирибосом

    демонстрирует нарушение трансляции IL-6 в клетках J774, сверхэкспрессирующих FPN. Цитоплазматические экстракты контрольных клеток J774-GFP.RV () и FPN со сверхэкспрессией клеток J774-FPN1.RV2 (▪) после обработки LPS (100 нг / мл, 24 ч) подвергали центрифугированию в градиенте плотности сахарозы и относительные доли IL Определяли мРНК -6 ( A ), IL-1β ( B ) и β-актина ( C ) в каждой фракции. D , OD при 260 нм каждой фракции использовали как меру общей РНК.

    Снижение внутриклеточного железа подавляет трансляцию воспалительных цитокинов макрофагами

    Фагоциты при гемохроматозе I типа имеют относительно низкие уровни внутриклеточного железа из-за повышенной экспрессии FPN (14). Мы оценили внутриклеточную концентрацию железа в макрофагах Hfe — / — , используя метод проточной цитометрии, основанный на флуоресценции кальцеина, которая подавляется свободным железом (42, 43).Результаты, представленные в виде гистограмм флуоресценции кальцеина F4 / 80-положительных перитонеальных макрофагов, показали, что флуоресценция макрофагов с дефицитом Hfe была выше, чем у макрофагов дикого типа (рис. 7⇓, слева от ), что указывает на меньшее тушение и, следовательно, более низкий уровень внутриклеточного железа в мутантных клетках. Это открытие согласуется с повышенной экспрессией FPN.

    РИСУНОК 7.

    Влияние дефицита Hfe и SIH на внутриклеточные уровни железа в макрофагах.Гистограммы флуоресценции кальцеина F4 / 80-позитивных макрофагов дикого типа и Hfe нокаутных макрофагов ( осталось ). Флуоресценция макрофагов дикого типа (тонкая пунктирная гистограмма) и нокаутных (тонкая пунктирная гистограмма) макрофагов показана в отсутствие кальцеина. Гистограммы флуоресценции кальцеина F4 / 80-позитивных макрофагов дикого типа в отсутствие SIH (контроль) или в присутствии различных концентраций хелатора железа ( справа ). Показана флуоресценция в отсутствие кальцеина (тонкая пунктирная гистограмма).Данные FACS для этого эксперимента были получены параллельно с данными в первом эксперименте ( осталось ). Контрольные гистограммы и гистограммы без кальцеина идентичны соответствующим гистограммам дикого типа на слева .

    Чтобы определить, влияет ли низкий уровень внутриклеточного железа в макрофагах Hfe — / — на их ослабленную продукцию цитокинов, мы использовали проницаемый через мембрану хелатор железа SIH (44). Обработка макрофагов дикого типа SIH приводила к дозозависимому увеличению флуоресценции кальцеина (рис.7⇑, справа ), что свидетельствует о снижении внутриклеточного железа. Обработка SIH также привела к значительному снижению количества TNF-α, секретируемого в ответ на 3-часовую стимуляцию LPS (рис. 8⇓ A ), с менее драматическим влиянием на уровень соответствующей мРНК (рис. 8 ⇓ Б ). Дозы SIH, использованные в этих экспериментах, не влияли на жизнеспособность клеток (данные не показаны). Кроме того, ингибирующее действие SIH на секрецию TNF-α было обращено дозозависимым образом путем добавления сульфата железа в среду (рис.8⇓ C ), что указывает на то, что SIH действует путем хелатирования железа. В соответствии со снижением продукции TNF-α, вызванным хелатированием железа, добавление одного сульфата железа к среде приводило к увеличению LPS-индуцированной секреции цитокина (рис. 8- C ), хотя этот эффект был ограничен токсичность при более высоких дозах соли железа. Обработка SIH также ингибировала LPS-индуцированную секрецию IL-6 с менее выраженным ингибированием экспрессии мРНК (фиг. 8⇓, D и E ).Таким образом, эффекты лечения SIH были аналогичны эффектам дефицита Hfe , что позволяет предположить, что пониженные концентрации внутриклеточного железа способствовали нарушению биосинтеза цитокинов мутантными макрофагами. Несоответствие между эффектами SIH на цитокиновый белок и уровни транскриптов согласуется с представлением о том, что пониженное внутриклеточное железо ингибирует трансляцию мРНК. Чтобы подтвердить эту идею, мы использовали анализ профиля полирибосом, чтобы изучить влияние SIH на трансляцию мРНК IL-6 в J774-GFP.Линия клеток RV. Хелатирование железа вызвало сдвиг в распределении транскрипта IL-6 в менее плотные фракции (рис. 9⇓ A ), что указывает на уменьшение доли активно транслируемого сообщения и имитирует эффект сверхэкспрессии FPN (рис. 6⇑). А ). Распределение мРНК β-актина и общей РНК не выявило серьезных различий между контрольными клетками и клетками, обработанными SIH (фиг. 9⇓, B и C ). Эти результаты показывают, что пониженное содержание внутриклеточного железа избирательно нарушает трансляцию мРНК IL-6.

    РИСУНОК 8.

    Снижение внутриклеточного железа способствует снижению выработки цитокинов макрофагами Hfe — / — . A , Влияние SIH на белок TNF-α, секретируемый макрофагами дикого типа в ответ на LPS. Макрофаги обрабатывали 100 нг / мл LPS в течение 3 часов в присутствии или отсутствии различных количеств SIH, как указано. Концентрации TNF-α в супернатантах определяли с помощью ELISA и выражали как процент от контрольных клеток (не обработанных SIH) у n = 3 животных. B , Влияние SIH на уровни мРНК TNF-α в макрофагах дикого типа в ответ на LPS. Макрофаги обрабатывали 100 нг / мл LPS в течение 3 часов в присутствии или отсутствии различных количеств SIH, как указано. Готовили тотальную РНК и определяли уровни мРНК TNF-α с помощью количественной ОТ-ПЦР. После нормализации до мРНК 36B4 уровни транскриптов цитокинов были выражены как процент от контрольных клеток (не обработанных SIH). C , Влияние железа на LPS-индуцированную секрецию TNF-α в макрофагах дикого типа.Макрофаги обрабатывали 100 нг / мл LPS в течение 3 часов в присутствии или в отсутствие 5 мкМ SIH, как указано, с добавлением указанных количеств железа в форме сульфата железа или без него. Концентрации TNF-α в супернатантах определяли с помощью ELISA и выражали как процент от контрольных клеток (обработанных только LPS) у n = 6 животных. D , Влияние SIH на белок IL-6, секретируемый макрофагами дикого типа в ответ на LPS. Макрофаги обрабатывали 100 нг / мл LPS в течение 3 часов в присутствии или отсутствии различных количеств SIH, как указано.Концентрации IL-6 в супернатантах определяли с помощью ELISA и выражали как процент от контрольных клеток (не обработанных SIH) у n = 3 животных. E , Влияние SIH на уровни мРНК IL-6 в макрофагах дикого типа в ответ на LPS. Макрофаги обрабатывали 100 нг / мл LPS в течение 3 часов в присутствии или отсутствии различных количеств SIH, как указано. Готовили тотальную РНК и определяли уровни мРНК IL-6 с помощью количественной ОТ-ПЦР. После нормализации до мРНК 36B4 уровни транскриптов цитокинов были выражены как процент от контрольных клеток (не обработанных SIH).

    РИСУНОК 9. Анализ профиля полирибосом

    демонстрирует нарушение трансляции IL-6 в клетках J774 после хелатирования железа с SIH. Цитоплазматические экстракты клеток J774-GFP.RV, не обработанные (⋄) или обработанные 5 мкМ SIH (▪) и подвергнутые стимуляции LPS (100 нг / мл, 8 ч), анализировали центрифугированием в градиенте плотности сахарозы, и относительные пропорции мРНК IL-6 ( A ) и β-актина ( B ) в каждой фракции. C , OD при 260 нм каждой фракции использовали как меру общей РНК.

    Обсуждение

    Наши наблюдения показывают, что модель гемохроматоза I типа на мышах связана с ослабленным воспалительным ответом на инфекцию Salmonella как in vivo, так и в изолированных макрофагах. Они также указывают на то, что лежащий в основе механизм включает снижение трансляции мРНК провоспалительных цитокинов. Измененный биосинтез цитокинов, по-видимому, вызван пониженными уровнями внутриклеточного железа, которые возникают в макрофагах при гемохроматозе I типа из-за повышенной экспрессии FPN.Помимо того, что мы проливаем свет на иммунологические последствия относительно распространенного нарушения метаболизма железа, наши результаты показывают новую роль железа в регуляции трансляции цитокиновой мРНК.

    Известно, что железо регулирует экспрессию нескольких генов на уровне транскрипции, в первую очередь через образование активных форм кислорода и их влияние на активность NF-κB и других факторов транскрипции (45). Он также имеет хорошо задокументированную функцию контроля стабильности и трансляции транскриптов, которые участвуют в гомеостазе железа (46).Однако, насколько нам известно, ранее не сообщалось о железозависимом трансляционном контроле биосинтеза цитокинов. Известные посттранскрипционные эффекты железа опосредуются элементами ответа на железо, присутствующими в нетранслируемых областях мРНК, которые связываются регуляторными белками железа в условиях низкой концентрации железа. Нет канонических элементов ответа на железо в нетранслируемых областях сообщений TNF-α или IL-6. Однако железо-регуляторные белки-зависимые реакции на железо могут быть обусловлены атипичными элементами ответа на железо, которые могут быть пропущены стандартным анализом in silico (47), что повышает вероятность того, что такие скрытые элементы могут участвовать в железозависимой регуляции TNF-α. и перевод Ил-6.С другой стороны, железо может проявлять свои эффекты через AU-богатые последовательности, присутствующие в 3′-нетранслируемых областях многих цитокиновых транскриптов, включая TNF-α и IL-6 (48). Было показано, что некоторые белки связываются с этими элементами, оказывая влияние как на стабильность мРНК, так и на трансляцию (35, 48), и возможно, что изменения внутриклеточного железа могут влиять на эти взаимодействия, прямо или косвенно.

    Хотя потребуется дальнейшая работа, чтобы точно определить, как внутриклеточное железо регулирует трансляцию мРНК TNF-α и IL-6, наши данные показывают, что этот регуляторный механизм имеет важные последствия для взаимодействий хозяин-патоген в экспериментальной модели гемохроматоза типа I.TNF-α и IL-6 играют важную роль в рекрутировании воспалительных клеток, индуцированных Salmonella , и во врожденной устойчивости к этому патогену (37, 38, 49, 50, 51). Поэтому неудивительно, что снижение продукции этих цитокинов приводит к ослаблению кишечного воспаления, вызванного Salmonella , наблюдаемого у мышей Hfe — / — .

    Стоит отметить, что более ранние работы нашей лаборатории, а также других исследователей показали, что повышенная экспрессия макрофагов FPN подавляет рост нескольких внутриклеточных патогенов, в том числе Salmonella (28, 29, 30, 31).Поэтому несколько удивительно, что дефицит Hfe с ассоциированным с ним увеличением экспрессии макрофагов FPN увеличивал выделение Salmonella из инфицированных тканей in vivo (рис. 1⇑ E ) и лишь незначительно снижал рост патогена в макрофаги in vitro (рис. 2⇑ B ). Увеличение бактериальной нагрузки в тканях у мышей Hfe — / — in vivo, вероятно, объясняется ослаблением воспалительной реакции у этих животных, что привело бы к уменьшению набора фагоцитарных клеток, а также к нарушению внутренних микробицидных механизмов макрофагов. (52).Отсутствие более сильного ингибирующего эффекта на рост Salmonella в макрофагах Hfe — / — in vitro вызывает большее недоумение, и у нас нет определенного объяснения расхождения с более ранними результатами. Различия в экспериментальной методологии могут быть способствующими факторами, и также возможно, что уровень внутриклеточного железа в макрофагах Hfe — / — просто недостаточно низок, чтобы оказывать прямое влияние на размножение Salmonella .Следует отметить, что вариации в статусе макрофагального железа могут также помочь объяснить некоторую вариабельность цитокиновых ответов от эксперимента к эксперименту, наблюдаемую в настоящем исследовании.

    Люди с гемохроматозом I типа необычно восприимчивы к определенным бактериальным инфекциям (24, 25, 26). Хотя повышенная доступность железа для инфекционного патогена может быть одним из объяснений этой восприимчивости, наши результаты повышают вероятность того, что изменения в иммунном ответе хозяина также могут быть вовлечены.Интересно, что сообщалось, что моноциты пациентов с гемохроматозом снижали LPS-индуцированную продукцию TNF-α, хотя механизм ранее не был выяснен (53). Это наблюдение подчеркивает клиническую значимость наших результатов на мышах с дефицитом Hfe и потенциально объясняется железозависимым трансляционным контролем биосинтеза цитокинов, который был выявлен в наших экспериментах. Ослабленный воспалительный ответ также может способствовать феномену отбора эпидемических патогенов, который был использован для объяснения высокой частоты вариантов гена Hfe в кавказских популяциях (27).В поддержку этой идеи недавно было показано, что уменьшение воспаления на мышиной модели легочной чумы связано с улучшением выживаемости хозяина (54). Это интригующая возможность, что люди с дефицитом HFE могли иметь преимущество в выживаемости во время эпидемии чумы в Европе, потому что они экспрессировали пониженное количество воспалительных цитокинов.

    Имеют ли наши результаты значение для других нарушений гомеостаза железа, кроме гемохроматоза I типа? Основываясь на наших результатах, можно ожидать снижения воспалительных реакций при гемохроматозах II и III типов, когда низкие уровни циркулирующего гепсидина могут привести к усилению регуляции FPN макрофагов и снижению уровней железа в этих клетках (14).Этот механизм может также применяться к тем формам гемохроматоза типа IV, при которых мутации FPN делают белок нечувствительным к опосредованному гепсидином подавлению регуляции (55). Похожая ситуация может преобладать при талассемии, где недавно было показано, что экспрессия гепсидина подавляется высокими уровнями фактора дифференцировки роста 15 (56). Ослабленные воспалительные реакции, возникающие на фоне низкого содержания железа в интрамакрофагах, могут способствовать увеличению риска инфекции, связанной с гемолитическими расстройствами (4, 6).Эксперименты по изучению этих возможностей явно оправданы и помогут пролить дополнительный свет на взаимосвязь между гомеостазом железа и врожденным иммунитетом.

    Благодарности

    Мы благодарны доктору Нэнси Эндрюс за предоставление нокаут-мышей Hfe , доктору Дэвиду Хейлу за анти-FPN Ab и доктору Прему Понке за подарок SIH.

    Раскрытие информации

    У авторов отсутствует финансовый конфликт интересов.

    Footnotes

    • Затраты на публикацию этой статьи были частично покрыты за счет оплаты страницы. Таким образом, эта статья должна быть помечена как реклама в соответствии с 18 U.S.C. Раздел 1734 исключительно для указания этого факта.

    • ↵1 Эта работа была поддержана грантом экспериментального технико-экономического обоснования Гарвардского научно-исследовательского центра клинического питания (B.J.C.), неограниченным образовательным грантом от Wyeth Nutrition (L.W.) и грантами R21AI06461 (для B.J.C.) и R01ES014638 и R01DK064750 (для M.W.-R.) от Национальных институтов здравоохранения.

    • ↵2 Направляйте корреспонденцию и запросы на перепечатку доктору Бобби Дж. Чераилу, лабораторию иммунологии слизистых оболочек, Массачусетская больница общего профиля, здание 114, 16-я улица, Чарлстаун, Массачусетс 02129. Адрес электронной почты: cherayil {at} helix.mgh .harvard.edu

    • №3 В статье использованы сокращения: FPN, ферропортин; SIH, салицилальдегид изоникотиноилгидразон.

    • Получено 24 марта 2008 г.
    • Принято 18 июня 2008 г.
    • Авторские права © 2008 Американской ассоциации иммунологов

    Ссылки

    1. Schaible, U.E., S.H. Kaufmann. 2004. Железо и микробная инфекция. Nat. Rev. Microbiol. 2: 946-953.

    2. Гангаидзо, И. Т., В. М. Мойо, Э. Мвундура, Г. Аггрей, Н.Л. Мерфри, Х. Хумало, Т. Саунгвенре, И. И. Касвосве, З. А. Гомо, Т. Руо и др. 2001. Связь туберкулеза легких с повышенным содержанием железа в рационе. J. Infect. Дис. 184: 936-939.

    3. Гордюк, В. Р., К. Э. Макларен, А. П. Макфейл, Г. Дейксель, Т. Х. Ботвелл. 1996. Связь перегрузки железом в Африке с гепатоцеллюлярной карциномой и туберкулезом: пересмотр диссертации Страчана 1929 года. Кровь 87: 3470-3476.

    4. Магнус, С.А., И. Р. Хэмблтон, Ф. Мосдин, Г. Р. Сержант. 1999. Рецидивирующие инфекции при гомозиготной серповидно-клеточной анемии. Arch. Дис. Ребенок 80: 537-541.

    5. Мойо В. М., И. Т. Гангаидзо, В. Р. Гордюк, К. Ф. Киире, А. П. Макфейл. 1997. Туберкулез и перегрузка железом в Африке: обзор. Centr. Afr. J. Med. 43: 334-339.

    6. Wanachiwanawin, W. 2000. Инфекции при E-бета-талассемии.J. Pediatr. Гематол. Онкол. 22: 581-587.

    7. Мюррей, М. Дж., А. Б. Мюррей, М. Б. Мюррей, К. Дж. Мюррей. 1978. Неблагоприятное влияние восполнения запасов железа на течение некоторых инфекций. Br. Med. J. 2: 1113-1115.

    8. Ньякерига, А. М., М. Трой-Бломберг, Дж. Р. Дорфман, Н. Д. Александер, Р. Бэк, М. Кортоак, А. К. Чемтаи, К. Марш, Т. Н. Уильямс. 2004. Дефицит железа и малярия у детей, живущих на побережье Кении.J. Infect Dis. 190: 439-447.

    9. С. Сазавал, Р. Э. Блэк, М. Рамсан, Х. М. Чвайя, Р. Дж. Штольцфус, А. Дутта, У. Дхингра, И. Каболе, С. Деб, М. К. Осман, Ф. М. Каболе. 2006. Влияние рутинных профилактических добавок с железом и фолиевой кислотой на госпитализацию и смертность детей дошкольного возраста в условиях высокой передачи малярии: рандомизированное плацебо-контролируемое исследование на уровне общины. Ланцет 367: 133-143.

    10. Олфорд, К. Э., Т. Э. Кинг, младший, П. А. Кэмпбелл. 1991. Роль трансферрина, рецепторов трансферрина и железа в листерицидной активности макрофагов. J. Exp. Med. 174: 459-466.

    11. Коллинз, Х. Л., С. Х. Э. Кауфманн, У. Э. Шайбл. 2002. Хелатирование железа с помощью дефероксамина обостряет экспериментальный сальмонеллез за счет ингибирования никотинамидадениндинуклеотидфосфатоксидазного респираторного взрыва.J. Immunol. 168: 3458-3463.

    12. Пушманн, М., А. М. Ганзони. 1977 г. Повышенная устойчивость мышей с дефицитом железа к инфекции Salmonella . Заразить. Иммун. 17: 663-664.

    13. Рой, М. Ф., Н. Риендо, К. Бедард, П. Хели, Г. Мин-О, К. Тюркотт, П. Гро, Ф. Канон-Херго, Д. Мало. 2007. Дефицит пируваткиназы вызывает у мышей восприимчивость к инфекции Salmonella typhimurium .J. Exp. Med. 204: 2949-2961.

    14. Пьетранджело А. 2006. Наследственный гемохроматоз. Анну. Rev. Nutr. 26: 251-270.

    15. Федер, Дж. Н., А. Гнирке, В. Томас, З. Цучихаши, Д. А. Радди, А. Басава, Ф. Дормишян, Р. Доминго-младший, М. К. Эллис, А. Фуллан и др. 1996 г. Роман MHC ген класса I мутирован у пациентов с наследственным гемохроматозом. Nat. Genet.13: 399-408.

    16. Эндрюс, Н. С. 2007. Гомеостаз железа. Анну. Rev. Physiol. 69: 69-85.

    17. Nemeth, E., T. Ganz. 2006. Регулирование метаболизма железа гепсидином. Анну. Rev. Nutr. 26: 323-342.

    18. Госвами Т., Н. К. Эндрюс. 2006. Взаимодействие белка наследственного гемохроматоза, HFE, с рецептором трансферрина 2 предполагает молекулярный механизм чувствительности к железу у млекопитающих.J. Biol. Chem. 281: 28494-28498.

    19. Nemeth, E., M. S. Tuttle, J. Powelson, M. B. Vaughn, A. Donovan, D. M. Ward, T. Ganz, J. Kaplan. 2004. Гепсидин регулирует отток клеточного железа, связывая ферропортин и вызывая его деградацию. Наука 306: 2090-2093.

    20. Ахмад К. А., Дж. Р. Ахманн, М. К. Мигас, А. Вахид, Р. С. Бриттон, Б. Р. Бэкон, В. С. Слай, Р. Э.Флеминг. 2002. Снижение экспрессии гепсидина в печени у мышей с нокаутом Hfe . Blood Cells Mol. Дис. 29: 361-366.

    21. Bahram, S., S. Gilfillan, L.C. Kuhn, R. Moret, J. B. Schulze, A. Lebeau, K. Schumann. 1999. Экспериментальный гемохроматоз из-за дефицита HFE класса I MHC: иммунный статус и метаболизм железа. Proc. Natl. Акад. Sci. США 96: 13312-13317.

    22. Леви, Дж.Э., Л. К. Монтросс, Д. Э. Коэн, М. Д. Флеминг, Н. К. Эндрюс. 1999. Мутация C282Y, вызывающая наследственный гемохроматоз, не дает нулевого аллеля. Кровь 94: 9-11.

    23. Zhou, XY, S. Tomatsu, RE Fleming, S. Parkkila, A. Waheed, J. Jiang, Y. Fei, EM Brundt, DA Ruddy, CE Prass, et al. 1998. Нокаут гена HFE . производит мышиную модель наследственного гемохроматоза. Proc. Natl. Акад. Sci.USA 95: 2492-2497.

    24. Буллен, Дж. Дж., П. Б. Сполдинг, К. Г. Уорд, Дж. М. Гаттеридж. 1991. Гемохроматоз, железо и сепсис, вызванные Vibrio vulnificus . Arch. Междунар. Med. 151: 1606-1609.

    25. Доэрти, К. П. 2007. Взаимодействие между хозяином и патогеном: роль железа. J. Nutr. 137: 1341-1344.

    26. Герхард, Г.С., К. А. Левин, Г. Дж. Прайс, М. М. Войнар, М. Дж. Чорни, Д. А. Бельчис. 2001. Vibrio vulnificus сепсис у пациента с гемохроматозной мутацией HFE C282Y. Arch. Патол. Лаборатория. Med. 125: 1107-1109.

    27. Моалем, С., Э. Д. Вайнберг, М. Э. Перси. 2004. Гемохроматоз и загадка неуместного железа: последствия для инфекционных заболеваний и выживания. Биометаллы 17: 135-139.

    28. Хлоста, С., Д. С. Фишман, Л. Харрингтон, Э. Джонсон, М. Д. Кнутсон, М. Весслинг-Резник, Б. Дж. Чераил. 2006. Железный белок ферропортин регулирует внутриклеточный рост Salmonella enterica . Заразить. Иммун. 74: 3065-3067.

    29. Наирц, М., И. Тьюри, С. Людвичек, М. Тьюри, С. М. Майр, Г. Фриче, Г. Вайс. 2007. Скоординированная регуляция гомеостаза железа в мышиных макрофагах ограничивает доступность железа для внутриклеточного Salmonella typhimurium .Cell Microbiol. 9: 2126-2140.

    30. Олаканми, О., Л. С. Шлезингер, Б. Э. Бритиган. 2007. Наследственный гемохроматоз приводит к снижению усвоения и роста железа Mycobacterium tuberculosis в макрофагах человека. J. Leukocyte Biol. 81: 195-204.

    31. Парадкар П., И. Де Доменико, Н. Дурчфор, И. Зон, Дж. Каплан и Д. М. Уорд. 2008. Истощение запасов железа ограничивает внутриклеточный рост бактерий в макрофагах. Кровь . Под давлением.

    32. Бартель, М., С. Хапфельмайер, Л. Кинтанилья-Мартинес, М. Кремер, М. Роде, М. Хогардт, К. Пфеффер, Х. Рюссманн, W.-D. Hardt. 2003. Предварительная обработка мышей стрептомицином дает модель колита серовара Typhimurium Salmonella enterica , которая позволяет анализировать как патоген, так и хозяина. Заразить. Иммун. 71: 2839-2858.

    33. Ри, С.J., W.A. Walker, B.J. Cherayil. 2005. Регулируемая в процессе развития экспрессия в кишечнике IFNγ и его генов-мишеней и возрастной ответ на кишечную инфекцию Salmonella . J. Immunol. 175: 1127-1136.

    34. Li, Q., B.J. Cherayil. 2003. Роль Toll-подобного рецептора 4 в активации и толерантности макрофагов при инфицировании сероваром Typhimurium Salmonella enterica . Заразить. Иммун. 71: 4873-4882.

    35. Ю., С., Б. Йорк, С. Ван, К. Фэн, Дж. Сюй, Б. В. О’Мэлли. 2007. Существенная функция соактиватора SRC-3 в подавлении трансляции цитокиновой мРНК и воспалительной реакции. Мол. Клетка. 25: 765-778.

    36. Харрингтон, Л., К. В. Срикант, Р. Энтони, Х. Н. Ши, Б. Дж. Чераил. 2007. Роль естественных клеток-киллеров в воспалении кишечника, вызванном инфекцией Salmonella enterica серовар Typhimurium. ФЭМС Иммунол.Med. Microbiol. 51: 372-380.

    37. Rydström, A., M. J. Wick. 2007. Привлечение, активация и функция моноцитов в лимфоидной ткани, ассоциированной с кишечником, во время пероральной инфекции Salmonella . J. Immunol. 178: 5789-5801.

    38. Вик, М. Дж .. 2004. Жизнь в опасной зоне: врожденный иммунитет к Salmonella . Curr. Opin. Microbiol. 7: 51-57.

    39. Ройл, М.К., С. Тётемейер, Л. К. Олдридж, Д. Дж. Маскелл, К. Э. Брайант. 2003. Стимуляция Toll-подобного рецептора 4 липополисахаридом во время клеточной инвазии живыми Salmonella typhimurium является критическим, но не исключительным событием, приводящим к ответам макрофагов. J. Immunol. 170: 5445-5454.

    40. Вайс, Д. С., Б. Раупах, К. Такеда, С. Акира, С. Зихлинский. 2004. Toll-подобные рецепторы временно участвуют в защите хозяина.J. Immunol. 172: 4463-4469.

    41. Кнутсон, М. Д., М. Оукка, Л. М. Косс, Ф. Айдемир, М. Весслинг-Резник. 2005. Высвобождение железа из макрофагов после эритрофагоцитоза активируется сверхэкспрессией ферропортина 1 и подавляется гепсидином. Proc. Natl. Акад. Sci. США 102: 1324-1328.

    42. Браун, Дж. Х., П. Д. Баккет, М. Весслинг-Резник. 2004. Идентификация низкомолекулярных ингибиторов, которые различают захват железа, связанного с трансферрином, и транспорт железа, опосредованный трансферрином.Chem. Биол. 11: 407-416.

    43. Кахлон О., Кабанчик З.Л. 2002. Лабильный пул железа: характеристика, измерение и участие в клеточных процессах. Свободный Радич. Биол. Med. 33: 1037-1046.

    44. Simunek, T., C. Boer, RA Bouwman, R. Vlasblom, AM Versteilen, M. Sterba, V. Gersl, R. Hrdina, P. Ponka, JJ de Lange, et al. 2005. SIH, роман липофильный хелатор железа, защищает кардиомиобласты H9c2 от вызванного окислительным стрессом повреждения митохондрий и гибели клеток.J. Mol. Клетка. Кардиол. 39: 345-354.

    45. Темплтон, Д. М., Ю. Лю. 2003. Генетическая регуляция функции клеток в ответ на перегрузку железом или хелатирование. Биохим. Биофиз. Acta 1619: 113-124.

    46. Руо, Т. А. 2006. Роль белков, регулирующих железо, в гомеостазе железа и заболеваниях млекопитающих. Nat. Chem. Биол. 2: 406-414.

    47. Санчес, М., Б. Гали, М. У. Мукенталер, М. В. Хенце. 2007. Белки, регулирующие железо, ограничивают экспрессию индуцируемого гипоксией фактора-2α при дефиците железа. Nat. Struct. Мол. Биол. 14: 420-426.

    48. Андерсон П., 2008. Посттранскрипционный контроль продукции цитокинов. Nat. Иммунол. 9: 353-359.

    49. Арнольд, Дж. У., Д. В. Низель, К. Р. Эннэйбл, К. Б. Гесс, М. Асунсьон, Ю. Дж. Чо, Дж.В. Петерсон, Г. Р. Климпель. 1993. TNFα опосредует раннюю патологию при инфекции желудочно-кишечного тракта Salmonella . Microb. Патог. 14: 217-227.

    50. Джонс, С. А. 2005. Направление перехода от врожденного иммунитета к приобретенному: определение роли IL-6. J. Immunol. 175: 3463-3468.

    51. Надо, У. Дж., Т. Г. Пистоле, Б. А. Маккормик. 2002. Миграция полиморфноядерных лейкоцитов через модельный эпителий кишечника усиливает уничтожение Salmonella typhimurium посредством цитокина, производного от эпителия, IL-6.Микробы заражают. 4: 1379-1387.

    52. Васкес-Торрес, А., Дж. Фантуцци, К. К. Эдвардс, III, К. А. Динарелло, Ф. К. Фанг. 2001. Дефектная локализация НАДФН-фагоцитарной оксидазы в фагосомах, содержащих Salmonella , у мышей с дефицитом рецептора TNF p55. Proc. Natl. Акад. Sci. США 98: 2561-2565.

    53. Гордюк, В. Р., С. Баллоу, Г. Лозанский, Г. М. Риттенхэм.1992. Снижение концентрации TNFα в супернатантах моноцитов от гомозигот по наследственному гемохроматозу. Кровь 79: 1855-1860.

    54. Латем, У. А., П. А. Прайс, В. Л. Миллер, У. Э. Гольдман. 2007. Активирующая плазминоген протеаза специфически контролирует развитие первичной легочной чумы. Наука 315: 509-513.

    55. Дрейксмит, Х., Л. М. Шимански, Э.Ормерод, А. Т. Мерривезер-Кларк, В. Випракасит, Дж. П. Эдвардс, Э. Свитленд, Дж. М. Бастин, Д. Коули, Ю. Чинтаммитр и др. 2005. Устойчивость к гепсидину обеспечивается мутациями ферропортина, связанными с гемохроматозом. Кровь 106: 1092-1097.

    56. Tanno, T., NV Bhanu, PA Oneal, SH Goh, P. Staker, YT Lee, JW Moroney, CH Reed, NL Luban, RH Wang, et al. 2007. Высокие уровни GDF15 при талассемии подавляют экспрессию белок, регулирующий железо, гепсидин.Nat. Med. 13: 1096-1101.

    CCR-12-2986 2723..2733

    % PDF-1.4 % 49 0 объект > эндобдж 8 0 объект > поток 2013-04-29T10: 51: 46 + 05: 302021-10-18T18: 23: 05-07: 00Arbortext Advanced Print Publisher 9.1.406 / W Unicode2021-10-18T18: 23: 05-07: 00 Acrobat Distiller 9.4.0 Приложение (Macintosh) / pdf

  • CCR-12-2986 2723..2733
  • вершина
  • uuid: b9fde557-1dd1-11b2-0a00-680927bd3700uuid: b9fde55b-1dd1-11b2-0a00-5b0000000000 конечный поток эндобдж 94 0 объект > эндобдж 100 0 объект > эндобдж 118 0 объект > эндобдж 40 0 объект > эндобдж 35 0 объект > эндобдж 4 0 obj > / Font> / ProcSet [/ PDF / Text] >> / TrimBox [28.224 28.224 613.241 811.197] / Тип / Страница >> эндобдж 121 0 объект > / ProcSet [/ PDF / Text / ImageC] / XObject >>> / Type / Page >> эндобдж 126 0 объект [132 0 R 133 0 R 134 0 R 135 0 R 136 0 R 137 0 R 138 0 R 139 0 R] эндобдж 127 0 объект > поток q 539.3594055 0 0 83.3014526 50.8202972 707.6985474 см / Im0 Do Q BT / T1_0 1 Тс 10 0 0 10 105,56985 609,99985 тм (2013; 19: 2723-2733. Опубликовано в Интернете 2 апреля 2013 г.) Tj / T1_1 1 Тс -7.55699 0 Тд (Clin Cancer Res \ 240) Tj / T1_0 1 Тс 0 1 ТД (\ 240) Tj 0 1.00001 TD (Кэ-Да Ю, Руи Чжу, Мин Чжан и др.) Tj / T1_2 1 Тс 0 1 ТД (\ 240) Tj / T1_3 1 Тс 18 0 0 18 30 649,99997 тм (Химиорезистентный тройной отрицательный рак груди) Tj Т * (Выявление релевантных для прогноза подгрупп у пациентов с) Tj ET 30 522 581 68 рэ 0 0 мес. S BT / T1_0 1 Тс 11 0 0 11 120,94 202 562,99997 тм (\ 240) Tj / T1_3 1 Тс -7,55696 1 тд (Обновленная версия) Tj ET BT / T1_2 1 Тс 10 0 0 10 141 554,99994 тм (\ 240) Tj / T1_0 1 Тс 16.73097 1 тд () Tj 0 0 1 рг -15.11897 0 Td (10.1158 / 1078-0432.CCR-12-2986) Tj 0 г -1.612 0 Тд (DOI 🙂 Tj 0 1.00001 TD (См. Самую последнюю версию этой статьи по адресу:) Tj ET BT / T1_0 1 Тс 11 0 0 11 120,94202 521,99994 тм (\ 240) Tj / T1_3 1 Тс -3,50099 1 тд (Материал) Tj -3,44499 1,00001 тд (Дополнительно) Tj ET BT / T1_2 1 Тс 10 0 0 10 141 524,99994 тм (\ 240) Tj / T1_0 1 Тс 41.12993 1 Td () Tj 0 0 1 рг -41.12993 0 Тд (http://clincancerres.aacrjournals.org/content/suppl/2013/03/29/1078-0432 \ .CCR-12-2986.DC1) Tj 0 г Т * (Доступ к самым последним дополнительным материалам по адресу:) Tj ET BT / T1_2 1 Тс 10 0 0 10 30 501.99997 Тм (\ 240) Tj 0 1 ТД (\ 240) Tj ET BT / T1_2 1 Тс 10 0 0 10 30 481,99997 тм (\ 240) Tj Т * (\ 240) Tj ET 30 412 581 70 рэ 0 0 мес. S BT / T1_0 1 Тс 11 0 0 11 120,94202 449,99997 тм (\ 240) Tj / T1_3 1 Тс -6.00198 1 тд (Цитированные статьи) Tj ET BT / T1_2 1 Тс 10 0 0 10 141 441,99994 тм (\ 240) Tj / T1_0 1 Тс 30,40193 1 тд () Tj 0 0 1 рг -30,40193 0 Тд (http: //clincancerres.aacrjournals.org/content/19/10/2723.full#ref-list-1 \ ) Tj 0 г 0 1.00001 TD (Эта статья содержит 36 статей, 17 из которых вы можете получить бесплатно по адресу:) Tj ET BT / T1_0 1 Тс 11 0 0 11 120.94202 419.99997 тм (\ 240) Tj / T1_3 1 Тс -6,33498 1 тд (Цитирование статей) Tj ET BT / T1_2 1 Тс 10 0 0 10 141 411,99994 тм (\ 240) Tj / T1_0 1 Тс 31.79193 1 тд () Tj 0 0 1 рг -31.79193 0 Тд (http: //clincancerres.aacrjournals.org/content/19/10/2723.full#related-ur \ ls) Tj 0 г Т * (Эта статья процитирована в 4 статьях, размещенных на HighWire. Перейдите в ar \ ticles at:) Tj ET BT / T1_2 1 Тс 10 0 0 10 30 391,99997 тм (\ 240) Tj 0 1 ТД (\ 240) Tj ET 30 277 581 115 рэ 0 0 мес. S BT / T1_0 1 Тс 11 0 0 11 120.94 202 359.99997 Тм (\ 240) Tj / T1_3 1 Тс -5.66901 1 тд (Оповещения по электронной почте) Tj ET BT / T1_0 1 Тс 10 0 0 10 295,49966 372 тм (относится к этой статье или журналу.) Tj 0 0 1 рг -15.44997 0 Тд (Зарегистрируйтесь, чтобы получать бесплатные уведомления по электронной почте) Tj ET BT 0 г / T1_0 1 Тс 11 0 0 11 120.94202 326.99994 тм (\ 240) Tj / T1_3 1 Тс -6.38997 1 тд (Подписки) Tj 0,556 1,00001 тд (Отпечатки и) Tj ET BT / T1_0 1 Тс 10 0 0 10 141 329,99994 тм (\ 240) Tj 6.85098 1 тд (.) Tj 0 0 1 рг -6.85098 0 Тд ([email protected]) Tj 0 г 0 1.00001 TD (Чтобы заказать перепечатку статьи или подписаться на журнал, свяжитесь с нами \ t Отдел публикаций AACR в) Tj ET BT / T1_0 1 Тс 11 0 0 11 120.94202 304,99997 тм (\ 240) Tj / T1_3 1 Тс -5.66901 1 тд (Разрешения) Tj ET BT / T1_0 1 Тс 10 0 0 10 141 276,99988 тм (\ 240) Tj 0 1 ТД (Сайт с правами.) Tj 0 1.00001 TD (Нажмите «Запросить разрешения», чтобы перейти на страницу защиты авторских прав \ Центр раннса \ (CCC \)) Tj 24.67896 1 тд (.) Tj 0 0 1 рг -24.67896 0 Тд (http://clincancerres.aacrjournals.org/content/19/10/2723)Tj 0 г 0 1 ТД (Чтобы запросить разрешение на повторное использование всей или части этой статьи, используйте это li \ nk) Tj ET BT / T1_0 1 Тс 9 0 0 9 270.64792 11 тм (18 октября 2021 г. \ 251 Американская ассоциация исследований рака, 2013 г. \ ) Tj 0 0 1 рг -13,61496 0 тд (Clincancerres.aacrjournals.org) Tj 0 г -8.11398 0 Td (Скачано с) Tj ET BT / T1_0 1 Тс 9 0 0 9 168.18217 826 тм (Опубликовано в Интернете 2 апреля 2013 г .; DOI: 10.1158 / 1078-0432.CCR-12-2986 \ ) Tj ET конечный поток эндобдж 131 0 объект > / Filter / FlateDecode / Height 238 / Length 73913 / Name / X / Subtype / Image / Type / XObject / Width 1541 >> stream HϏn`’G6R0 «#AKH» 9 \ C |

    Вт, 19 окт.2021 г., 01:23:17 GMT Неверное имя процедуры, часть превышает 30 байт Имя папы: prod ПРОЦЕДУРА: hwwkrnbw.p_displaydept? sel_term = 201301 & sel_ptrm = b & sel_dept = hu & sel_desc = humanities + and + arts & sel_level = 01 & sel_campus = x URL: http://banner-as6.admin.wpi.edu:443/pls/prod/hwwkrnbw.p_displaydept?sel_term=201301&sel_ptrm=b&sel_dept=hu&sel_desc=humanities+and+arts&sel_level=01&sel_campus=x ПАРАМЕТРЫ: =========== СРЕДА: ============ PLSQL_GATEWAY = WebDb GATEWAY_IVERSION = 2 SERVER_SOFTWARE = ​​Oracle-Application-Server-11g GATEWAY_INTERFACE = CGI / 1.1 SERVER_PORT = 443 SERVER_NAME = banner-as6.admin.wpi.edu REQUEST_METHOD = ПОЛУЧИТЬ QUERY_STRING = PATH_INFO = / hwwkrnbw.p_displaydept? Sel_term = 201301 & sel_ptrm = b & sel_dept = hu & sel_desc = humanities + and + arts & sel_level = 01 & sel_campus = x SCRIPT_NAME = / pls / prod REMOTE_HOST = REMOTE_ADDR = 130.215.40.20 SERVER_PROTOCOL = HTTP / 1.1 REQUEST_PROTOCOL = HTTPS REMOTE_USER = banweb_user ORACLE_SSO_USER = OSSO_IDLE_TIMEOUT_EXCEEDED = OSSO_USER_GUID = HTTP_CONTENT_LENGTH = HTTP_CONTENT_TYPE = application / x-www-form-urlencoded; charset = UTF-8 HTTP_USER_AGENT = Mozilla / 5.0 (X11; Linux x86_64; rv: 33.0) Gecko / 20100101 Firefox / 33.0 HTTP_HOST = bannerweb.wpi.edu HTTP_ACCEPT = текст / HTML, приложение / xhtml + xml, приложение / xml; q = 0,9, * / *; q = 0,8 HTTP_ACCEPT_ENCODING = идентификатор HTTP_ACCEPT_LANGUAGE = en-US, en; q = 0,5 HTTP_ACCEPT_CHARSET = windows-1251, utf-8; q = 0,7, *; q = 0,7 HTTP_COOKIE = HTTP_IF_MODIFIED_SINCE = HTTP_REFERER = HTTP_SOAPACTION = HTTP_ORACLE_ECID = HTTP_ORACLE_CACHE_VERSION = HTTP_AUTHORIZATION = WEB_AUTHENT_PREFIX = DAD_NAME = продукт DOC_ACCESS_PATH = документы DOCUMENT_TABLE = GURUPLD PATH_ALIAS = REQUEST_CHARSET = AL32UTF8 REQUEST_IANA_CHARSET = UTF-8 SCRIPT_PREFIX = / пожалуйста HTTP_IF_MATCH = HTTP_CACHE_CONTROL = SOAP_BODY = HTTP_X_ORACLE_DEVICE_CLASS = HTTP_X_ORACLE_DEVICE_ORIENTATION = HTTP_X_ORACLE_DEVICE_MAXDOCSIZE = HTTP_X_ORACLE_DEVICE = HTTP_X_ORACLE_ORIG_ACCEPT = HTTP_X_ORACLE_ORIG_USER_AGENT = HTTP_X_ORACLE_USER_LOCALE = HTTP_X_ORACLE_USER_NAME = HTTP_X_ORACLE_USER_DISPLAYNAME = HTTP_X_ORACLE_USER_USERKIND = HTTP_X_ORACLE_USER_AUTHKIND = HTTP_X_ORACLE_USER_DEVICEID = HTTP_X_ORACLE_USER_LOCATION_ADDRESSLINE1 = HTTP_X_ORACLE_USER_LOCATION_ADDRESSLINE2 = HTTP_X_ORACLE_USER_LOCATION_ADDRESSLASTLINE = HTTP_X_ORACLE_USER_LOCATION_BLOCK = HTTP_X_ORACLE_USER_LOCATION_CITY = HTTP_X_ORACLE_USER_LOCATION_COMPANYNAME = HTTP_X_ORACLE_USER_LOCATION_COUNTY = HTTP_X_ORACLE_USER_LOCATION_STATE = HTTP_X_ORACLE_USER_LOCATION_POSTALCODE = HTTP_X_ORACLE_USER_LOCATION_POSTALCODEEXT = HTTP_X_ORACLE_USER_LOCATION_COUNTRY = HTTP_X_ORACLE_USER_LOCATION_TYPE = HTTP_X_ORACLE_USER_LOCATION_X = HTTP_X_ORACLE_USER_LOCATION_Y = HTTP_X_ORACLE_SERVICE_HOME_URL = HTTP_X_ORACLE_SERVICE_PARENT_URL = HTTP_X_ORACLE_HOME_URL = HTTP_X_ORACLE_MODULE_CALLBACK_URL = HTTP_X_ORACLE_MODULE_CALLBACK_LABEL = HTTP_X_ORACLE_CACHE_USER = HTTP_X_ORACLE_CACHE_SUBID = HTTP_X_ORACLE_CACHE_AUTH = HTTP_X_ORACLE_CACHE_DEVICE = HTTP_X_ORACLE_CACHE_LANG = HTTP_X_ORACLE_CACHE_ENCRYPT = HTTP_X_ORACLE_ASSERT_USER =

    Рецептор фактора некроза опухоли 1 является негативным регулятором пролиферации предшественников в нейрогенезе гиппокампа у взрослых

    Животные и хирургия.

    Все экспериментальные процедуры следовали рекомендациям, установленным Этическим комитетом Мальмё-Лунда в отношении использования лабораторных животных и ухода за ними. TNF-R1 / R2 — / — мышей (Peschon et al., 1998), скрещенных в течение пяти поколений с мышами C57BL / 6 дикого типа, были приобретены в лаборатории Джексона (Бар-Харбор, штат Мэн). Мы создали TNF-R1 — / — и TNF-R2 — / — мышей путем скрещивания TNF-R1 / R2 — / — с мышами C57BL / 6 дикого типа (B & K Universal, Стокгольм, Швеция) и скрещивание гетерозиготного потомства с последующим отбором соответствующих генотипов, как определено с помощью ПЦР.Мыши C57BL / 6 дикого типа и в одном эксперименте однопометники дикого типа, полученные из шестого поколения гетерозиготных родительских особей TNF-R1 / R2 +/- , использовали в качестве контроля, что дало аналогичные результаты при оценке базального нейрогенеза. (данные не показаны).

    Взрослый самец TNF-R1 — / — ( n = 29), TNF-R2 — / — ( n = 43), TNF-R1 / R2 — / — ( n = 35), TNF-R1 / R2 + / + ( n = 7) и мыши C57BL / 6 дикого типа ( n = 32), массой 22–24 г. , были использованы для исследований in vivo .Мыши с нестин-зеленым флуоресцентным белком (GFP) для сортировки предшественников гиппокампа были подарком доктора Г. Ениколопова (Лаборатория Колд-Спринг-Харбор, Колд-Спринг-Харбор, Нью-Йорк). Крысы Sprague Dawley ( n = 6; 220–250 г), использованные для культивирования предшественников гиппокампа, были от B&K Universal. Животных содержали отдельно в условиях 12 ч свет / темнота с доступом ad libitum к воде и пище.

    Восемьдесят пять мышей анестезировали галотаном и имплантировали скрученный изолированный стимулирующий и регистрирующий электрод из нержавеющей стали (Plastics One, Roanoke, VA) в одностороннем порядке в вентральную область CA1 – CA3 гиппокампа (координаты: 2.9 мм каудально и 3,0 мм латеральнее брегмы, 3,0 мм вентрально от твердой мозговой оболочки и зубной планке на -3,3 мм).

    Индукция эпилептического статуса.

    Через десять дней после имплантации электродов 59 мышей были подвергнуты электрически индуцированной SE, как первоначально описано Lothman et al. (1989). Мыши получали 1 час надпороговой стимуляции, состоящей из 10-секундных последовательностей двухфазных прямоугольных импульсов длительностью 1 мс с частотой 50 Гц. Стимуляцию прерывали каждые 10 мин на 1 мин для записи электроэнцефалограммы (ЭЭГ) и измерения постразрядов (MacLab; AD Systems, Hastings, UK).После прекращения стимуляции у всех мышей проявлялась самостоятельная, непрерывная иктальная активность ЭЭГ гиппокампа, которая была связана с различной степенью тяжести двигательных поведенческих судорог, разделенных на парциальные и генерализованные приступы. Парциальные припадки включали гиперактивное двигательное поведение и оценивались как 0–2 балла по классической шкале двигательного поведения при киндлинге. Генерализованные приступы соответствовали клоническим приступам 3-5 степени (Racine, 1972). Как поведенческие судороги, так и иктальная активность ЭЭГ были купированы у всех мышей с помощью пентобарбитала (40 мг / кг, т.п.) через 2 ч после компенсации стимуляции.

    Введение бромдезоксиуридина и групповое назначение.

    Мышей разделили на четыре группы лечения и получили инъекции бромдезоксиуридина (BrdU) [50 мг / кг, внутрибрюшинно, растворенного в калиевом PBS (KPBS)]. (1) Наивным мышам ( n = 42) вводили BrdU два раза в день в течение 2 недель для маркировки значительного количества новых клеток, после чего им позволяли выжить в течение 2 недель. (2) Наивные мыши ( n = 19) получали инъекции BrdU каждые 2 часа в течение 6-часового периода и перфузировали через 2 часа.(3) Мышам, подвергнутым SE ( n = 31) и нестимулированным контрольным пациентам с имплантированным электродом ( n = 14), вводили BrdU дважды в день в течение 1 недели, начиная с 7 дней после SE на пике SE- индуцировали пролиферацию (Parent et al., 1997) и перфузировали через 4 недели после последней инъекции. (4) Мыши, подвергнутые SE ( n = 28) и нестимулированные контрольные с имплантированными электродами ( n = 12) получали инъекции BrdU каждые 2 часа в течение 6-часового периода, начиная с 7 дней после SE, и получали перфузию 2. ч после последней инъекции BrdU.

    Иммуногистохимия.

    Мыши получили передозировку анестезии (пентобарбитал натрия; 200 мг / кг, внутрибрюшинно) и им была сделана транскардиальная перфузия 100 мл физиологического раствора с последующим введением 100 мл ледяного раствора формальдегида [4% параформальдегида (PFA) в 0,1 м PBS, pH 7,4]. Мозг удаляли, фиксировали в течение ночи в той же среде и помещали в 20% сахарозу в 0,1 м фосфатном буфере на 24 часа. Коронковые срезы (30 мкм) вырезали на замораживающем микротоме и хранили в криозащитном растворе.

    Для иммунофлуоресценции BrdU и нейрон-специфического ядерного белка (NeuN) свободно плавающие срезы денатурировали в 1 м HCl в течение 30 мин при + 65 ° C, промывали в KPBS (для нейтрализации pH), предварительно инкубировали с 2% козьего молока. и ослиную сыворотку в 0,25% Triton X-100 в течение 1 часа и инкубировали в течение ночи с крысиным антителом против BrdU (1: 100; Sigma, Стокгольм, Швеция) и мышиным антителом против NeuN (1: 100; Chemicon, Temecula, CA ) при + 4 ° С. Затем срезы промывали и инкубировали в темноте в течение 2 часов с конъюгированными с цианином 3 ослиными антителами против IgG крысы (1: 400; Jackson ImmunoResearch, West Grove, PA) и биотинилированными лошадиными антителами против IgG мыши (1: 200; Vector Laboratories, Järfälla, Швеция), инкубировали в стрептавидине Alexa Fluor 488 (1: 200; Invitrogen, Carlsbad, CA) в темноте в течение 2 часов, помещали на предметные стекла и закрывали средой на основе глицерина (для флуоресцентной микроскопии).

    Для окрашивания ядерного антигена пролиферирующих клеток (PCNA), фосфорилированного гистона h4 (p-h4), ионизированной кальций-связывающей адаптерной молекулы 1 макрофаг / микроглиа-специфический белок (Iba1) и астроцит-специфический маркер S100β (S100β), свободный — плавающие срезы гасили 3% H 2 O 2 и 10% метанолом в KPBS в течение 30 минут при комнатной температуре, промывали в KPBS (для нейтрализации pH), предварительно инкубировали в течение 1 часа с 2% лошадиной сывороткой в ​​0,25% тритоне. X-100 для PCNA и 2% козьей сыворотки в 0.25% Triton X-100 для p-h4, Iba1 и S100β. После этого срезы инкубировали в течение ночи с мышиным антителом против PCNA (1: 1000; Santa Cruz Biotechnology, Санта-Крус, Калифорния), кроличьим антителом против p-h4 (1: 400; Upstate, Шарлоттсвилль, Вирджиния), кроличьим анти-Iba1. антитело (1: 1000; Wako Chemicals, Neuss, Германия) или кроличье антитело против S100β (1: 5000; Swant, Беллинцона, Швейцария) при + 4 ° C, промывают и инкубируют с биотинилированными лошадьми антимышиными антителами IgG ( 1: 200; Vector Laboratories) для PCNA или биотинилированных козьих антител против кроличьего IgG (1: 200; Vector Laboratories) для p-h4, Iba1 и S100β.Затем срезы инкубировали с комплексом авидин-биотин-пероксидаза (набор Elite ABC; Vector Laboratories) в течение 1,5 ч, обрабатывали диаминобензидином (0,5 мг / мл) и 3% перекисью водорода и, наконец, промывали в KPBS, установленном на предметных стеклах. и обезвоживают в увеличивающихся концентрациях этанола (70, 95 и 99%), прежде чем покрыть покровным стеклом монтажной средой Pertex для световой микроскопии.

    Для окрашивания фтор-нефритом свободно плавающие срезы мозга помещали в KPBS и оставляли сушиться в течение ночи.Как подробно описано ранее (Schmued et al., 1997), срезы регидратировали, предварительно обрабатывали 0,06% перманганатом калия в течение 15 минут, промывали в дистиллированной воде, инкубировали в 0,01% рабочем растворе фтор-нефрита (Histo-Chem, Jefferson, AR ) в течение 30 мин, промыть дистиллированной водой, погрузить в ксилол и накрыть покровным стеклом.

    Микроскопический анализ.

    Все оценки были выполнены наблюдателем, не знающим условий лечения. Иммуноокрашивание исследовали с помощью светового микроскопа Olympus Optical (Albertslund, Дания) AX-70.Подсчитывали количество иммунореактивных клеток в слое гранулярных клеток (GCL) и в пределах двух диаметров клеток ниже этой области в SGZ (называемой SGZ / GCL). Стереологические оценки общего количества BrdU-положительных (BrdU + ), Iba1 + и S100β + клеток в SGZ / GCL дорсальной гиппокампа были выполнены с использованием метода оптического фракционатора (Gundersen and Jensen, 1987; West et al., 1991). Три коронарных среза, расположенных на 1,7–2,3 мм кзади от брегмы, анализировали с помощью микроскопа Olympus Optical BH-2 с масляным объективом 100x, цветной видеокамеры CCD-IRIS и программного обеспечения CAST-GRID (Olympus Optical).Для систематической выборки площадь рамки была установлена ​​на 1491,7 мкм 2 с интервалом счета 40 мкм на уровне x и y , а оптический диссектор составлял долю 5 мкм от общей толщины среза. (размером 7–9 мкм). Ни площадь для подсчета, ни толщина анализируемых срезов (измеренная с помощью Heidenhain Microcator и программного обеспечения CAST-GRID) не различались между группами, что позволяло сравнивать количество клеток. Объем SGZ / GCL измеряли с помощью стереологического оборудования в тех же сечениях.Из-за их небольшого количества количество клеток p-h4 + и PCNA + в SGZ / GCL дано в виде клеток на секцию.

    Совместная локализация BrdU-положительных клеток с NeuN была подтверждена с использованием конфокального сканирующего светового микроскопа (MRC1024UV; Bio-Rad, Hemel Hempstead, UK) с фильтром возбуждения криптон / аргон 488 и 568. Клетка с двойным окрашиванием была определена как имеющая наибольшую интенсивность обоих окрашиваний в пределах одного или непосредственно соседних оптических срезов толщиной 1 мкм через клетку в последовательной серии Z , состоящей по крайней мере из четырех срезов, с перекрытием окрашивание не менее чем на трех срезах.Кроме того, клетка с двойной меткой не показала иммунореактивности BrdU вне ядра тела клетки NeuN + . Пятьдесят BrdU-положительных клеток от каждого животного анализировали на двойное мечение NeuN в SGZ / GCL.

    Измерение цитокинов.

    гиппокампа дикого типа, TNF-R1 — / — , TNF-R2 — / — и TNF-R1 / R2 — / — мышей ( n = 7 для все группы) были вскрыты и непосредственно заморожены на сухом льду.Белок экстрагировали путем гомогенизации в PBS с коктейлем ингибиторов протеаз (Sigma) на льду с использованием пестика для гранул и мотора (Sigma). Гомогенат очищали от клеточного мусора центрифугированием. Общий белок определяли в осадке с использованием анализа белка BCA (Pierce Endogen, Rockford, IL). Количество интерлейкина-1β (IL-1β), IL-6 и TNF-α в гомогенате измеряли с помощью ELISA (Pierce Endogen), и данные представлены в пикограммах на миллиграмм общего белка гиппокампа.

    Культура клеток.

    Нейральные культуры предшественников, полученные из гиппокампа взрослых крыс, были инициированы, как описано ранее (Gage et al., 1995; Palmer et al., 1997). Вкратце, крыс подвергали глубокой анестезии с использованием галотана, обезглавливали и удаляли мозг. Гиппокампы препарировали, объединяли и диссоциировали в среде DMEM (Invitrogen, Стокгольм, Швеция), содержащей 2,5 Ед / мл папаина, 1 Ед / мл диспазы II и 250 Ед / мл ДНКазы 1 (Worthington Biochemical, Стокгольм, Швеция) в течение 45 мин при + 37 ° С. Диссоциированные клетки очищали на двух градиентах Percoll (Pharmacia, Uppsala, Sweden), 35 и 65%.Полученные клетки культивировали в культуральных колбах или предметных стеклах, покрытых поли-1-орнитином (Invitrogen, Стокгольм, Швеция) и ламинином (Sigma), в среде DMEM / F-12 с добавлением 15 мм HEPES, 2 мм l-глутамина, 100 Ед. / мл пенициллина, 100 мг / мл стрептомицина, добавка N2 (Invitrogen, Стокгольм, Швеция) и 20 нг / мл основного FGF (R&D Systems, Abingdon, UK).

    Для иммуноцитохимии крысиные клетки-предшественники культивировали на предметных стеклах, покрытых поли-1-орнитином / ламинином, фиксировали 4% PFA в течение 15 мин и окрашивали мышиными антителами против TNF-R1 и козьими антителами против TNF-R2. (Санта-Крус Биотехнология) на ночь при + 4 ° C.Окрашивание визуализировали с помощью биотинилированных антител лошади против мыши и кролика против козы (Vector Laboratories) с использованием набора для амплификации TSA (Becton Dickinson, Стокгольм, Швеция) и стрептавидина Alexa Fluor 488 (Invitrogen, Карлсбад, Калифорния).

    Сортировка клеток и обратная транскрипция-ПЦР.

    Hippocampi от мышей нестин-GFP объединяли и диссоциировали, как описано выше, и клетки очищали в 35% градиенте Перколла. GFP-положительные клетки сортировали на клеточном сортировщике с активацией флуоресценции [FACS DiVa (Becton Dickinson)] непосредственно в буфер для лизиса клеток.Выделяли тотальную РНК из GFP-положительных клеток мыши и культур предшественников гиппокампа крысы (RNAqueos для ПЦР; Ambion, Хантингдон, Кембриджшир, Великобритания) и обратно транскрибировали в кДНК с использованием праймеров oligo-dT и Superscript II (Invitrogen, Стокгольм, Швеция). ПЦР выполняли со следующими праймерами, температурами отжига и ожидаемым размером продукта для мыши: смысловой глицеральдегид-3-фосфатдегидрогеназой (GAPDH), 5 ‘TCACCATCTTCC AGGAGCGA 3’ и антисмысловой, 5’ACCAGGAAATGAGCTTGACA 3 ‘, + 56 ° C, 720 bp; TNF-α смысловой, 5 ‘ATGAGCACAGAAAGCATGATCCGCGAC 3’ и антисмысловой, 5 ‘TCACAGAGCAATGACTCCAAAGTAGACCTG 3’, + 62 ° C, 700 п.н .; TNF-R1 смысловой, 5 ‘CCGGGCCACCTGGTCCG 3’ и антисмысловой, 5 ‘CAAGTAGGTTCCTTTGTG 3’, + 55 ° C, 307 п.н .; и TNFR2 смысловой, 5 ‘CTCGCGCTGGTCTTCGAACTG 3’ и антисмысловой, 5 ‘GGTATACATGCTTGCCTCACAGTC 3’, + 62 ° C, 234 п.н. (Reddy et al., 2001). Для крыс праймеры, температуры отжига и ожидаемые размеры продуктов следующие: смысл GAPDH, 5 ‘TCCTGCACCACCAACTGCTTAGCC 3’ и антисмысловой, 5 ‘TAGCCCAGGATGCCCTTTAGTGGG 3’, + 60 ° C, 377 п.н .; TNF-α смысловой, 5 ‘TGGCCCAGACCCTCACACTC 3’ и антисмысловой, 5 ‘CTCCTGGTATGAAATG GCAAATC 3’, + 59 ° C, 281 п.н .; TNF-R1 смысловой, 5 ‘GAACACCGTGTGTAACTGCC 3’ и антисмысловой, 5 ‘ATTCCTTCACCC TCCACCTC 3’, + 59 ° C, 301 п.н .; и TNF-R2 смысловой, 5 ‘GATGAGAAATCCCAGGATGCAGTAGG 3’ и антисмысловой, 5 ‘TGCTACAGACGTTCACGATGCAGG 3’ + 59 ° C, 264 п.н. (Raina and Jeejeebhoy, 2004).Полученные продукты визуализировали на 1,5% агарозном геле, содержащем бромид этидия, и фотографировали в УФ-трансиллюминаторе.

    Статистический анализ.

    Сравнения были выполнены с использованием однофакторного дисперсионного анализа с последующим апостериорным тестом Бонферрони-Данна. Данные представлены в виде средних значений ± стандартная ошибка среднего, различия считаются значимыми при p <0,05. Парные корреляции были выполнены с помощью теста z . Все статистические анализы проводились с использованием программного обеспечения StatView, версия 5.0,1 (Abacus Concepts, Беркли, Калифорния).

    Добро пожаловать в MicrochipDirect

    • Продукты 8-битные микроконтроллеры 16-битные микроконтроллеры 32-битные микроконтроллеры 32-битные микропроцессоры Аналоговый Управление энергопотреблением Часы и время Высокоскоростная сеть и видео Интерфейс и возможности подключения Драйверы дисплеев и светодиодов Встроенные контроллеры и Super I / O объем памяти Касание и жест Беспроводной ИС безопасности Инструменты разработки Автомобильный класс Запчасти со скидкой Расширенные инструменты выбора продукта
    • Услуги по программированию Центр программирования Поиск стоимости программирования Управляйте своими частями программирования Код загрузки Запросить образцы для проверки Утвердить / отклонить подтверждение Разместить производственный заказ Часто задаваемые вопросы по программированию Учебник по программированию
    • Цена за объем Запросить ценовое предложение на большое количество Проверить статус предложения / разместить заказ Подать заявку на открытие бизнес-счета Запросить новую кредитную линию или увеличение кредита
    • Как мы можем помочь? Часто задаваемые вопросы (FAQ) Поддержка продаж / Свяжитесь с нами Техподдержка Данные экспортного контроля Селектор инструментов разработки Microchip Популярные ссылки
    • Быстрый ввод заказа
    .

    Добавить комментарий

    Ваш адрес email не будет опубликован. Обязательные поля помечены *