Температура воздуха в школе санпин: Роспотребнадзор рассказал о температурных нормах в школах, садах и больницах

Разное

Содержание

Температура воздуха в группе детского сада – Детский сад и ребенок

Добрый день. Спасибо большое за ответы. Подскажите пожалуйста, есть ли (и если есть, то в каких нормативных документах) требования к ограничению, т.е. максимально высокой температуре воздуха в группе и в спальне (либо совмещенные группы-спальни) детского сада? Ниже указана норма температуры, но есть ли крайний предел? Если температура от нормы в группе на 5 градусов выше, это тоже норма или нет? Заведующая говорит, что есть нижняя норма, например в группе 21-23 градуса (это нижняя норма), а если в группе 28-30 градусов, то тут ни кто не придерется, т.к. ограничения по температуре нет. Юлия.

Приложение 3 к санитарным правилам СанПиН 2.4.1.2660-10 регламентирует необходимые значения температуры воздуха для основных помещений дошкольных образовательных учреждений, например:

1) в приемных, игровых и туалетных ясельных групп должна поддерживаться температура 22-24°С;

2) в приемных, игровых младшей дошкольной группы — 21-23°С;

3) в групповых, раздевальных групп — 21-23°С;

4) в спальнях ясельных и дошкольных групп — 19-20°С;

5) в залах для музыкальных и гимнастических занятий — 19-20°С;

6) в залах с ванной бассейна — не менее 29°С;

7) в раздевалках с душевой бассейна — 25-26°С;

8) в медицинских помещениях — 22-24°С.

Ответ:
1) согласно Приложению N 3 к СанПиН 2.4.1.3049-13 в помещениях ДОО должна соблюдаться t° (C) — не ниже:
— в приемных, игровых ясельных групповых ячеек: 22 – 24 °C;
— в приемных, игровых младшей, средней, старшей групповых ячеек: 21 – 23 °C;
— в спальнях всех групповых ячеек: 19 – 20 °C.

Относительно верхнего предела температуры в п.11.2 СанПиН 2.1.2.2645-10 «Требования к условиям проживания в жилых зданиях и помещениях» установлены допустимые нормы температуры для жилой комнаты, которые следует применять в ДОО:

— в холодный период — 18-24 °C (с результирующей температурой 17-23°C), с относительной влажностью 60% и скоростью движения воздуха в помещениях жилых зданий 0,2 м/с.

— в теплый период — 20-28 °C (с результирующей температурой 18-27°C), с относительной влажностью 65% и скоростью движения воздуха в помещениях жилых зданий 0,3 м/с.

То есть, в зависимости от холодного или теплого периода года максимальная результирующая температура в помещениях детского сада может составлять 23 и 27°C.

Исходя из п. 3.3 и 3.4 СанПиН 2.2.4.548-96:

— холодный период года — период года, характеризуемый среднесуточной температурой наружного воздуха, равной +10°С и ниже;

— теплый период года — период года, характеризуемый среднесуточной температурой наружного воздуха выше +10°С.

Владимир Коржов.

О порядке работы школы при низких температурах

О порядке работы школы при низких температурах

 Департамент образования администрации города Нижнего Новгорода в период сильных морозов рекомендует:

1. Несмотря на изменение погодных условий, связанных с сильными морозами, учебный процесс в общеобразовательных организациях осуществляется в штатном режиме.

2.  При понижении температуры воздуха до 25-29 градусов родители (законные представители) могут не направлять обучающихся 1-4 классов в  общеобразовательные организации.

3. При понижении температуры воздуха до 30 градусов родители (законные представители) могут не направлять в общественной организации обучающихся 1-9 классов.

4. Родители (законные представители)  обучающихся вправе самостоятельно принимать решение о посещении школы их ребенком и под свою ответственность, сообщив об этом классному руководителю или в администрации школы по телефону.

5. Родителям (законным представителям) в случае принятия решения о посещении образовательной организации в дни с неблагополучными погодными условиями необходимо обеспечить сопровождение учащихся начальных классов в школу и обратно домой.

6. Уроки, пропущенные обучающимися из-за погодных условий не засчитываются пропусками по неуважительной причине.

7. Требования каких-либо оправдательных документов с детей и родителей о непосещении общеобразовательных учреждений в период резкого понижения температуры неправомерно.

8. Педагогам общеобразовательных организаций необходимо предоставить обучающимся их родителям (законным представителям) возможности дистанционного обучения,  получение консультаций и рекомендаций по возможному изучению учебного материала самостоятельно,  в том числе по электронной почте или по телефону.

 

Кроме того, обращаем внимание,  организация занятий по физической культуре на открытом воздухе в зимний период должна осуществляться в соответствии с СанПиН 2.4.2.2821-10:

 

Климатическая зона

 

Возраст учащихся

Температура воздуха и скорость ветра, при которых допускается проведение занятий на открытом воздухе

 

Без ветра

При скорости ветра до 5 м/сек

При скорости ветра  5 м/сек

При скорости ветра более 10 м/сек

Средняя полоса РФ

до 12 лет

— 9 С

— 6 С

— 3 С

 Занятия не проводятся

12-13 лет

— 12 С

— 8 С

— 5 С

14-15 лет

— 15 С

— 12 С

— 8 С

16-17 лет

— 16 С

— 15 С

— 10 С

Какая должна быть температура в учебном заведении. Важные изменения в СанПиН для школьных учебных заведений: проветривание, питание, температурный режим

IV. Требования к зданию

4.9. Площадь учебных кабинетов принимается без учета площади, необходимой для расстановки дополнительной мебели (шкафы, тумбы и другие) для хранения учебных пособий и оборудования, используемых в образовательном процессе, из расчета:

Не менее 2,5 м 2 на 1 обучающегося при фронтальных формах занятий;

Не менее — 3,5 м 2 на 1 обучающегося при организации групповых форм работы и индивидуальных занятий.

Во вновь строящихся и реконструируемых зданиях общеобразовательных организаций высота учебных помещений должна быть не менее 3,6 м 2 .

При проектировании и строительстве общеобразовательных организаций высота потолка помещений и система вентиляции должны обеспечивать кратность воздухообмена.

4.10. В кабинетах химии, физики, биологии должны быть оборудованы лаборантские.

4.11. Площадь кабинетов информатики и других кабинетов, где используются персональные компьютеры, должна соответствовать гигиеническим требованиям к персональным электронно-вычислительным машинам и организации работы.

4.12. Набор и площади помещений для внеурочной деятельности, кружковых занятий и секций должен соответствовать санитарно-эпидемиологическим требованиям к учреждениям дополнительного образования детей.

При размещении спортивного зала на 2-м этаже и выше должны быть выполнены звуко- и виброизолирующие мероприятия.

Количество и типы спортивных залов предусматриваются в зависимости от вида общеобразовательной организации и его вместимости. Рекомендуемые площади спортивных залов: 9,0 х 18,0 м, 12,0 х 24,0 м, 18,0 х 30,0 м. Высота спортивного зала при проектировании должна составлять не менее 6,0 м.

4.14. При спортивных залах в существующих общеобразовательных организациях должны быть предусмотрены снарядные; раздевальные для мальчиков и девочек. Рекомендуется оборудовать при спортивных залах раздельные для мальчиков и девочек душевые, туалеты.

4.15. Во вновь строящихся зданиях общеобразовательных организаций при спортивных залах должны быть предусмотрены: снарядные; помещения для хранения уборочного инвентаря и приготовления дезинфицирующих и моющих растворов, площадью не менее 4,0 м 2 ; раздельные для мальчиков и девочек раздевальные, площадью не менее 14,0 м 2 каждая; раздельные для мальчиков и девочек душевые, площадью не менее 12 м 2 каждая; раздельные для мальчиков и девочек туалеты, площадью не менее 8,0 м 2 каждый. При туалетах или раздевалках оборудуют раковины для мытья рук.

4.16. При устройстве бассейнов в общеобразовательных организациях планировочные решения и его эксплуатация должны отвечать гигиеническим требованиям к устройству, эксплуатации плавательных бассейнов и качеству воды.

4.27. В помещениях начальных классов, лаборантских, учебных кабинетах (химия, физика, рисование, биология), мастерских, кабинетах домоводства, во всех помещениях медицинского назначения устанавливаются умывальные раковины.

Установку раковин в учебных помещениях следует предусматривать с учетом росто-возрастных особенностей обучающихся: на высоте 0,5 м от пола до борта раковины для обучающихся 1–4 классов, и на высоте 0,7–0,8 м от пола до борта раковины для обучающихся 5–11 классов.

Рядом с умывальными раковинами должны быть мыло и полотенца.

V. Требования к помещениям и оборудованию общеобразовательных организаций

5.1. Количество рабочих мест для обучающихся не должно превышать вместимости общеобразовательной организации, предусмотренной проектом, по которому построено (реконструировано) здание.

Каждый обучающийся обеспечивается рабочим местом (за партой или столом, игровыми модулями и другими) в соответствии с его ростом.

5.2. В зависимости от назначения учебных помещений могут быть использованы различные виды ученической мебели: школьная парта, столы ученические (одноместные и двухместные), столы аудиторные, чертежные или лабораторные в комплекте со стульями, конторки и другие. Табуретки или скамейки вместо стульев не используют.

Ученическая мебель должна быть изготовлена из материалов, безвредных для здоровья детей и соответствовать росто-возрастным особенностям детей и требованиям эргономики.

5.6. При оборудовании учебных помещений соблюдаются следующие размеры проходов и расстояния в сантиметрах:

  • между рядами двухместных столов – не менее 60;
  • между рядом столов и наружной продольной стеной – не менее 50–70;
  • между рядом столов и внутренней продольной стеной (перегородкой) или шкафами, стоящими вдоль этой стены – не менее 50;
  • от последних столов до стены (перегородки), противоположной классной доске, – не менее 70, от задней стены, являющейся наружной – 100;
  • от демонстрационного стола до учебной доски–- не менее 100;
  • от первой парты до учебной доски – не менее 240;
  • наибольшая удаленность последнего места обучающегося от учебной доски – 860;
  • высота нижнего края учебной доски над полом – 70–90;
  • расстояние от классной доски до первого ряда столов в кабинетах квадратной или поперечной конфигурации при четырехрядной расстановке мебели – не менее 300.

Угол видимости доски от края доски длиной 3,0 м до середины крайнего места обучающегося за передним столом должен быть не менее 35 градусов для обучающихся II–III ступени образования и не менее 45 градусов для обучающихся I ступени образования.

Самое удаленное от окон место занятий не должно находиться далее 6,0 м.

VI. Требования к воздушно-тепловому режиму

6.1. Здания общеобразовательных организаций оборудуют системами централизованного отопления и вентиляции, которые должны соответствовать нормам проектирования и строительства жилых и общественных зданий и обеспечивать оптимальные параметры микроклимата и воздушной среды.

6.2. Температура воздуха в зависимости от климатических условий в учебных помещениях и кабинетах, кабинетах психолога и логопеда, лабораториях, актовом зале, столовой, рекреациях, библиотеке, вестибюле, гардеробе должна составлять 18–24 °С; в спортзале и комнатах для проведения секционных занятий, мастерских – 17–20 °С; спальне, игровых комнатах, помещениях подразделений дошкольного образования и пришкольного интерната – 20–24 °С; медицинских кабинетах, раздевальных комнатах спортивного зала – 20–22 °С, душевых – 25 °С.

6.7. Уроки физической культуры и занятия спортивных секций следует проводить в хорошо аэрируемых спортивных залах.

Необходимо во время занятий в зале открывать одно или два окна с подветренной стороны при температуре наружного воздуха выше плюс 5 °С и скорости движения ветра не более 2 м/с. При более низкой температуре и большей скорости движения воздуха занятия в зале проводят при открытых одной-трех фрамуг. При температуре наружного воздуха ниже минус 10 °С и скорости движения воздуха более 7 м/с сквозное проветривание зала проводится при отсутствии учащихся 1–1,5 минуты; в большие перемены и между сменами – 5–10 минут.

При достижении температуры воздуха плюс 14 °С проветривание в спортивном зале следует прекращать.

VII. Требования к естественному и искусственному освещению

7.1. Естественное освещение

7.1.1. Все учебные помещения должны иметь естественное освещение в соответствии с гигиеническими требованиями к естественному, искусственному, совмещенному освещению жилых и общественных зданий.

7.1.3. В учебных помещениях следует проектировать боковое естественное левостороннее освещение. При глубине учебных помещений более 6 м обязательно устройство правостороннего подсвета, высота которого должна быть не менее 2,2 м от пола.

Не допускается направление основного светового потока спереди и сзади от обучающихся.

7.2. Искусственное освещение

7.2.1. Во всех помещениях общеобразовательной организации обеспечиваются уровни искусственной освещенности в соответствии с гигиеническими требованиями к естественному, искусственному, совмещенному освещению жилых и общественных зданий.

7.2.2. В учебных помещениях система общего освещения обеспечивается потолочными светильниками с люминесцентными лампами и светодиодами. Предусматривается освещение с использованием ламп по спектру цветоизлучения: белый, тепло-белый, естественно-белый.

7.2.3. Не используются в одном помещении для общего освещения источники света различной природы излучения.

7.2.4. В учебных кабинетах, аудиториях, лабораториях уровни освещенности должны соответствовать следующим нормам: на рабочих столах – 300–500 лк, в кабинетах технического черчения и рисования – 500 лк, в кабинетах информатики на столах – 300–500 лк, на классной доске – 300–-500 лк, в актовых и спортивных залах (на полу) – 200 лк, в рекреациях (на полу) – 150 лк.

При использовании компьютерной техники и необходимости сочетать восприятие информации с экрана и ведение записи в тетради jсвещенность на столах обучающихся должна быть не ниже 300 лк.

X. Гигиенические требования к режиму образовательного процесса

10.3. Для профилактики переутомления обучающихся в годовом календарном учебном плане рекомендуется предусмотреть равномерное распределение периодов учебного времени и каникул.

10.14. Использование в учебном процессе инновационных образовательных программ и технологий, расписаний занятий, режимов обучения возможно при отсутствии их неблагоприятного влияния на функциональное состояние и здоровье обучающихся.

10.17. С целью профилактики утомления, нарушения осанки и зрения обучающихся на уроках следует проводить физкультминутки и гимнастику для глаз.

10.22. Двигательная активность обучающихся, помимо уроков физической культуры, в образовательном процессе может обеспечиваться за счет:

  • физкультминуток в соответствии с рекомендуемым комплексом упражнений;
  • организованных подвижных игр на переменах;
  • спортивного часа для детей, посещающих группу продленного дня;
  • внеклассных спортивных занятий и соревнований, общешкольных спортивных мероприятий, дней здоровья;
  • самостоятельных занятий физической культурой в секциях и клубах.

10.23. Спортивные нагрузки на занятиях физической культурой, соревнованиях, внеурочных занятиях спортивного профиля, при проведении динамического или спортивного часа должны соответствовать возрасту, состоянию здоровья и физической подготовленности обучающихся, а также метеоусловиям (если они организованы на открытом воздухе).

Распределение обучающихся на основную, подготовительную и специальную группы для участия в физкультурно-оздоровительных и спортивно-массовых мероприятиях проводит врач с учетом их состояния здоровья (или на основании справок об их здоровье). Обучающимся основной физкультурной группы разрешается участие во всех физкультурно-оздоровительных мероприятиях в соответствии с их возрастом. С обучающимися подготовительной и специальной групп физкультурно-оздоровительную работу следует проводить с учетом заключения врача.

Обучающиеся, отнесенные по состоянию здоровья к подготовительной и специальной группам, занимаются физической культурой со снижением физической нагрузки.

Уроки физической культуры целесообразно проводить на открытом воздухе. Возможность проведения занятий физической культурой на открытом воздухе, а также подвижных игр, определяется по совокупности показателей метеоусловий (температуры, относительной влажности и скорости движения воздуха) по климатическим зонам.

10.26. Все работы в мастерских и кабинетах домоводства обучающиеся выполняют в специальной одежде (халат, фартук, берет, косынка). При выполнении работ, создающих угрозу повреждения глаз, следует использовать защитные очки.

10.27. При организации практики и занятий общественно-полезным трудом обучающихся, предусмотренными образовательной программой, связанными с большой физической нагрузкой (переноска и передвижение тяжестей), необходимо руководствоваться санитарно-эпидемиологическими требованиями к безопасности условий труда работников, не достигших 18-летнего возраста.

Не допускается привлекать обучающихся к работам с вредными или опасными условиями труда, при выполнении которых запрещается применение труда, лиц моложе 18 лет, а также к уборке санитарных узлов и мест общего пользования, мытью окон и светильников, уборке снега с крыш и другим аналогичным работам.

XI. Требования к организации медицинского обслуживания обучающихся и прохождению медицинских осмотров работниками общеобразовательных организаций

11.1. Во всех общеобразовательных организациях должно быть организовано медицинское обслуживание учащихся.

11.7. В классном журнале рекомендуется оформлять лист здоровья, в который для каждого обучающегося вносят сведения об антропометрических данных, группе здоровья, группе занятий физической культурой, состоянии здоровья, рекомендуемом размере учебной мебели, а также медицинские рекомендации .

Дети проводят в школах практически половину светового дня, поэтому для родителей условия, в которых учится ребенок, имеют большое значение. Санитарно-гигиенические показатели и освещение для детского здоровья и иммунитета играют большую роль. Особенности детского организма таковы, что даже малейшее изменение микроклимата отражается на терморегуляции. Именно поэтому школьники нуждаются в обеспечении соответствующего температурного режима и комфорта. Если температурный режим в школе не соблюден, то отдача тепла растущим организмом увеличивается, что приводит к охлаждению, а в такой ситуации и до рукой подать.

Санитарные нормы

Микроклимат в любом помещении зависит от температуры воздуха, его влажности (относительной), а также скорости перемещения. Если два последних показателя регулировать легко, то температура внутреннего воздуха в школах зависит от ряда факторов. Наиболее значимый фактор – теплоотдача системы отопления. Если школа подключена к центральной отопительной системе, то все, что может сделать руководство учебного заведения – это установить радиаторы с высоким КПД. Поддерживать температуру воздуха в школе в норме помогают и качественные , и плотно прилегающие к раме двери. Если эти меры не помогают, рекомендуется вести в школе журнал температурного режима. Результаты ежедневных измерений можно предъявить теплоснабжающей организации.

Согласно существующим ныне нормативам, посещение школы возможно при следующем температурном режиме:

  • от 17 градусов в учебных кабинетах;
  • от 15 градусов в школьных цехах, мастерских;
  • от 15 градусов в спортивном зале;
  • от 19 градусов в раздевалках и гардеробных;
  • от 16 градусов в библиотеке;
  • от 17 градусов в актовых залах;
  • от 17 градусов в туалетах;
  • от 21 градуса в медкабинете.

Если минимальная температура в помещениях школы ниже нормы, отмена занятий – единственное возможное решение.

Превратности погоды

Температура внутри школьных помещений не может не зависеть от температуры за окном. Даже самые качественные окна и двери не спасут от холода, если на улице лютует зима. Сильные морозы зачастую являются поводом для официальной отмены занятий. В странах СНГ разработаны соответствующие нормативы. Так, температура, при которой в школах отменяют занятия, варьируется от -25 до -40 градусов. Кроме того, значение имеет и скорость ветра. Если она меньше двух метров в секунду, то отменяются учебные занятия при следующем температурном режиме:

  • -30 градусов для учащихся 1-4 классов;
  • -35 градусов для учащихся 1-9 классов;
  • -40 градусов для учащихся 1-11 классов.

При более высокой скорости ветра условия для отмены занятий следующие:

При экстремальных температурах воздуха, несвойственных для конкретных регионов, местные телеканалы, радио и печатные издания информируют население о закрытии школ. Но лучший способ узнать о том, отменены ли в школе занятия, это телефонный звонок классному руководителю.

В конце концов, родителям следует руководствоваться здравым смыслом. Если на улице лютый мороз, а поход в школу превращается в экстремальное испытание, то стоит пропустить занятия даже в том случае, если официально они не отменены. Подучить с ребенком пройденный в его отсутствие учебный материал проще, чем лечить его от переохлаждения и оформлять больничный лист в поликлинике, чтобы не получить выговор на работе от руководства.

Дети проводят в школе почти половину светового дня и большую часть своей жизни, поэтому условия обучения имеют первостепенное значение. Немаловажную роль для физического и морального состояния ребенка отыгрывают и показатели санитарии и гигиены. Даже небольшое отклонение микроклимата от нормы сильно влияет на детский организм и его терморегуляцию. Поэтому в образовательном учреждении должен выдерживаться . Если он нарушается, растущий организм больше отдает тепла, а это в свою очередь приводит к охлаждениям и началу простуд.

На внутренний климат в кабинетах и других помещениях влияет температура воздуха, его влажность и скорость. Если два последних показателя можно легко регулировать, то температура зависит от некоторых факторов. Один из самых важных факторов – теплоотдача в системе отопления. Если школа входит в центральную отопительную систему, то максимум, что может сделать директор школы – это поставить радиаторы с высоким коэффициентом полезного действия. Удерживать необходимый градус в помещениях помогают и новые стеклопакетные окна, и плотные двери с максимальным прилеганием, без щелей. Если и эти меры не помогают, стоит вести . Его в случае чего можно предъявить теплоснабжающей организации.

Сохраните это себе, чтобы не потерять

Требования СанПиН к температурному режиму необходимо учитывать, составляя общешкольный план развития учебных кабинетов. В журнале «Справочник заместителя директора школы» представлен образец, составленный в строгом соответствии актуальным нормам
Скачайте образец плана сейчас

Согласно нормативам, отмеченным в СанПиН 2.4.3.2821-10 «Санитарно-эпидемиологические требования к условиям и организации обучения в общеобразовательных учреждениях» от 3 марта 2011 года, посещать школу возможно при следующем :

  • В учебных кабинетах – от 17 градусов
  • В мастерских и цехах – от 15 градусов
  • В спортзале – от 15 градусов
  • В раздевалках – от 19 градусов
  • В библиотеке – от 16 градусов
  • В актовых залах – от 17 градусов
  • В туалетных комнатах – от 17 градусов
  • В медпункте – от 21 градуса.

Если температура в этих помещениях ниже указанной нормы, занятия должны быть отменены.

Естественно, температура внутри школы зависит от температуры на улице. Даже очень качественные окна не защитят от сильного мороза, поэтому часто они являются причиной отмены занятий. Отмена уроков происходит по нормативам, принятым в СНГ. Температура, при которой занятия в школах отменяются, колеблется между -25 и -40 градусами. Также имеет большое значение и скорость ветра. Если она составляет меньше 2 м/с, то учеба отменяется при таком температурном режиме для школьников :

  • Для 1-4 классов — -30 градусов
  • Для 1-9 классов — -35 градусов
  • Для 1-11 классов — -40 градусов.

Если же скорость ветра больше, то учеба отменяется:

  • Для 1-4 класов при -25 градусах
  • Для 1- классов при -30 градусах
  • Для 1-11 классов при -35 градусах.

Если наблюдается экстремально холодная погода, не свойственная для региона, в печатных изданиях, по радио и телеканалам, сообщается о закрытии школ. Но, конечно же, лучшим методом определения, работает ли школа, будет звонок классному руководителю.

Журнал температурного режима в школе

Чтобы следить за состоянием микроклимата в помещениях, а также чтобы вовремя его изменить, нужно вести журнал температурного режима в школе . В него записываются все показания, характеризующие помещение. Это требуется выполнять регулярно. Чтобы не нарушить, зимой нужно выдерживать не только рамки содержания помещений, но и вспомогательных приборов. Для соблюдения температурного режима также послужит качественная изоляция. Тщательно проверяйте все теплосберегающие элементы для того, чтобы обеспечить нужный микроклимат в помещении.

Нормы температурного режима в школе

Чтобы контролировать температурный режим для школьников в помещениях, в кабинетах нужны термометры. Во внеурочное время, когда школьников в стенах школы нет, в здании должна оставаться на уровне минимум 15 градусов.

Кроме того, в помещениях влажность должна составлять 40-60%, а скорость перемещения воздуха – максимум 0.1м/с.

Новые возможности для карьерного роста

Попробуй бесплатно! . За прохождение — диплом о профессиональной переподготовке. Учебные материалы представлены в формате наглядных конспектов с видеолекциями экспертов, сопровождаются необходимыми шаблонами и примерами.

Если школа отапливается печкой, топка должна находиться в коридоре. Чтобы воздух в школе не загрязнялся окисью углерода, печные трубы можно закрывать только после того, как топливо полностью прогорело, и не позднее чем за 2 часа до начала учебного дня. В новостроящихся и реконструируемых школах оборудование печного отопления уже не разрешается.

Классы необходимо проветривать на переменах, а рекреационные помещения – наоборот, во время уроков. До начала учебного дня и после его окончания нужно проветривать учебные помещения сквозным образом. Длительность такого проветривания определяется погодными условиями.

Уроки физкультуры и занятия в спортивных секциях нужно проводить в спортзалах с возможностью хорошего проветривания. Во время занятий нужно открывать 1-2 окна с подветренной стороны, если воздух на улице выше 5 градусов, а скорость движения ветра – до 2 м/с. Если температура за окном ниже, а скорость ветра – больше, занятия в зале нужно проводить при открытых 1-3 фрамугах. Если же воздух снаружи ниже -10 градусов, а ветер дует со скоростью более 7 м/с, нужно проводить проветривание зала 1-1,5 минут, пока учащиеся отсутствуют, а также 5-10 минут на больших переменах и между сменами. Если в спортзале температура воздуха опускается до 14 градусов, проветривания прекращаются.

Эти и другие нормы температурного режима в школе прописаны в нормах СанПин 2.4.3.2821-10 «Санитарно-эпидемиологические требования к условиям и организации обучения в общеобразовательных учреждениях» от 3 марта 2011 года. В заключение добавим, что каким бы ни был температурный режим в школе, организм ребенка не должен подвергаться сильным перепадам, более чем на 2 градуса. В ином случае здоровье ребенка ухудшится, могут начаться проблемы с сердечно-сосудистой системой.

Эти и многие другие тонкости регламентированы санитарно-эпидемиологическими правилами и нормативами, утвержденными Главным государственным санитарным врачом России Геннадием Онищенко. И все школы страны обязаны им соответствовать.

Гигантомания сегодня не в почете. По соображениям безопасности разрешено строительство лишь невысоких школ — максимум в три этажа. Лишь в мегаполисах, где свободного места катастрофически не хватает, допускается четвертый этаж. Новые здания проектируются с расчетом, что грызть гранит науки в них будут не больше тысячи ребят. А в классе могут учиться до 25 человек. Причем на одного школяра положено минимум 2,5 квадратных метра учебной площади.

Красиво смотрятся расставленные аккуратными рядами одинаковые парты. Только от этого единообразия страдают дети. Ведь в классе учатся ребята разного роста, и каждый должен быть обеспечен подходящей ему мебелью. Парты для «коротышек» ставят ближе к доске. И еще один очень важный момент. Плохо видящих и слышащих детей обязаны усаживать в первом ряду, а часто болеющих — подальше от наружной стены.

Важнейшим показателем для оценки санитарного состояния школы является чистота в туалетах. Но не менее важно и другое — число «посадочных мест» должно соответствовать количеству учащихся. Врачи предписывают иметь 1 унитаз на 20 девочек, 1 унитаз на 30 мальчиков и 1 писсуар на 60 мальчиков. Кроме того, для школьниц, начиная с 5-го класса, оборудуются помещения личной гигиены из расчета 1 комната — на 70 учениц.

В хорошей школе не бывает ни жарко, ни холодно. Температура воздуха в классе поддерживается в пределах 18-20 градусов, в коридорах — 16-18, в учебных мастерских — 15-17 градусов. Даже когда нет занятий, температура не опускается ниже 15 градусов. А относительная влажность может колебаться в интервале 40-60 процентов.

Во всех классах должно быть естественное освещение. Окна должны выходить на юг или восток. Лишь кабинеты черчения, рисования и информатики могут быть ориентированы на север. Строго регламентирована и окраска стен. Разрешены светлые тона желтого, бежевого, розового, зеленого и голубого цветов. Они не раздражают зрение и не привлекают к себе лишнего внимания учеников.

Администрация школы обязана обеспечить горячие завтраки для всех детей и двухразовое питание для групп продленного дня. Особое внимание к меню: в нем не должно быть продуктов и блюд, которые могут вызвать массовые отравления. Под запретом в школах макароны по-флотски, блинчики с мясом, студень, окрошка, паштеты, квас, грибы, яичница-глазунья, пирожные, кремовые торты, пончики и многое другое.

Большинство из вышеперечисленных правил в школах стараются соблюдать. Но одно требование нарушается повсеместно. В редком классе подоконники не заставлены цветочными горшками. Учителей, разводящих на окнах настоящие ботанические сады, обычно ставят в пример. Но цветы загораживают солнце, и место для них — кашпо в простенках окон.

Почти 14 процентов школ мы относим к третьей группе санитарно-эпидемиологического благополучия, — рассказывает заведующая отделом гигиены детей и подростков Федерального центра госсанэпиднадзора Ольга Милушкина. — Чтобы дети могли в них нормально учиться, необходимы кардинальные изменения. Во Владимирской и Кемеровской областях, Дагестане, Чечне, Якутии, Карачаево-Черкесии и Хабаровском крае таких школ больше 25 процентов. В некоторых из них выявлены нарушения вопиющие. До 1 сентября они должны быть устранены. Если нет — школа может быть временно закрыта. Такое, кстати, случается каждый год. Скажем, прошлой осенью 15 российских школ открыли свои двери с опозданием.

Своя ноша тянет

Наверное, все видели малышей, бредущих в школу с согнутой под тяжестью ранца спиной. Чтобы немножко передохнуть, они прислоняются к стенам. Так что не надо удивляться, что сейчас почти нет детей с идеальной осанкой.

Сам ранец первоклассника весит не больше 500 граммов, — говорит Ольга Милушкина. — Но дети в него часто запихивают множество нужных и ненужных вещей. Научить малыша брать с собой только действительно необходимое должны родители и учителя. Тому же первокласснику не следует носить за плечами больше двух килограммов.

Очень важен цвет ранца. Ведь в некоторых наших регионах дети полгода ходят в школу в сумерках. Яркий ранец хорошо заметен водителям машин, а рефлектирующее покрытие обеспечит отражение света фар, и школяр на дороге будет заметен издалека.

Учащиеся начальных классов, чей позвоночник еще очень гибок, должны носить только ранцы, а дети постарше — могут и портфель, не забывая менять руки. По мнению специалистов, максимальный вес ранца или портфеля учеников средней и старшей школы — 8-10 процентов от веса хозяина.

Если вес собранного портфеля в первую очередь определяет сам ребенок, то вес учебников строго регламентирован, — продолжает Ольга Милушкина. — Учебники для 1-4-х классов должны весить не больше 300 г, для 5-6-х классов — 400 , для 7-9-х классов — 500 , для 10-11-х классов — 600 г. Есть и другие ограничения. Например, в учебных пособиях для 1-6-х классов не допускается набор текста в две колонки. Также запрещена печать на цветном или сером фоне. Санитарные нормативы запрещают использование учебников с полиграфическим браком: смазанными красками, склеенными страницами, поврежденным переплетом.

Понедельник — легкий день

Какой ребенок не жалуется на нелепое расписание уроков? Оказывается, составлять его надо по науке. Пик умственной активности школьника приходится на 10-12 часов утра. Поэтому самые трудные предметы должны идти вторым, третьим и четвертым уроками. А вот сдвоенная математика в конце учебного дня — это форменное безобразие и законный повод для жалобы директору.

Ученые доказали, что в понедельник и пятницу материал воспринимается хуже, чем в середине недели. Поэтому пик учебной нагрузки должен приходиться на вторник и среду. Это может быть максимальное количество уроков либо самые тяжелые предметы. Самой-самой признана математика — 11 условных баллов. Для сравнения: иностранный язык — 10 баллов, физика и химия — по 9, русский язык и литература — по 7. Легкими считаются черчение — 3 балла, рисование — 2, пение — 1 балл. А вот физкультура, вопреки расхожему мнению, совсем не легка — ей присвоено целых 5 баллов.

Правильным считается расписание, когда максимальная нагрузка по сумме баллов приходится на середину недели. Напротив, если она распределена равномерно или максимум приходится на понедельник и пятницу, расписание необходимо срочно менять!

В гимназиях, лицеях и школах с углубленным изучением отдельных предметов не допускается занятий в две смены. А первые, пятые и выпускные классы в любом случае учатся только с утра. Уроки не должны начинаться раньше 8 часов, и никаких «нулевых» уроков, в том числе факультативов! Максимальная нагрузка зависит от возраста. Например, для учащихся 2-4-х классов это 22 часа при пятидневной учебной неделе и 25 часов — при шестидневке. 6-й класс — 29 и 32 часа, соответственно, 8-9-е — 32 и 35, 10-11-е — 33 и 36 часов.

Есть санитарные нормы даже для домашних заданий. Так, первоклассники не должны их делать дольше 1 часа, второклассники — 1,5 часа, учащиеся 3-4-х классов — 2 часов. В 5-6-х классах дети могут готовить уроки до 2,5 часа, в 7-8-х классах — до 3 часов, а в 10-11-х — до 4 часов. Лучшим временем для начала самоподготовки считается 4 часа дня.

Кстати

Специалисты Госсанэпиднадзора напоминают: соблюдение санитарных нормативов — обязанность школьной администрации. Если же она сидит сложа руки, родителям следует обратиться к местным санитарным врачам. Тревожные сигналы из школ проверяются в обязательном порядке.

Многие специалисты считают: ранец будущего — это миниатюрный компьютер. В Тайване уже продаются электронные школьные ранцы, которые весят чуть больше килограмма. В их память легко умещаются тексты и иллюстрации из всех учебников, что избавляет ученика от необходимости таскать книги в школу. Учитель же может посылать сразу всем учащимся учебные материалы и домашние задания, а потом автоматически проверять их.

В любом образовательном учреждении со временем происходят изменения в учебном процессе. Они включают в себя исправления прошлых ошибок, выявленных в процессе обучения, и современные требования к образовательному процессу. На основе накопленного опыта и новых тенденций разрабатываются документы, которые обеспечивают безопасность и корректность образовательного процесса. Таким изменениям в 2015 году подвергся и основополагающий документ СанПиН для школ 2.4.2.2821-10, который регулирует санитарные правила общеобразовательных организаций.

СанПиНы для школы в 2015–2016 году, подверглись изменениям по многочисленным направлениям. Больше всего изменений претерпели питание и температурный режим в школе.

Изменения СанПиН, школьное питание

Изменения в СанПиН для школ 2015–2016 коснулись и такой важной для любого ребенка и родителя темы как питание. В новый СанПиН включены разделы, касающиеся оборудования школьных помещений и организации школьного питания. Были добавлены следующие пункты, которых не было в основной редакции документа:

  • 5.19.14. В этом пункте указаны требования к производственным помещениям столовых в школах. Теперь производственные помещения столовых должны включать в себя цех обработки овощей, заготовочный и горячий цех, а также раздельные моечные для столовой и кухонной посуды;
  • 5.19.15. В данном пункте образовательным учреждениям прямо указывается на соответствие организации школьного питания с нормами СанПиН 2.4.5.2409-08, в котором прописаны все нормы и требования;
  • 5.19.16. Здесь идет речь об организации питания и питьевого режима, которые также предусмотрены в нормах СанПиН 2.4.5.2409-08. Также сказано о том, что график питания и его кратность обязаны учитывать время пребывания в школе.
  • Таким образом, изменения способствуют улучшению качества питания и соответствию со всеми необходимыми нормами.

    Температурный режим в школе СанПиН 2015–2016

    Многие из родителей помнят, что обучавшись в школах, они постоянно испытывали сильные температурные перепады. Невыносимая духота в кабинетах и распахнутые настежь окна нередко приводили к учащению простудных заболеваний. Новый СанПиН для школ 2015–2016 предусмотрел одну из ранее неотмеченных проблем с температурой в комнатах личной гигиены учащихся. В школьных кабинетах личной гигиены необходимо поддерживать температуру 19 – 21 градус по Цельсию. Теперь в любых школах не допускается использование надворных санитарных узлов. Таким образом, уже оборудованные туалетами школы обязаны предусмотреть вентиляцию, регулирующую температурный режим, а не оборудованным – предусмотреть данный пункт при постройке.

    Температура в школе по СанПиН

    СанПиНы для школы в 2015–2016 году предусматривают контроль температуры не только в учебных кабинетах, но и допустимые значения температур для занятий вне школы. Каждому родителю полезно знать, при каких температурах его ребенок может заниматься учебной деятельностью, а в каких случаях это будет недопустимо. Рассматривается три пункта, различающихся местонахождением учащихся:

    • температуры, при которых отменяются занятия в школах. Занятия в школах отменяются при экстремально низких температурах на улице, в значение принимается также и скорость ветра. В случае отмены занятий родители информируются через средства массовой информации. К тому же у многих школ появляются собственные системы внешнего мониторинга и их результаты публикуются на собственных сайтах;
    • температуры, при которых проводится обучение только внутри школьных помещений, отменяются занятия на свежем воздухе. Таблица поможет сориентироваться в допустимости таких занятий при минусовых температурах в градусах Цельсия:
    • температурный режим в школе по СанПиН предусматривает контроль в школьных помещениях. Нормы СанПиН в школе разделяются по сфере деятельности в школьных кабинетах. В учебных классах, столовой, библиотеке, актовом или музыкальном классе, рекреации и других помещениях должна поддерживаться температура от 18 до 24 градусов по Цельсию. В спортивных залах и мастерских этот показатель составляет от 17 до 20 градусов по Цельсию. График проветривания кабинетов в школе по СанПин не был изменен и все также зависит от температуры воздуха на улице.
    • В соответствии с СанПиН, школа 2015 – 2016 в РФ является безопасным и продуктивным для образовательной деятельности учреждениям. Новый СанПиН для школ 2015 – 2016 с изменениями дополняет и улучшает требования, предъявляемые к школам ранее. Изменения коснулись ранее не рассматриваемых или частично рассматриваемых моментов, которые напрямую влияют на качество учебного процесса. СанПиН по школам – новый стандарт, к которому обращаются руководители и контроллеры учебных заведений. А для родителей нормы СанПиН в школе – это документ, к которому можно обратиться в случае спорных ситуаций, возникающих при обучении.

    как не позволить школе заморозить ребенка?

    По сообщениям синоптиков в ближайшие несколько дней томичей ожидает понижение температуры до -30°С, усиление ветра, снег и метели. Сбудутся ли их прогнозы, покажет время, а пока многие родители обеспокоены тем, стоит ли отпускать в такую погоду детей в школу. Проект «Право знать» решил выяснить, какая температура за окном может стать официальным основанием для пропуска детьми занятий, имеет ли право руководство школ заставлять старшеклассников ходить на уроки в лютый мороз, и как свести на нет конфликт с директором, если он возник из-за погоды. «Право знать» — знай свои права!

    1. Мороз и солнце: какие права есть у родителей и детей в холода?

    После появления информации о скором похолодании, пользователи портала Tomsk.ru стали активно обсуждать эту тему. Комментатор saika рассказал, что от класса, в котором учится его племянница, сотрудники одной из томских школ потребовали явиться на уроки, даже если термометр покажет -50°С. Пользователь задал резонный вопрос о законности подобных требований и попросил рассказать о том, какими документами урегулированы подобные ситуации.

    Предупреждения от МЧС приходят почти каждому томичу. Об ухудшении погодных условий ведомство информирует и школы 

    Согласно пункту 3 части 4 ст. 41 закона «Об образовании в Российской Федерации», все школы должны соблюдать государственные санитарно-эпидемиологические правила и нормативы. Их соблюдение необходимо для того, чтобы не подвергать здоровье школьников риску и сохранять его. Вряд ли дорога до школы в мороз может способствовать сохранению здоровья учеников, поэтому на случай холодов разрабатываются специальные нормы. В Томске этим занимается департамент образования при администрации города. Немаловажной является и возможность сохранения тепла в классах, когда за окном стоит морозная погода. Знайте, что существующие санитарные правила и нормы устанавливают требования к температуре воздуха в классах и других помещениях школы. Некоторые образовательные организации не могут обеспечить установленные СанПиН требования, в том числе из-за низкой температуры на улице.

    Пункт 6.2 СанПиН 2.4.2.2821-10 устанавливает, что температура воздуха в классах, других учебных помещениях, кабинетах психолога и логопеда, лабораториях, актовом зале, столовой, рекреациях, библиотеке, вестибюле и гардеробе должна составлять от 18°С до 24°С. В спортзале и мастерских может быть холоднее ― от 17°С до 20°С, а вот в спортивных раздевалках температура ниже 20°С является нарушением норм. Родители имеют право контролировать температуру во всех помещениях школы: для этого СанПиН обязывает руководство образовательных организаций устанавливать бытовые термометры. При обеспечении требуемой температуры в классах и других помещениях в школе могут проводиться занятия при любой погоде. Однако следует помнить, что если температура внутри помещений опускается ниже 18°С, то это является основанием для введения директором полного запрета на посещение детьми школы.

    Что же касается ситуации с холодами на улице, то вы вправе самостоятельно решать, пойдет ребенок в школу или нет. Причем это касается не только родителей младших школьников, но и учеников средней школы, а также старшеклассников. Важно не забыть уведомить классного руководителя или администрацию школы о том, что ученик пропустит занятия. Только в этом случае уроки, которые пропустит обучающийся, не будут считаться пропусками по неуважительной причине.

    При принятии решения о непосещении ребенком школы родителям нужно учитывать дополнительные факторы. К ним относятся направление и сила ветра, расстояние от дома до образовательной организации, пробки и другие транспортные проблемы, а также переносимость школьником отрицательных температур.

    Если ваш ребенок учится в начальной школе, и вы все-таки приняли решение о том, что он должен идти на уроки, необходимо проводить его до школы и встретить после уроков. И это важный нюанс: многие младшеклассники игнорируют просьбы родителей и «забывают» надеть шапку или шарф. И вместо того чтобы потом искать виноватых в заболевании отпрыска и корить учителя за то, что тот «не доглядел», лучше предотвратить возникновение такой ситуации. Да и по закону, учитель не обязан контролировать, оделись ли дети так, как нужно, или выбежали на улицу раздетыми. Так что проводы и встречи младших школьников ― вопрос далеко не праздный.

    2. Только цифры: при скольких градусах можно не идти в школу?

    Департамент образования администрации города Томска в связи с тем, что в  зимний период может происходить значительное понижение температуры, сообщил о температурном режиме, при котором вводится ограничение на посещение учениками образовательных организаций. Мы обобщили сведения из приказа департамента в инфографике к материалу. Помните, что этот документ является универсальным и действует в течение всей зимы. Со ссылкой на него вы сможете объяснить администрации школы причину отсутствия вашего ребенка на занятиях.

    3. Чего не вправе делать сотрудники школ, когда на улице мороз?

    Негодование пользователя портала Tomsk.ru из-за высказывания сотрудников одной из томских школ о «необходимости посещения школы в 50-градусный мороз» совершенно оправдано. Учителя и администрация школ не должны забывать о том, что вопрос посещения ребенком школы в мороз находится исключительно в компетенции его родителей или законных представителей. При этом обосновывать необходимость присутствия школьников старших классов подготовкой к ЕГЭ недопустимо: по закону, возможность отсутствовать на занятиях распространяется на всех учеников.

    Знайте, что требование каких-либо оправдательных документов с детей и родителей о непосещении образовательной организации в период холодов и резкого понижения температуры неправомерно. Как отмечает помощник прокурора Кировского района города Томска Анастасия Никифорова, администрациям школ запрещено применять какие-либо санкции к ученикам, если они не посещали занятия, когда температура воздуха на улице была ниже допустимой. А вот занятия со всеми присутствующими детьми должны быть проведены в обязательном порядке. Это же правило действует, даже если на уроки пришел один-единственный ученик.

    Иными словами, несмотря на любое изменение погодных условий, учебный процесс должен быть организован в штатном режиме. По возможности педагоги могут предоставлять ученикам и их родителям вариант самостоятельного дистанционного обучения. С учетом того, что практически во всех школах города функционируют электронные площадки для размещения домашних заданий и взаимодействия учеников с учителями, сделать это несложно.

    Важно знать, что администрация школы должна довести до сведения родителей информацию о том, при какой температуре школьникам разрешено не посещать занятия. Сведения об этом должны быть озвучены классными руководителями, а также находиться в свободном доступе на информационных стендах.

    Как отмечает Анастасия Никифорова, если из-за непосещения школы в морозы между родителями и учителями произошел конфликт, то нужно обратиться к администрации образовательной организации. «Если с администрацией конфликт разрешить не удалось, следует обратиться в прокуратуру своего района. Вопрос соблюдения прав несовершеннолетних в прокуратуре является приоритетным», ― подчеркивает помощник прокурора.

    Учителя не могут диктовать родителям и ученикам условия, нарушающие закон. Воспользуйтесь нашими советами, если перед вами встанет вопрос о том, должен ли идти ребенок в школу в мороз. Знайте свои права и следите за прогнозном погоды, чтобы не позволить школе заморозить вашего ребенка.

    А вы пропускали занятия из-за холодов? Расскажите об этом в комментариях к материалу и в нашей группе ВКонтакте. Делитесь статьями рубрики «Право знать» на страницах своих социальных сетей, чтобы как можно больше людей знали о своих правах!

    Дмитрий Аксенов

    При какой температуре можно не ходить на работу? : Новый пенсионер

    Тепло в наших широтах представляет собой настоящую ценность… Решение об отмене занятий в школах выносит местный департамент образования, а на производстве руководство компании, принимая во внимание требования ТК и санитарные нормы. Работа в холодное время на открытом воздухе или в закрытых неотапливаемых помещениях регулируется статьёй 109 Трудового кодекса РФ. Нормы >>

    На улице

    Лицам, работающим на открытом воздухе, должны предоставляться перерывы в работе для обогрева, которые обязательно включаются в рабочее время. Продолжительность и количество перерывов определяется администрацией компании совместно с профсоюзной организацией.

    Работа каменщиков прекращается при температуре –25°С с ветром более трёх баллов или температуре –30 °С  без ветра. 

    Работа представителей других профессий, связанных с пребыванием на открытом воздухе, прекращается при температуре –27°С с ветром более трёх баллов или температуре –35°С без ветра.

    Если деятельность связана с техникой, которая во время холодов вышла из строя, время вынужденного простоя должно оплачиваться из расчёта двух третей оклада.  

    В офисе  

    Для офисных работников погодные условия, согласно законодательству, на работу не влияют. Во внимание берётся лишь температура на рабочем месте. Условия труда регулируются саанитарными правилами и нормами СанПиН 2.2.4.548-96 «Гигиенические требования к микроклимату производственных помещений».

    Согласно документу, те, кто работает в помещениях, условно разделяются на пять категорий. 

    * 1а — сидячая работа. Сюда относятся управленцы, офисные работники, рабочие швейного и часового производства. Для них самая комфортная температура в помещении +22°С — +24°С.

    * 1б — если весь день проходит на ногах. Например, это контролёры, продавцы-консультанты. Они должны работать при +21°С — +23°С.

    * 2а — работа предполагает некоторое физическое напряжение. Например, экскурсоводы, сотрудники уборочных цехов на машиностроительных предприятиях. Оптимальная температура для них — +19°С -+21°С. 

    * 2б — работа, связанная с ходьбой и переносом тяжестей до десяти килограммов. В основном это рабочие заводов — слесари, сварщики. Для них температура в помещении должна быть +17°С — +19 °С. 

    * 3 — предполагает тяжёлый физический труд, например, в литейных и кузнечных цехах. К этой же категории относятся грузчики, которые переносят мебель и технику тяжелее десяти килограммов. Для них температура несколько ниже — + 16°С -+18°С.

    При снижении температуры на рабочем месте на 1 градус ниже нормы рабочее время сокращается на 1 час. Таким образом, при температуре +19°С рабочий день офисного работника будет составлять 7 часов, +18 °С — 6 часов и так далее. При температуре +12°С и ниже работа прекращается и согласно статье 157 ТК РФ рабочее время в таком случае оплачивается работодателем в размере не менее двух третей тарифной ставки.

    Детский сад 

    Детский сад работает при любой температуре воздуха на улице. Но согласно санитарным нормативам СанПиН 2.4.1.1249-03,  при температуре воздуха ниже -15°С и скорости ветра более 7 м/с продолжительность прогулки сокращается. Прогулка не проводится при температуре воздуха ниже -15°С и скорости ветра более 15 м/с для детей до 4 лет, а для детей 5-7 лет при температуре воздуха ниже -20°С и скорости ветра более 15 м/с (для средней полосы).

    Школа 

    Нормативы, которые действуют сегодня относительно посещения детьми школы в сильные морозы следующие:

    — при температуре -25°С не учатся школьники 1-4 классов сельских школ
    — при температуре -27°С — школьники 1-4 классов городских и сельских школ
    — при температуре -30°С и ниже не учатся все школьники — с 1 по 11 класс

    При наступлении вышеперечисленных температур министерство образование издаёт соответствующие приказы. Но решение о прекращении занятий в связи с морозной погодой принимает руководство каждого образовательного учреждения самостоятельно. Если такое решение принято, ребёнок на его основании может отдыхать от учёбы.

    На отмену занятий в школах влияют не только температура, но и сила ветра. Обычно температурный порог отмены школьных занятий из-за ветра понижается на 2-3 градуса.

    Отмена занятий в школе в регионах 

    Для северных регионов страны температурные границы для отмены занятий ниже. На Урале применяется следующая шкала отмены занятий:

    -25°С — -28°С — в школу не идут малыши,
    -28°С — -30°С — не учатся ученики 5-9 классов,
    -30°С — -32°С — могут не приходить старшеклассники.

    В Сибири начальные классы не учатся при -30°С градусах. Школьники 5-9-х классов могут не риходить, если столбик термометра опускается до -32°С и -35°С. Старшеклассники не идут в школу, если на улице -35°С — -40°С.

    В Якутии, чтобы ученики 1-4-х классов не пошли в школу, столбик термометра должен опуститься до -40°С градусов. Для школьников средней школы температура должна составить -48°С, а старшеклассники не идут на учёбу только если на улице -50°С. 

    Подробности: http://www.aif.ru/dontknows/instruction/1093225

    Какая температура воздуха должна быть в школе

    Говорить только об уровне температуры в школьных помещениях не совсем верно, потому как при разработке нормативов к воздушно-тепловому режиму образовательных учреждений учитываются несколько факторов:
    — наличие воздухообмена и его интенсивность;
    — относительная влажность;
    — температура воздуха.

    Учитывая вышеперечисленные параметры и изучив их воздействие на здоровье школьников, ученые разработали оптимальные критерии для различных школьных помещений, которые изложены в «Санитарно-эпидемиологических правилах и нормативах (СанПиН 2.4.2.2821 – 10).

    Во внимание принимается площадь, максимальный поток учащихся, проходящий за день через тот или иной кабинет, возможность проветривания. Совершенно недопустимы наглухо закупоренные на зиму окна, сделанная раз в день влажная уборка, так как даже при соблюдении оптимальной температуры, но при нарушении уровня влажности, создается не комфортная для детского организма среда.

    Не допустимо, чтобы температура в школе определялась настроением администрации, работниками теплосети, обслуживающими котельную школы, или родителями, которые приучили ребенка к более высокой температуре воздуха в помещении. Тем более что температурный режим каждого человека индивидуален. Законом для образовательного учреждения является СанПиН, и иначе быть не может.


    В кабинетах небольшой площади, где проводят индивидуальную работу психолог или логопед, оптимальной считается температура воздуха от 18 до 24 градусов. Такая же приемлема для актового зала, фойе, библиотеки и столовой, где большое количество детей и преподавателей бывает, но не на протяжении всего дня.

    В мастерских, где дети заняты зачастую физическим трудом, температура немного ниже (17-20). Эта же норма относится к спортивному залу, где даже рекомендуется держать открытыми фрамуги во время занятий, не допуская сквозняка. Это правило действует, если температура воздуха на улице выше + 5. При низких температурах сквозное проветривание необходимо проводить между уроками.

    Если в школе оборудованы при спортивном зале душевые, то там температура должна достигать 22-25 градусов. В спортивных раздевалках и медицинском кабинете 20-22.

    Во время каникул допустимо снизить температуру воздуха в школе до 15 градусов. Чтобы осуществлять постоянный контроль соблюдения температурного режима, необходимо все помещения школы снабдить термометрами.

    Влажность воздуха не должна выходить за допустимые пределы 40-60 %. Соблюсти эти нормы поможет регулярное проветривание, которое следует проводить в любое время года. Если температура окружающего воздуха ниже –10, то достаточно сквозного 5-минутного проветривания на большой перемене и минутного на маленькой. По мере повышения температуры на улице увеличивается и время проветривания.

    Соблюдение этих правил требует регулярного выполнения со стороны учителя, которому, возможно, не всегда хочется выводить весь класс на маленькой перемене из кабинета. А администрации школы следует во время летнего ремонта позаботиться о том, чтобы окна или фрамуги были в рабочем состоянии.

    Физическая культура на улице САНПИН 2.4.2. 2821 — 10 — Школа № 48 г. Кирова

     

     

    Рекомендации по проведению занятий физической культурой, в зависимости от температуры и скорости ветра, в некоторых климатических зонах Российской Федерации на открытом воздухе в зимний период года

     

    Климатическая зона Возраст обучающихся Температура воздуха и скорость ветра, при которых допускается проведение занятий на открытом воздухе
    без ветра при скорости ветра до 5м/с при скорости ветра 6 – 10 м/с при скорости ветра более 10 м/с
    Северная часть Российской Федерации (Красноярский край, Омская область и др.) до 12 лет -10 — 11 °C — 6 — 7 °C -3 — 4 °C Занятия не проводятся
    12 – 13 лет -12 °C -8 °C -5 °C
    14 – 15 лет -15 °C -12 °C -8 °C
    16 – 17 лет -16 °C -15 °C -10 °C
    В условиях Заполярья (Мурманская область) до 12 лет -11 — 13 °C -7 — 9 °C -4 — 5 °C Занятия не проводятся
    12 – 13 лет -15 °C -11 °C -8 °C
    14 – 15 лет -18 °C -15 °C -11 °C
    16 – 17 лет -21 °C -18 °C -13 °C
    Средняя полоса Российской Федерации до 12 лет -9 °C -6 °C -3 °C Занятия не проводятся
    12 – 13 лет -12 °C -8 °C -5 °C
    14 – 15 лет -15 °C -12 °C -8 °C
    16 – 17 лет -16 °C -15 °C -10 °C

     

     

    Раздел: Новости

    Об авторе Елена Бондаренко

    Заместитель директора по ВР

    Гигиеническая оценка внутришкольной среды в сельских и городских общеобразовательных школах

    Целью исследования является оценка показателей внутришкольной среды в городских и сельских общеобразовательных школах. В ходе специальных исследований дана гигиеническая оценка климата, освещенности и качества воздуха в классных комнатах. В учебных помещениях сельских школ установлены показатели микроклимата, не отвечающие гигиеническим требованиям, в основном по параметрам температуры и влажности.В сельских школах температура была снижена до 16-17 ° С в 19,0 ± 8,6% классных комнат, влажность повышена до 63,1% в 25,7 ± 7,4% классных комнат. Среди городских школ влажность в 49,6 ± 4,4% аудиторий снизилась до 23,3 ± 0,3%, в 20,8 ± 5,4% офисов повысилась до 71,9 ± 0,9%. Коэффициент естественной освещенности сельских школ снижен до 0,86–1,4% в 33,9 ± 14,2% аудиторий. В 25,1 ± 2,3% аудиторий городских школ уровень естественной освещенности был ниже нормативных значений и колебался в пределах 0.32-1,3%. Отмечается, что в кабинетах информатики показатели естественного освещения значительно ниже, чем в аудиториях по профильным предметам. Искусственное освещение в городских школах оказалось ниже гигиенических норм на партах в 1,9 раза, в 2,2 раза — на досках. Получены статистически значимые проблемы со здоровьем городских школьников при рукопожатии, обусловленные внутрисредовыми факторами. Климат в обследованных спортзалах сельских школ отличается низкой температурой и повышенной влажностью.Гигиеническая оценка среды загрязнения воздуха в классных комнатах проводилась по ряду химических веществ: формальдегид, оксид углерода, диоксид азота, диоксид серы, твердые частицы. Концентрации формальдегида; содержание двуокиси азота, взвешенных веществ в воздухе в классах городских школ оказалось выше, чем в сельских школах. Было обнаружено, что концентрация окиси углерода в классных комнатах сельских школ превышает их значения в городских школах. Было установлено, что воздух в классных комнатах одного из городов отличается специфической атмосферой по содержанию его химического вещества — фтороводорода в концентрациях, превышающих ПДК в 3–3 раза.5 раз.

    SNAPIN регулирует прогрессию клеточного цикла, способствуя росту β-клеток поджелудочной железы

    Abstract

    При сахарном диабете гибель β-клеток в поджелудочной железе происходит на протяжении всего развития заболевания с потерей выработки инсулина. Поддержание количества β-клеток необходимо для поддержания нормогликемии. Было обнаружено, что SNAPIN регулирует секрецию инсулина, но вызывает ли он пролиферацию β-клеток, еще предстоит выяснить. Это исследование было направлено на изучение физиологической роли SNAPIN в пролиферации β-клеток.Экспрессия SNAPIN увеличивается с возрастом мышей, а SNAPIN подавляется при диабете. Анализ пути KEGG и GO показал, что белки, взаимодействующие с SNAPIN, были обогащены регуляцией клеточного цикла. Цикл В-клеток был остановлен в S-фазе, а пролиферация клеток ингибировалась после нокдауна SNAPIN. Экспрессия белков CDK2, CDK4 и CCND1 в S-фазе клеточного цикла снижалась после нокдауна SNAPIN, тогда как она повышалась после сверхэкспрессии SNAPIN. Кроме того, уровни белка инсулина и мРНК также увеличивались или уменьшались после нокдауна или сверхэкспрессии SNAPIN, соответственно.Выводы. Наши данные указывают на то, что SNAPIN опосредует пролиферацию β-клеток и секрецию инсулина, и свидетельствуют о том, что SNAPIN может быть фармакотерапевтической мишенью при сахарном диабете.

    Ключевые слова: SNAPIN, β-клетки, пролиферация, клеточный цикл, диабет

    Введение

    Диабет является распространенным заболеванием во всем мире и стал серьезной проблемой социального здоровья (1). В конечном итоге это приводит к дефициту функциональных β-клеток поджелудочной железы (2). Поддержание количества β-клеток и массы островков необходимо для поддержания нормогликемии (3, 4).Скорость репликации β-клеток человека очень низкая, и клетки способны к репликации только в течение короткого периода после рождения (5).

    Сахарный диабет 1 типа (СД1) связан с нарушением массы β-клеток (6). Патогенез диабета 2 типа более разнообразен и состоит из инсулинорезистентности и нарушения секреции инсулина (6). В частности, сахарный диабет 2 типа (СД2) связан с генетической предрасположенностью и факторами окружающей среды, такими как ожирение и диета (7). Во время беременности и на ранних стадиях диабета компенсаторная пролиферация β-клеток поджелудочной железы происходит в ответ на изменение уровня глюкозы в крови (8, 9).Сама глюкоза способна стимулировать репликацию β-клеток (10), и несколько линий доказательств указывают на то, что терминально дифференцированные β-клетки поджелудочной железы сохраняют значительную пролиферативную способность in vivo (11, 12). Эта способность к пролиферации привлекла значительное внимание исследователей с точки зрения разработки терапевтических стратегий при сахарном диабете. Хотя ряд исследований, касающихся дифференцированных β-подобных клеток из эмбриональных стволовых клеток или индуцированных плюрипотентных (взрослых) стволовых клеток, продолжается, низкая эффективность преобразования β-клеток из стволовых клеток остается проблемой для разработки методов лечения на основе клеток (13).Сообщалось, что передача сигналов глюкокиназы, белок, связывающий элемент углеводного ответа (ChREBP), ядерный фактор активированных Т-клеток (NFAT), тромбоцитарный фактор роста (PDGF), CDK4 / 6 и TCF7L2, стимулируют пролиферацию β-клеток человека (14). –19). Таким образом, были выявлены механизмы, регулирующие массу β-клеток, лежащие в основе развития СД1 и СД2, что важно для разработки новых терапевтических подходов к лечению диабета. Эта способность к пролиферации привлекла значительное внимание исследователей с точки зрения разработки терапевтических стратегий при сахарном диабете.

    SNAPIN — это белок, который взаимодействует с комплексами SNARE во время синаптической передачи. Впервые о нем сообщил Джеффри М. Иларди в 1999 году. Впервые он был идентифицирован в нейронах и локализован на мембранах синаптических везикул (20). Он также входит в состав комплексов BLOC-1 и BORC (21). Комплекс BLOC-1 необходим для нормального биогенеза связанных с лизосомами органелл (LRO), таких как плотные тромбоциты гранулы и меланосомы (22), а BORC необходим для позиционирования лизосом в клетках млекопитающих (21).Все больше данных показывает, что SNAPIN важен для ретроградного транспорта аксонов (23), позднего эндосомно-лизосомного транспорта (24) и индуцированного глюкозой экзоцитоза инсулина (25). Также считается, что он участвует во множестве функций передачи сигналов и внутрикапсулярного транспорта / слияния (26).

    SNAPIN специфически экспрессируется в эндокринном отделе поджелудочной железы. Наблюдалось диффузное окрашивание цитоплазмы, и клетки были сгруппированы в точечные структуры, которые располагались рядом с секретирующими инсулин гранулами (27).Секреция инсулина может быть вызвана взаимодействием между c-концевой областью h3 SNAPIN и областью sn-1 snap-25 в комплексе SNARE (27, 28), которое запускает процесс нацеливания, связывания, инициации частиц секреции инсулина. и слияние мембран (27, 29). Эти процессы экзоцитоза опосредуются комплексом Munc18 / SNARE (30).

    Кроме того, SNAPIN является мишенью для протеинкиназы A (PKA) (31), которая является важным регулятором глюкозо-стимулированного экзоцитоза инсулина в β-клетках поджелудочной железы, способствуя взаимодействию и сборке белков, связанных с секреторными пузырьками инсулина Snap25 и TMEM27 (32).SNAPIN значительно коррелирует с геном TMEM27, который кодирует мембранный белок, расщепляемый и выделяемый бета-клетками поджелудочной железы, который был предложен в качестве биомаркера массы бета-клеток (33). Это указывает на то, что SNAPIN также может быть биомаркером бета-клеток. Функция SNAPIN в росте β-клеток плохо изучена, и наши результаты показывают, что сверхэкспрессия SNAPIN в клетках Min6 может способствовать пролиферации клеток и является многообещающим для достижения целей регенеративной медицины для лечения диабета.

    Материалы и методы

    Процедуры клонирования

    Snapin полной длины амплифицировали с помощью ПЦР с кДНК и клонировали в сайтах XhoI и BamHI вектора PCDH-3xFlag-3xHA-EF1-пуромицин. Праймеры были созданы с использованием программного обеспечения Primer Premier 5.0 (Premier Biosoft International, Пало-Альто, Калифорния).

    Упаковка и заражение лентивирусом

    Клетки HEK293T высевали в планшеты для культивирования на 12 часов и трансфицировали лентивирусными векторами вместе с упаковывающими векторами, pMDL, VSVG и REV в соотношении 10: 5: 3: 2 с использованием липофектамина 2000 для 48 часов.Вирус собирали, фильтровали и добавляли к β-клеткам в присутствии 10 мкг / мл полибрена (Sigma, H9268) с последующим центрифугированием в течение 30 минут при 1500 g при 37 ° C. Среда была заменена через 12 часов. Эффективность трансдукции оценивали с помощью анализа иммуноблоттинга.

    shRNA Infection

    Процесс упаковки частиц лентивирусов был таким же, как описано выше. Последовательности праймеров были в формате. Временную трансфекцию плазмид в клетки проводили с использованием реагентов Lipofactamine 2000 (Invitrogen) в соответствии с инструкциями производителя.

    Таблица 1

    Целевое секвенирование

    shRNA и праймеры для клонирования SNAPIN.

    A 900AAATTGACAACCTAGCTCTC1)
    Ген Вперед ( 5 ‘→ 3’ ) Обратный ( 5 ‘→ 3’ )
    shRNA-1 CCGGCAACCTAGCTACAGAACTGTGACCTC AATTCACTAAGAACTGTGACCTC AATTCACTAAGA plko.1) GAGCACAGTTCTGTAGCTAGGTTGTTTTTG TGCTCGAGCACAGTTCTGTAGCTAGGTTG
    shRNA-2 CCGGGAACAAATTGACAACCTAGCTC63 CCGGGAACAAATTGACAACCTAGCTC63 GAGAGCTAGGTTGTCAATTTGTTCTTTTTG GCTCTCGAGAGCTAGGTTGTCAATTTGTTC
    shRNA-1 TCGACAACCTAGCTACAGAACTGTGTTCAAG GATC GAAAAAACAACCTAGCTACAGAACT
    (psicor) AGACACAGTTCTGTAGCTAGGTTGTTTTTTC GTGTCTCTTGAACACAGTTCTGTAGCTAGGTTG
    shRNA-2 TCGAGAACAAATTGACAACCTAGCT TTCAA GATC GAAAAAAGAACAAATTGACAACCTA
    (psicor) GAGAAGCTAGGTTGTCAATTTGTTC TTTTTTC GCTTCTCTTGAAAGCTAGGTTGTCAATTTGTTC
    SnapIn AGAGAATTCGGATCCATGGCCGCGGCTGGTT CTTCCATGGCTCGAGTTTGCTTGGAGAACCAGG
    (PCDH)

    Клеточные линии

    мышь поджелудочной железы Min6, поджелудочной железы INS1 крысы и клеточные линии HEK-293T были получены от ATCC.Клетки Min6 поддерживали в среде DMEM с высоким содержанием глюкозы (BI) с добавлением 15% об. / Об. Фетальной бычьей сыворотки (FBS, BI), 50 ммоль / л 2-меркаптоэтанола и 1% пенициллин-стрептомицина при 37 ° C и 5% СО2 в увлажненной атмосфере в инкубаторе. HEK-293T культивировали в среде DMEM с добавлением 10% об. / Об. Фетальной бычьей сыворотки (FBS, BI) и 1% пенициллин-стрептомицин в инкубаторе при 37 ° C и 5% CO2 в увлажненной атмосфере в инкубаторе. Клетки INS1 поджелудочной железы крысы культивировали в RPMI1640 (Hyclone), содержащей 10% об. / Об. Фетальной бычьей сыворотки (FBS, BI), 1% пенициллин-стрептомицин, 1% глутамин, 1 мМ пируват натрия и 50 мкМ β-меркаптоэтанол (сигма). .

    Животные

    Самцов мышей KM массой примерно 18-25 г были приобретены в Центре животных Университета Сямэня. Мышей гуманно содержали при температуре 22 ± 2 ° C с 12-часовым циклом свет / темнота. Все животные имели свободный доступ к пище и воде. Все исследования на животных были одобрены комитетом по этике Сямэньского университета и соответствовали положениям руководящих принципов Национального института здравоохранения по уходу и благополучию лабораторных животных. Мыши Db / Db и HFD были получены из лаборатории Ли Мин Ю в Университете Сямыня.

    Иммуногистохимия

    SNAPIN и инсулин были проанализированы иммуногистохимическим окрашиванием замороженных срезов поджелудочной железы взрослых мышей, фиксированных O / N в 4% PFA в PBS при комнатной температуре, pH 7,4, замороженных 30% сахарозой в PBS, залитых в Tissue-Tek ( Сакура; Верлозе, Дания) и разрезали на срезы 9 мкм на криостате Leica. Извлечение антигена выполняли с помощью микроволновой обработки в течение 4 минут при 600 Вт в 200 мл 0,01 М цитратного буфера, затем 15 минут при 250 Вт и, наконец, оставляли охлаждаться на 20 минут.Срезы тканей промывали в TBS, гасили в 3% h3O2 в течение 5 минут и снова промывали. Затем использовали 10% козью сыворотку для блокирования в течение 1 часа перед инкубацией в течение ночи с очищенными кроличьими антителами против SNAPIN, разведенными 1: 200, и кроличьими антиинсулиновыми антителами, разведенными 1: 400 в 10% блокирующем буфере козьей сыворотки. Срезы промывали трижды по 5 минут каждый в TBS между инкубациями с первичным антителом и следующими инкубациями с биотинилированным вторичным антителом (Zymed; Орхус, Дания) в течение 30 минут.Связанные антитела визуализировали с помощью DAB после 3-минутного инкубационного периода и последующей промывки в TBS, а слайды окрашивали гематоксилином. Изображения были получены с помощью микроскопа Olympus (Токио, Япония) BX51 и сняты с помощью охлаждаемой камеры Hamamatsu C5810 CCD (город Хамамацу, Япония) и программного обеспечения Image Pro Plus 4.5.

    Ядерная экстракция клеток

    SNAPIN сверхэкспрессировался в клетках Min6. Все этапы выполнялись на льду с ледяными реагентами в пробирках для предварительного центрифугирования.Сначала мы использовали ледяной 1xPBS для промывания клеток и аккуратного соскоба клеток в 15 мл пробирку. Их центрифугировали 5 минут при 500 об / мин, 4 ° C. Затем осадок ресуспендировали в 1 мл охлажденного льдом BUFFER1 (1 M HEPES, PH 8,0, 1 M Mgcl2, 1 M KCl и 1 M DTT) и инкубировали в течение 15 минут на льду, чтобы клетки могли набухнуть. Np40 добавляли в вортекс на 10 с. Клетки центрифугировали в течение 3 минут при максимальной скорости, затем пипеткой отсасывали супернатант, который представлял собой цитоплазматическую фракцию. Осадок ресуспендировали в холодном буфере BUFFER2 (1 M HEPES, pH 8.0, 1 M Mgcl2, глицерин, 1 M Nacl, 0,5 M EDTA и 1 M DTT), встряхивали 30 S и энергично вращали при 4 ° C в течение 30 минут. Осадок центрифугировали в течение 15 минут на максимальной скорости, супернатант удаляли и переносили в свежую охлажденную пробирку. Анализ концентрации белка для иммуноблоттинга.

    Конфокальная иммунофлуоресцентная микроскопия

    β-клеток фиксировали в 4% параформальдегиде в течение получаса при комнатной температуре. Затем клетки трижды промывали PBS в течение 5 минут при комнатной температуре.0,1% Тритон-100 добавляли для проникновения в течение 10 минут, и клетки инкубировали в блокирующем буфере (5,0% BSA в PBS) в течение 1 часа при комнатной температуре. Затем мы провели иммуноокрашивание с использованием первичных антител SNAPIN (1:50) и инсулина (1: 800), инкубированных в течение ночи при 4 ° C, а затем вторичных антител, конъюгированных с флуорофором. Иммуномеченые клетки анализировали с помощью лазерного сканирующего конфокального микроскопа Carl Zeiss LSM5 EXITER или Leica TCS SP8 STED. Зеленый канал был отображен с помощью лазерной линии с длиной волны 488 нм (120 мВт / см2, 2.5%). Красный канал был получен с помощью лазера с длиной волны 559 нм (120 мВт / см2, 2,0%). Изображения получали с интервалом 4 с (время кадра 3,9 с). Импульсный лазер с длиной волны 375 нм (10 МГц) применялся для экспериментов по снятию каркаса во всем поле зрения для восьми кадров (3,2 с / кадр). Установка с двумя сканерами позволяла одновременно выполнять лазерную стимуляцию и конфокальную визуализацию. Это позволило получить клеточные ответы, возникающие во время или сразу после лазерной стимуляции.

    Клеточный цикл и проточная цитометрия

    Клетки Min6, которые подверглись сверхэкспрессии или нокдауну SNAPIN, добавляли к 1 мл холодного PBS для повторного суспендирования осадка клеток и осторожно встряхивали и равный объем холодного абсолютного этанола (хранить при -20 ° C). по каплям добавляли к суспензии клеток в той же пробирке на 15 мл.Затем его хранили при -20 ° C не менее 2 часов. Перед окрашиванием клетки дважды промывали холодным PBS и центрифугировали при 4 ° C, 3000 g в течение 5 минут, и супернатант полностью удаляли. Добавляли окрашивающий раствор PI и инкубировали при 37 ° C в течение 15 минут. Данные были получены с помощью проточной цитометрии. Затем мы использовали PI для окрашивания клеток Min6, которые трансфицировали shRNA в течение 15 минут. Клетки или ядра фильтровали через сито 40 мм и проточную цитометрию проводили на 4-лазере LSRII (BD Biosciences). Данные были проанализированы с помощью программного обеспечения FlowJo.

    Анализ пролиферации клеток

    Клетки Min6, которые подверглись сверхэкспрессии или нокдауну SNAPIN, высевали в 96-луночный планшет и инкубировали со средой в течение 24 часов. Жизнеспособность клеток измеряли с помощью анализа MTS с использованием CellTiter 96 AQueous One Solution Cell Proliferation Assay (Promega). Для измерения жизнеспособности клеток на лунку добавляли 500 мкл смеси среда / раствор MTS (20 мкл среды MTS / мл). Планшет инкубировали при 37 ° C в течение 1 часа. Затем измеряли оптическую плотность при 490 нм, используя автоматический ридер для микропланшетов.Жизнеспособность клеток измеряли каждые 24 часа в течение четырех дней подряд.

    Анализ этинилдезоксиуридина (EdU)

    Пролиферирующие клетки оценивали с помощью Click-iT ™ EdU Proliferation Assay (Invitrogen) в соответствии с протоколом производителя. Вкратце, клетки Min6, которые подверглись нокдауну, высевали в 96-луночный планшет (5000 клеток / лунку). Затем добавляли среду для мечения EdU 10 мкм и клетки инкубировали в течение 24 часов. 50 мкл фиксатора Click-iT ™ EdU добавляли в каждую лунку на 5 минут и 50 мкл реакционной смеси 1X Click-iT ™ в каждую лунку на 30 минут.Затем добавляли 1,5% БСА для блокирования клеток на 5 минут. После промывки несколько раз добавляли 100 мкл реакционной смеси Amplex ™ UltraRed в течение 15 минут, а затем инкубировали с 10 мкл стоп-реагента Amplex ™ UltraRed. Флуоресценцию измеряли с максимумом возбуждения 568 нм и максимумом испускания 585 нм.

    Окрашивание аннексином V-FITC / пропидием иодидом (PI)

    Апоптоз β-клеток измеряли с помощью аннексина V / FITC (BD Bioscience) в соответствии с протоколом производителя. Клетки собирали и ресуспендировали в 100 мкл связывающего буфера с последующим окрашиванием 5 мкл аннексина V, конъюгированного с FITC, и 5 мкл PI в темноте в течение 15 минут при комнатной температуре.Затем для ресуспендирования клеток добавляли 00 мкл связывающего буфера. Клетки были обнаружены методом проточной цитометрии (BD Biosciences). На ранней стадии апоптоза клеточные мембраны окрашивали FITC- конъюгированным аннексином V, тогда как ядра не окрашивались PI. На поздней стадии апоптоза клетки окрашивали как FITC- конъюгированным аннексином V, так и PI. Результаты были проанализированы с помощью FlowJo vX.0.7 (FlowJo LLC).

    Секреция инсулина в клетках bb

    Для проверки секреторной реакции на глюкозу клетки Min6 культивировали на стеклянных покровных стеклах в течение 24 часов.Через 24 часа посева клетки Min6 инкубировали в течение 1 часа при 37 ° C в KIRH BUFFER (136 ммоль / л NaCl, 4,7 ммоль / л хлорида калия (KCl), 1,2 ммоль / л Kh3PO4, 1,2 ммоль / л MgSO4, 5 ммоль / л NaHCO3, 1 ммоль / л CaCl2, 10 ммоль / л HEPES и 0,5% BSA, pH 7,4) с добавлением 2,8 ммоль / л или 16,7 ммоль / л глюкозы. Инсулин определяли с помощью ELISA (набор для иммуноанализа мышиного инсулина широкого диапазона, каталожный номер: 32100). В каждую лунку добавляли 5 мкл стандарта и образца и 100 мкл детектирующего антитела с последующей инкубацией при комнатной температуре в течение 90 минут.После промывки несколько раз в каждую лунку добавляли 100 мкл раствора субстрата при комнатной температуре в течение 15 минут с последующим добавлением 100 мкл стоп-раствора и немедленным обнаружением при 450 нм. Клетки фиксировали 4% параформальдегидом в течение 20 минут, и фиксированные клетки подвергали проницаемости 0,5% тритона-100 в течение 15 минут, обрабатывали 0,1% твина 20 в фосфатно-солевом буфере в течение 5 минут и блокировали 5% FBS в течение 40 минут перед инкубацией. с первичным антителом против SNAPIN (1:50; протеинтех) и инсулином (1: 800; Cell Signaling Technology) в течение ночи при 4 ° C с последующей инкубацией с меченными родамином вторичными антителами против IgG мыши (1: 200; Chemicon, Темекула, США) в течение 1 часа при комнатной температуре.Ядерную локализацию контрастировали с помощью DAPI.

    Ткани и клетки Выделение РНК

    Ткани мышей выделяли у мышей 5 дней, 2, 3, 4 и 8 недель. Затем суммарную РНК экстрагировали, используя реагент TRIzol (Gibco-BRL) и следуя инструкциям производителя.

    Цепная реакция обратной транскриптазы-полимеразы в реальном времени

    Вкратце, тотальную РНК экстрагировали с использованием реагента TRIzol (Invitrogen), а комплементарную ДНК генерировали с использованием набора реагентов для обратной транскрипции PrimeScript ™ (Takara, Tokyo, Japan).Из аликвот РНК 1 мкг мы синтезировали кДНК с использованием случайных гексамеров или олиго (dT) и обратной транскриптазы, следуя протоколу производителя. Реакции проводили в течение 40 циклов при 30 ° C в течение 10 минут, 42 ° C в течение 20 минут, 99 ° C в течение 5 минут и 4 ° C в течение 5 минут с использованием системы обнаружения ПЦР в реальном времени (Bio-Rad, Hercules, США) согласно инструкции производителя и проверено на геле. Цепные реакции с обратной транскриптазой и полимеразой в реальном времени (ОТ-ПЦР в реальном времени) проводили с использованием Master Mix Power SYBR Green PCR (Roche) и системы обнаружения ПЦР в реальном времени 7500 (Applied Biosystems).Актин использовался в качестве внутреннего контроля. Последовательности праймеров перечислены в. Все эксперименты были выполнены в трех экземплярах, и данные показаны как среднее ± стандартное отклонение.

    Таблица 2

    Последовательности праймеров для ПЦР в реальном времени.

    AGGACCCACAAGTGGAACAA
    Ген Вперед ( 5 ‘→ 3’ ) Обратный ( 5 ‘→ 3’ )
    SNAPIN AGCTACAGAACTGTGCCGGATCATA GCTTGAGAGACCAGGAA GCTTGAGAGACCAGGulin
    GCTGGTAGAGGGAGCAGATG
    Insulin2 GGACCCACAAGTGGAACAAC GTGCAGCACTGATCCACAAT
    CDK2 AATGCAGAGGGGTCCATCAA GGAGTAGTACTTGCAGCCCA
    актина TGTTACCAACTGGGACGACA GGGGTGTTGAAGGTCTCAAA

    Вестерн блот

    Клетки высевали при подходящей плотности и общего белка клеток или тканей использовали буфер для лизиса клеток, содержащий (50 мМ Tris-HCl (pH 7.4), 150 мМ NaCl, 1 мМ EDTA и 1% Triton X-100), содержащую смесь ингибиторов протеаз (сигма, P2714-1BTL), на льду в течение 30 минут с последующим центрифугированием. Концентрации белка определяли с помощью набора для анализа бицинхониновой кислоты (Beyotime Biotechnology). Белок (20 мкг / дорожка) разделяли электрофорезом в 10-15% додецилсульфат-полиакриламидном геле (SDS-PAGE) и переносили на поливинилиденфторидные мембраны (Millipore, Billerica, MA). Мембраны блокировали на 1,5 часа в трис-буферном физиологическом растворе и Твин 20 (TBST, pH 7.6) содержащий 5% обезжиренного сухого молока при комнатной температуре и инкубированный с первичными антителами при 4 ° C в течение ночи. Затем мембраны трижды промывали TBST по 15 минут каждый и инкубировали с антикроличьими вторичными антителами (1: 5000 в TBST), конъюгированными с HRP, в течение 1 часа при комнатной температуре. Затем блоты проявляли в темноте с использованием набора для определения ECL (Proteintech). Интенсивность полос определяли количественно с помощью программы ImageJ 1.45 (NIH, США). Антитела перечислены в.

    Таблица 3

    Антитела, используемые в вестерн-блоттинге, иммуногистохимии и иммунофлуоресценции.

    Антитело Разведение Виды-хозяева Поставщик
    β-Актин 1: 1000 Кролик proteintech
    Snapin 1: 1000 Кролик протеинтех
    Snapin 1: 1000 Кролик Синаптическая система
    Инсулин 1: 800 мышь Сигнализация клеток
    Инсулин 1: 400 Кролик proteintech
    Flag 1: 1000 mouse Sigma
    HA 1: 1000 Rabbit Santa Cruz
    CDK2 1: 1000 Rabbit Proteintech
    CDK4 1: 1000 Кролик Prote intech
    CCND1 1: 1000 Rabbit proteintech
    PARP 1: 1000 Rabbit Сигнализация клеток
    HSP60 1: 1000 Rabbitch proteintech
    BLOC1S1 1: 1000 Кролик ABclonal
    HRP-anti-rabbit IgG 1: 1000 Rabbit Beyotime
    CY3-anti-rabbit lgG 1gG : 200 Rabbit Beyotime
    CY3-anti-mouse lgG 1: 200 mouse Beyotime
    FITC-anti-mouse lgG 1: 200 мышь Beyotime

    Анализ иммунопреципитации

    Через два дня после трансфекции клетки лизировали в буфере для лизиса (1% Triton X-100, 50 мМ Tris-HC л (pH 7.4), 150 мМ NaCl, 1 мМ ЭДТА, 1% дезоксихлат натрия) с коктейлями из ингибиторов протеаз. Добавляли предварительно промытые бусины Flag-beads. После иммунопреципитации Flag-Beads промывали 4-5 раз буфером для лизиса (содержащим ингибитор протеазы). Flag-пептиды добавляли для элюирования белков, меченных Flag. Загрузочный буфер 4xSDS добавляли в супернатант после обогащения, и образец кипятили в металлической бане в течение 10 минут перед тем, как быть готовым. Затем элюаты подвергали SDS-PAGE и Вестерн-блоттингу.

    Анализ ЖХ – МС и поиск в базе данных

    Каждую иммунопреципитацию (IP) проводили в трех повторностях.Клетки Min6, экспрессирующие вектор Flag-SNAPIN или PCDH, выращивали на 15-сантиметровых планшетах до 90% конфлюэнтности, а затем подвергали IP. Элюаты после IP сначала восстанавливали в 20 мМ дитиотреитоле (DTT) (Sigma) при 95 ° C в течение 5 минут, а затем алкилировали в 50 мМ йодацетамида (IAA) (Sigma) в течение 30 минут в темноте при комнатной температуре. После алкилирования образцы переносили на центробежный центробежный фильтр 10 кДа (Millipore) и последовательно промывали 200 мл 8 М мочевины три раза и 200 мл 50 мМ бикарбоната аммония два раза центрифугированием при 14000 g.Затем проводили триптическое расщепление путем добавления трипсина (Promega) в соотношении 1:50 (фермент / субстрат, м / м) в 200 мл 50 мМ бикарбоната аммония при 37 ° C в течение 16 часов. Пептиды выделяли переносом фильтра в новую пробирку для сбора и вращением при 14000 g. Для увеличения выхода пептидов фильтр дважды промывали 100 мл 50 мМ бикарбоната аммония. Пептиды были обессолены с помощью StageTips (34, 35).

    Анализ путей GO и KEGG Генная онтология (GO) — онтология, широко используемая в области биоинформатики для аннотирования крупномасштабных генов и генных продуктов (36).KEGG — это практический ресурс базы данных для технологий секвенирования генома и экспериментов с полимерами. Он генерируется информацией на молекулярном уровне, особенно наборами макромолекулярных данных, которые можно использовать для прогнозирования того, какие пути конкретного гена обогащены (37). Он охватывает такие информационные ресурсы, как заболевания и пути распространения, анализ GO и анализ KEGG, выполненный с помощью инструментов DAVID (https://david.ncifcrf.gov/). Статистически значимым считали P <0,01.

    Статистический анализ

    Групповые данные отображаются как среднее ± стандартная ошибка среднего (SEM).Различия между группами рассчитывались с помощью непарных двусторонних t-критериев Стьюдента или одностороннего дисперсионного анализа (ANOVA) с последующими апостериорными тестами Тьюки . Статистически значимым считалось P <0,05.

    Результаты

    Экспрессия SNAPIN увеличивается с возрастом мышей, и SNAPIN снижается у диабетических мышей

    Были выделены ткани шести мышей разного возраста с последующей экстракцией белка для определения экспрессии SNAPIN ( ) .Мы обнаружили, что экспрессия SNAPIN была относительно выше в печени (38), почках (39) и поджелудочной железе (25). Уровень экспрессии SNAPIN в поджелудочной железе мышей также сильно увеличивался с возрастом мышей ( ) .

    Экспрессия SNAPIN в тканях мыши. (A) Экспрессия SNAPIN рассчитывалась с помощью вестерн-блоттинга. SNAPIN был сопоставим в течение 5 дней с 8-недельной мышью. (B) Нормализованные гистограммы белка снапина против актина с использованием программного обеспечения для визуализации. (C) Уровень экспрессии SNAPIN в поджелудочной железе мышей также сильно увеличивался с возрастом мышей. (D) Нормализованные гистограммы белка снапина против актина с использованием программного обеспечения для визуализации. (E) Репрезентативные иммунофлуоресцентные изображения здоровой и преддиабетической поджелудочной железы мышей с использованием антител против SNAPIN и инсулина. Инсулин и SNAPIN мышей HFD и db / db были значительно ниже, чем у мышей дикого типа. (F) Размер β-клеток поджелудочной железы и экспрессия SNAPIN были рассчитаны на основе иммуногистохимических (IHC) срезов, обработанных для инсулина и SNAPIN, путем получения изображений в ярком поле (серия Leica CTR 4000).Размер β-клеток у мышей с высоким содержанием жиров (HFD) был значительно меньше, чем у мышей дикого типа, а экспрессия SNAPIN у мышей HFD была значительно ниже, чем у мышей дикого типа. Шкала: 100 мкм (слева) и 50 мкм (справа). Значения выражены как средние ± S.E.M. P <0,001 по сравнению с контролем. (G) Статистика для размера β-клеток и экспрессии SNAPIN. *** P <0,001.

    Далее мы исследуем, имеет ли экспрессия SNAPIN несоответствие в своем участии у здоровых и диабетических мышей.Окрашивание гематоксилином проводили для обнаружения экспрессии инсулина и SNAPIN у мышей дикого типа и мышей с диабетом. Уменьшение массы β-клеток и снижение SNAPIN наблюдались у мышей с диабетом по сравнению с контрольными мышами дикого типа. У диабетических мышей было намного меньше SNAPIN по сравнению с контрольными мышами дикого типа (), что имеет тенденцию к снижению на 40%. Мы также исследовали экспрессию SNAPIN с помощью иммуноокрашивания, и у мышей с диабетом было намного меньше SNAPIN по сравнению с контролем WT ( ) .

    SNAPIN в основном расположен в цитоплазме и совмещен с секреторными гранулами инсулина

    SNAPIN первоначально был обнаружен в нейронах и исключительно на мембране синаптических пузырьков (40).Позднее сообщалось о внепочечной экспрессии в нескольких тканях и клеточных линиях, включая β-клетки поджелудочной железы, клетки INS1, клетки Min6, мозг и т. Д. В адипоцитах 3T3-L1 биохимический и иммунофлуоресцентный микроскопический анализ показал, что он локализуется как в диффузных цитозольных, так и в перинуклеарных тканях. мембранные отсеки (41). Мы обнаружили, что SNAPIN в основном локализован в цитоплазме, и мы обнаружили, что SNAPIN проявляет некоторое диффузное цитозольное окрашивание и группируется в точечные структуры внутри клеточного тела в клетках INS1 и Min6 крысы.Кроме того, картина окрашивания точечных точек была аналогична той, что наблюдалась для инсулинсодержащих секреторных гранул. Затем два поля были наложены друг на друга (). И анализ совместной локализации флуоресценции показал, что SNAPIN и инсулин имели отношения совместной локализации с помощью ImageJ (). Анализ данных подтвердил, что существует значительная совместная флуоресценция между точечным инсулином и сигналами SNAPIN, что указывает на совместную локализацию SNAPIN и секреторных гранул инсулина. Мы также использовали клетку Min6 дикого типа для обнаружения субклеточной локализации SNAPIN и обнаружили, что нуклеоцитоплазматическое разделение показало, что SNAPIN преимущественно находится в цитоплазме ().

    Субклеточная локализация SNAPIN. (А) . Иммунофлуоресценция была проведена для измерения субклеточной локализации SNAPIN. SNAPIN визуализировали в клетках INS-1 и Min6 с использованием антитела против SNAPIN в сочетании с антителом против кролика FITC, тогда как инсулин визуализировали с помощью антител к инсулину и конъюгированных с красным козьих антител против мыши. Слайды устанавливали и флуоресценцию просматривали под лазерным сканирующим конфокальным микроскопом, оборудованным фильтром лазерного возбуждения 488 нм для FITC. Ядра были помечены DAPI (синий) (4ʹ, 6-диамидино-2-фенилиндол), а белок SNAPIN был помечен Alesa Fluor 643 (красный).Шкала шкалы 2 мм. (B) Распределение флуоресценции SNAPIN и инсулина было проанализировано ImageJ. (C) Ядерно-цитоплазматическое разделение выполняли для измерения субклеточной локализации SNAPIN. PARP является ядерным маркером, а HSP60 — цитоплазматическим маркером. SNAPIN в основном находится в цитоплазме.

    SNAPIN и его взаимодействующий белок-обогащенный клеточный цикл

    SNAPIN в основном находится в цитоплазме, и для выяснения роли SNAPIN в развитии и прогрессировании диабета в этом исследовании была использована схематическая схема процедуры масс-спектрометрии иммунопреципитации. .Flag-SNAPIN или пустой вектор сверхэкспрессировался в клетках Min6 и подвергался иммунопреципитации с использованием лизатов цельных клеток в трех повторностях. Клетки Min6, экспрессирующие только пустой вектор, служили отрицательным контролем. Чтобы идентифицировать предполагаемые биологические процессы, связанные с белками, взаимодействующими с SNAPIN, мы выполнили анализ обогащения в домене «Биологический процесс» генов (GO) () и пути KEGG (). Этот анализ идентифицировал клеточный цикл, связанный с ростом клеток.

    Результаты протеомного анализа белков, измененных по SNAPIN.Идентичность белков, связывающих SNAPIN. Экспериментальный процесс идентификации белков, взаимодействующих с SNAPIN. Клетки Min6 трансдуцировали SNAPIN со специфическими последовательностями, содержащими тег 3xFlag. Полученный клеточный лизат подвергали реакции с шариками-флажками. Связанную фракцию элюировали и отправляли на ЖХ-МС / МС с дробовиком. (A, B) Пути были обогащены общими генами с использованием базы данных для аннотаций, визуализации и интегрированного обнаружения (DAVID) вер. 6.8, путь KEGG и путь GO, которые представляют функциональные классы белков, взаимодействующих с SNAPIN. (C) Белки, значительно взаимодействующие с SNAPIN, были классифицированы на различные белковые комплексы. (D) IP был выполнен для измерения эффективности раскрытия флага. BLOCS1 был положительным контролем. (E) SNAPIN-связывающие белки были идентифицированы с помощью раскрывающегося списка Flag Immunoprecipitation. Тепловая карта показывает оценку секвестра HT, где интенсивности синим цветом указывают относительное содержание белка в образце.

    Иммуноблот-анализ иммунопреципитированных фракций показал, что помеченный SNAPIN был обогащен в раскрывающемся списке ().Напротив, в векторном контроле в раскрывающемся списке не было обнаружено SNAPIN. В некоторых работах ранее было показано, что SNAPIN связывается с Bloc1s1 с помощью иммуноблоттинга (42). Как и ожидалось, Bloc1s1 был обнаружен в текущем исследовании IP-MS (). Эти данные демонстрируют, что меченый SNAPIN может быть эффективно и специфично иммунопреципитирован из клеточных экстрактов.

    Белки, значительно взаимодействующие с SNAPIN, были разделены на различные белковые комплексы. Результаты этого анализа идентифицировали двадцать преобладающих комплексов: (1) Nop56p-ассоциированный комплекс пре-рРНК, (2) Большой комплекс Дроша, (3) комплекс CCT (шаперонин, содержащий комплекс TCP1), (4) комплекс SNW1, (5) PA700 комплекс, (6) комплекс сплайсосома C, (7) комплекс CDC5L, (8) сигнальный комплекс TNF-альфа / NF-Kappa B и другие известные комплексы: комплекс BLOC1 (биогенез связанного с лизосомами комплекса органелл1) и комплекс белка Arp2 / 3 ().

    Наши эксперименты показали, что SNAPIN может влиять на пролиферацию клеток и клеточный цикл, и мы проанализировали пути клеточного цикла, которые тесно связаны с ростом клеток ().

    Сверхэкспрессия SNAPIN вызывает пролиферацию β-клеток

    SNAPIN и его взаимодействующие белки могут обогатить путь клеточного цикла, что может привести к усилению клеточной пролиферации. Чтобы напрямую оценить роль SNAPIN в пролиферации β-клеток, мы трансфицировали клетки Min6 лентивирусом в течение 24 часов.MTS-анализ применялся для обнаружения пролиферации клеток. Мы наблюдали значительное увеличение содержания белка SNAPIN в клетках Min6, обработанных лентивирусом, с помощью Вестерн-блоттинга (). Сверхэкспрессия SNAPIN индуцировала пролиферацию β-клеток () и увеличивала образование клонов клеток Min6 по сравнению с контрольной группой (). показывает статистику клона.

    Сверхэкспрессия SNAPIN вызывает пролиферацию β-клеток. Клетки Min6 трансдуцировали неспецифическими и специфичными для SNAPIN последовательностями. (A) Клетки Min6 обрабатывали лентивирусом.Значительное увеличение белка SNAPIN по данным вестерн-блоттинга. Анализ (B) MTS проиллюстрировал пролиферацию клеток Min6, индуцированную после сверхэкспрессии SNAPIN. (C, D) Образование клона показало, что сверхэкспрессия SNAPIN индуцирует пролиферацию β-клеток. (E) Клетки окрашивали окрашиванием PI. Собирали прикрепленные клетки и проводили анализ клеточного цикла с помощью проточной цитометрии. Сверхэкспрессия SNAPIN увеличивала популяцию клеток в S-фазе. (F) Уровни экспрессии белков CyclinD1, CDK2 и CDK4 проверяли вестерн-блоттингом с указанными антителами. (G) Нормализованные гистограммы белка снапина против актина с использованием программного обеспечения для визуализации. * P <0,05, ** P <0,01, **** P <0,0001.

    Наши данные MS показали обогащение SNAPIN и его взаимодействующими белками, которые, как известно, регулируют клеточный цикл. Чтобы предоставить прямые доказательства того, что SNAPIN регулирует клеточный цикл, мы трансфицировали клетки Min6 лентивирусом для количественного определения содержания клеточной ДНК с помощью проточной цитометрии ().По сравнению с контрольной группой сверхэкспрессия SNAPIN привела к увеличению популяции клеток в S-фазе с 6,85% до 27,13%. Мы оценили β-клетки на предмет экспрессии CDK2, CDK4 и CCND1, которые отмечают фазу S клеточного цикла. Все экспрессии CDK2, CDK4 и CCND1 были активированы ( ) . Наши результаты показали, что сверхэкспрессия SNAPIN может способствовать пролиферации β-клеток.

    SNAPIN Knockdown ингибирует пролиферацию β-клеток

    КшРНК лентивируса для подавления SNAPIN и трансфицированные клетки Min6 лентивирусом в течение 24 часов.MTS-анализ применялся для определения разновидности клеток. Мы наблюдали значительное снижение содержания белка SNAPIN в обработанных лентивирусом клетках Min6 с помощью Вестерн-блоттинга (). Нокдаун SNAPIN ингибировал пролиферацию β-клеток ( ) и ингибировал образование клона клеток Min6 по сравнению с контрольной группой (). показывает статистику клона. Клеточная фотография также показала, что нокдаун SNAPIN может вызвать гибель клеток Min6 ().

    Нокдаун SNAPIN подавляет пролиферацию β-клеток. (A) Мышиные клетки Min6 трансдуцировали лентивирусом, экспрессирующим кшРНК и неспецифические последовательности. Значительное снижение белка SNAPIN по данным вестерн-блоттинга. Анализ (B) MTS показал, что пролиферация клеток Min6 ингибировалась после нокдауна SNAPIN. (C) Click-iT ™ EdU Proliferation Assay показал, что пролиферация клеток Min6 ингибировалась после нокдауна SNAPIN. (D) Статистика интенсивности флуоресценции при 585 нм. (E) Образование клона показало, что нокдаун SNAPIN ингибирует пролиферацию β-клеток. (F) Статистика образования клонов. (G) Клеточная фотография показывает, что клетки Min6 погибают в результате нокдауна SNAPIN. (H) Клетки окрашивали окрашиванием PI. Собирали прикрепленные клетки и проводили анализ клеточного цикла с помощью проточной цитометрии. Нокдаун SNAPIN приводил к снижению популяции клеток в S-фазе. (I) Уровни экспрессии белков CyclinD1, CDK2 и CDK4 проверяли вестерн-блоттингом с указанными антителами. (J) Нормализованные гистограммы белка снапина против актина с использованием программного обеспечения для визуализации. * P <0,05, ** P <0,01, *** P <0,001, **** P <0,0001.

    Мы также количественно определили содержание клеточной ДНК с помощью проточной цитометрии ( ) . По сравнению с контрольной группой, нокдаун SNAPIN привел к снижению популяции клеток в S-фазе с 47% до 40% и 42,25%. Мы оценили β-клетки на предмет экспрессии CDK2, CDK4 и CCND1, что отмечает фазу G1 / S клеточного цикла. Выражения CDK2, CDK4 и CCND1 подавлялись ( ) .Click-iT ™ EdU Proliferation Assay измеряет пролиферацию β-клеток (). статистика интенсивности флуоресценции на длине волны 585 нм (). Наши результаты показали, что нокдаун SNAPIN может ингибировать пролиферацию β-клеток.

    SNAPIN Knockdown индуцирует апоптоз β-клеток

    Апоптоз — это особый способ запрограммированной гибели клеток (43). Неправильный апоптоз может вызывать множество заболеваний, поэтому регулирование апоптоза имеет большой терапевтический потенциал (44). Как субстрат каспазы 3, PARP расщепляется во время инициации программы апоптоза (45).Итак, расщепленный PARP — это сигнатурный белок апоптоза. Чтобы изучить влияние SNAPIN на апоптоз β-клеток, мы использовали shRNA, чтобы препятствовать экспрессии SNAPIN, и детектировали апоптоз клеток на основе окрашивания аннексином V-FITC / PI. Доля апоптотических клеток в контрольной группе составляла 10,32%, а доля апоптотических клеток после интерференции SNAPIN составляла 50,1% ( ) . Этот результат показал, что вмешательство в экспрессию SNAPIN индуцировало апоптоз клеток. мы также проанализировали уровень экспрессии PARP и SNAPIN ( ) .

    Нокдаун SNAPIN вызывает апоптоз β-клеток. (A) Анализ апоптоза показывает, что апоптоз β-клеток индуцировался после нокдауна SNAPIN. (B) Статистика для FITC и PI апоптотических β-клеток. (C) Мышиные клетки Min6 трансдуцировали лентивирусом, экспрессирующим shРНК и неспецифические последовательности. Значительное снижение экспрессии SNAPIN. (D) Нокдаун SNAPIN индуцировал расщепление PARP апоптотического маркерного белка. **** P <0,0001.

    SNAPIN Knockdown Inhibit Insulin Уровень белка / мРНК

    Для того, чтобы оценить влияние SNAPIN на уровень мРНК инсулина, мы использовали shRNA для подавления SNAPIN и трансфицировали клетки Min6 лентивирусом в течение 24 часов.Мы наблюдали значительное снижение количества мРНК SNAPIN в клетках Min6, обработанных лентивирусом, с помощью анализа QPCR (). Полученные инсулином INS1 и INS2 ингибировались после нокдауна SNAPIN ( ) . Мы также трансфицировали клетки Min6 лентивирусом для количественного определения уровня мРНК инсулина. Мы наблюдали увеличение количества мРНК SNAPIN в клетках Min6, обработанных лентивирусом, с помощью анализа QPCR (), а инсулин показал лишь небольшое увеличение ( ) .

    SNAPIN влияет на мРНК инсулина и уровни белка. (A) Эффективность нокдауна SNAPIN в β-клетках. (B, C) Нокдаун SNAPIN подавляет экспрессию мРНК инсулина в β-клетках. (D) Эффективность сверхэкспрессии SNAPIN в β-клетках. (E, F) Сверхэкспрессия SNAPIN увеличивала экспрессию мРНК инсулина в β-клетках. QPCR выполняли для измерения экспрессии мРНК инсулина. Данные представлены в виде среднего значения ± стандартное отклонение, n = 3. (G) Нокдаун SNAPIN подавляет экспрессию белка инсулина в клетках INS1. Вызванная глюкозой секреция инсулина, измеренная с помощью ELISA. (H) Нокдаун SNAPIN подавляет экспрессию белка инсулина в клетках Min6. Клетки INS1 трансдуцировали лентивирусом, экспрессирующим shRNA, который давал GFP. Вектор был Psicor-GFP. Уровни экспрессии белка инсулина измеряли с помощью иммунофлуоресценции. Ядра метили DAPI (синий) (4ʹ, 6-диамидино-2-фенилиндол), белок инсулина метили Alesa Fluor 643 (красный), а shSNAPIN метили GFP (желтовато-зеленый). ** P <0,01, **** P <0,0001.

    Клетки Min6 обрабатывали двумя shРНК для вмешательства в SNAPIN.Секрецию инсулина, индуцированную глюкозой, измеряли с помощью ELISA. Клетки Min6 стимулировали растворами глюкозы 2,8 ммоль / л и 16,7 ммоль / л в течение 2 часов, и супернатант собирали для определения содержания инсулина. После вмешательства SNAPIN экспрессия инсулина снижалась (). Затем мы обработали клетки INS1 двумя shРНК, чтобы вмешаться в SNAPIN, и детектировали инсулин с помощью иммунофлуоресценции. SNAPIN визуализировали с помощью GFP, а инсулин визуализировали с использованием антиинсулиновых антител в сочетании с козьим антимышиным cy3. Секреция инсулина снижалась при отключении SNAPIN ().

    Обсуждение

    Сахарный диабет — очень распространенное нарушение обмена веществ, его острые и хронические осложнения серьезно влияют на здоровье человека (46). Β-клетки поджелудочной железы — единственные клетки, которые могут вырабатывать инсулин в организме человека. Когда β-клетки становятся дисфункциональными, организм не может производить достаточно инсулина для поддержания стабильности глюкозы в крови, и длительная гипергликемия организма вызывает множественную дисфункцию органов (47). Скорость репликации β-клеток очень низкая, и ученые пытались вызвать дифференцировку β-клеток из клеток-предшественников, стволовых клеток или из других линий островковых клеток, но клинический прогресс все еще очень затруднен.Многие ученые пытаются идентифицировать небольшие молекулы или биомакромолекулы, которые могут побуждать β-клетки к саморепликации. Однако не существует эффективного лекарства, которое могло бы эффективно индуцировать репликацию β-клеток. Поэтому важно найти новые терапевтические цели и новые терапевтические методы лечения диабета.

    Первоначально сообщалось, что

    SNAPIN является белком, связанным с SNAP25, который в основном взаимодействует с комплексами SNARE для транспорта везикул и регуляции секреции инсулина (29). Мы сравнили аминокислотные последовательности SNAPIN у людей, мышей и крыс, и SNAPIN является высококонсервативным и гомологичным, что позволяет предположить, что SNAPIN выполняет очень согласованные биологические функции у людей, мышей и крыс.Мы извлекали различные ткани мышей разного возраста. SNAPIN был в изобилии в поджелудочной железе, и его экспрессия увеличивается с возрастом мышей, что может указывать на то, что SNAPIN связан с развитием поджелудочной железы. Однако необходимы дополнительные эксперименты, чтобы подтвердить это, мы можем извлечь островки мышей разного гестационного возраста, чтобы вмешиваться или сверхэкспрессировать SNAPIN, чтобы исследовать функцию SNAPIN в развитии островков. SNAPIN значительно коррелирует с геном TMEM27, который кодирует мембранный белок, который расщепляется и выделяется β-клетками поджелудочной железы, и этот белок был предложен в качестве биомаркера качества β-клеток (33).Это предполагает, что SNAPIN также может быть биомаркером β-клеток.

    Кроме того, мы использовали SNAPIN в качестве приманки для поиска взаимодействующих с SNAPIN белков, и были обогащены различные белковые комплексы, включая BLOC1, BORC, Arp2 / 3, Dynactin Complex.Snap23, Snap47 и другие члены семейства SNAP, описанные в статье, которые взаимодействуют с SNAPIN. Мы проверяем наши результаты, используя Bloc1s1 в качестве положительного контроля. Белки с высокими оценками были проанализированы с помощью Metascope и дополнительно обогащены путем BO / KEGG. Мы обогатили BLOC1 / BORC, который является членом семейства SNAPIN, и клеточный цикл и процессинг белка в эндоплазматическом ретикулуме и т. Д. Могут дополнительно изучить механизм.По результатам обогащения KEGG мы обнаружили изменения в основных белках пути UPR. Результаты нашего эксперимента показывают, что SNAPIN влияет на клеточный цикл Min6 и уровень маркеров клеточного цикла. Мы продолжим изучать, регулирует ли SNAPIN пролиферацию β-клеток, взаимодействуя с белком, связанным с клеточным циклом, в последующих исследованиях.

    Как единственный глюкозоснижающий гормон в организме, инсулин также может способствовать росту тела (48). Наше исследование показывает, что SNAPIN может способствовать секреции инсулина, что согласуется с другими сообщениями (25).Мы обнаружили, что SNAPIN способствует росту β-клеток, и еще предстоит выяснить, является ли этот эффект стимулирования роста за счет SNAPIN или из-за увеличения секреции инсулина.

    В заключение мы показали, что сверхэкспрессия SNAPIN достаточна для индукции пролиферации β-клеток. Поэтому мы можем попытаться разработать агонисты для последовательности SNAPIN в качестве нового средства лечения диабета. Это огромная проблема, но она может дать новые стратегии лечения диабета. В более широкой перспективе сверхэкспрессия SNAPIN, способствующая пролиферации клеток, может открыть новое направление исследований в области регенерации тканей.

    Наконец, важно подчеркнуть, что существует множество способов лечения, помимо пролиферации В-клеток. Например, многие из путей, активирующих пролиферацию, также активируют пути выживания, что является еще одной важной терапевтической целью. Кроме того, экспансия β-клеток может быть достигнута с помощью других подходов, в частности, повторной дифференцировки β-клеток и транс-дифференцировки от α- или d-клеток к β-клеткам (49, 50). Конечно, создание новых β-клеток также требует эффективного решения проблемы аутоиммунитета.Все это важные, плодородные и активные области терапевтических исследований β-клеток.

    Влияет ли изменение температуры на успеваемость в школе?

    За последние несколько недель произошло резкое падение температуры. Снижение температуры и увеличение количества экзаменов заставили меня вспомнить утверждение, о котором я слышал много лет назад: температура влияет на успеваемость. Если мы сначала подумаем об этом, это может показаться странной корреляцией, но что, если это правда? Может быть, холод влияет на наши экзамены.Я думаю, это интересная тема для изучения.

    В одном исследовании, связанном с этой темой, тест был дан девятиклассникам, которые были разделены в шести разных классах. Комнату либо нагревали горячими плитами вокруг нее, либо охлаждали раковины со льдом. Исследователи сравнили результаты тестов тех студентов, которые прошли тест при разных температурах, чтобы прийти к заключению. Однако результаты первого испытания не были значительными. После некоторых обсуждений возможных ошибок была проведена вторая попытка увеличения разницы температур в комнате.Результаты второго испытания показали, что температура действительно влияет на успеваемость, но не была достаточно сильной, чтобы показать, насколько сильна корреляция между двумя переменными.

    Чтобы сделать исследование достаточно ясным, я проанализировал гистограммы двух исследований, представленных ниже, и перечислил некоторые из своих мыслей:

    Этот график представляет собой первоначальный сбор данных из первого испытания в исследовании. Разница температур была всего около 2 ℉, что не имело большого значения.На мой взгляд, изменения оценок в этом испытании не были достаточно заметными, чтобы прийти к заключению, поэтому различия могут быть вызваны изменением, приводящим к ложноотрицательному или правильному решению. Чтобы убедиться, что результат действительно работает. Второе испытание проводилось с некоторыми корректировками температуры.

    Это результат второго испытания, на этот раз была применена большая разница температур (около 10 ℉). Судя по результатам тестов, показанным на графике, мы можем сказать, что и холодная, и теплая температура плохо сказываются на результатах.

    Однако такой вывод был основан только на одном испытании исследования. Хотя второе испытание выявило очень отчетливую тенденцию в поддержку корреляции между температурой и результатами исследования, я не думаю, что данные достаточно убедительны. Для подтверждения корреляции необходимы дополнительные исследования.

    Другое исследование было основано на одинарном слепом перекрестном эксперименте на двух классах учащихся 10-12 лет. Температуру манипулировали в течение недели, в то время как в течение этого периода студентам давались два задания с цифрами и два задания по языку.Исследование пришло к выводу, что производительность в целом улучшилась, когда температура снизилась до 68 ℉, а скорость подачи наружного воздуха увеличилась до 9,6 л / с. Это означает, что ученик успели лучше учиться в нейтральной окружающей среде.

    В обоих исследованиях сделан вывод о том, что температура влияет на успеваемость, но я думаю, что следует беспокоиться о других вещах:

    1. Возрастные группы участников обоих исследований слишком специфичны. Большинство из них — ученики средней школы.Может быть, студенты колледжа выступили бы по-другому? Так что я думаю, что следует проводить больше исследований по другим возрастным группам.
    2. Население слишком мало. Данные слишком малы, чтобы представить население в целом.
    3. Может быть, студенты из тропических регионов выступят по-другому. Я думаю, что необходимо проводить больше исследований со студентами из других областей и стран.

    В целом, я думаю, что эти два исследования являются хорошей отправной точкой. Для дальнейшего обсуждения этой корреляции требуется метаанализ.Поскольку это не сложное экспериментально спланированное исследование, на эту тему можно было бы провести больше исследований, следовательно, возникнет дальнейшее обсуждение этой корреляции.

    Все, что вы хотели знать о зеленом чае в Японии

    Несмотря на то, что суши и рамен могут доминировать в разговоре о японской кухне, зеленый чай нельзя игнорировать.

    Азиатские чаи, особенно зеленый чай матча, переживают свое время за границей, поэтому не будет ничего удивительного, если вы уже попробовали несколько сортов.

    Распространенное заблуждение состоит в том, что зеленый чай, также как ча или оча, можно сочетать только с суши или японскими сладостями, известными как вагаси. Однако загляните в любой местный японский ресторан, и вы обнаружите, что чаще всего, помимо стандартного ошибори (мокрого полотенца), официант также приносит зеленый чай на стол.

    В японских домах зеленый чай также служит важным средством встречи гостей и создания уютной атмосферы. Чайная церемония в Японии — признанный культурный символ, который основан на формальном акте встречи гостей с зеленым чаем.Но сегодня даже случайные встречи с японскими друзьями часто включают освежающий горячий или холодный зеленый чай, в зависимости от сезона.

    Несмотря на то, что потребление зеленого чая немного снизилось (из-за тенденции к производству пузырькового чая и появления новых безалкогольных напитков), оно все еще остается сильным. В 2016 году Япония произвела 77 100 тонн чая, из которых 97 процентов составляет зеленый чай.
    Что выделяет зеленый чай среди бесчисленных напитков, доступных в Японии? По словам Хитоми Накадзима, управляющего директора Japan Tea Central Public Interest Incorporated Association, зеленый чай обладает тремя особыми характеристиками.

    UMAMI
    «Во-первых, зеленый чай сам по себе имеет« умами »или пикантный и насыщенный вкус, в отличие от других чаев и напитков, — сказал Накадзима. «Уникальный ароматизатор создан на основе кислоты, и он дает сложный, глубокий вкус без добавления сахара, соли или каких-либо других приправ».

    Итак, в то время как британский черный чай часто пьют подслащенный и со сливками, зеленый чай обычно пьют как есть.

    Кроме того, заваривание одного и того же чайного листа два или три раза позволяет вам насладиться изменяющимся вкусом умами.

    Однажды во время поездки в Камакура я зашел в традиционную чайную, чтобы выпить зеленого чая и сладостей. Сотрудник рекомендовал снова заварить чайные листья после того, как попробовал начальную заварку. «Первая сервировка чая и вторая имеют совершенно другой вкус и аромат», — я помню, как она сказала.

    Когда я попробовал, как она предложила, вторая наливка была более гладкой с более мягким ароматом по сравнению с кисло-сладкой насыщенностью первого напитка. Сам того не осознавая, она познакомила меня с эволюцией умами зеленого чая.

    ПОЛЬЗА ДЛЯ ЗДОРОВЬЯ
    Вторая характеристика зеленого чая, по словам Накадзимы, — это его многочисленные преимущества для здоровья. «Поскольку зеленый чай не подвергался ферментации и содержит исходные питательные вещества неизмененных чайных листьев, он по-разному влияет на ваше здоровье», — сказал Накадзима.

    В 9 веке зеленый чай впервые был завезен из Китая для использования в медицине в Японию. По словам Накадзимы, зеленый чай содержит кофеин, катехин и другие витамины и антиоксиданты, которые помогают буддийским монахам сохранять бдительность во время медитации дзэн и изучения сутры.

    Напиток для монахов и аристократов стал основным продуктом питания в японских домах, когда Нагатани Соуэн, чайный фермер из Киото, создал сенчу, обработанный и высушенный зеленый чай, что сделало его недорогим и доступным для всех. Сегодня более 60 процентов всего чайного продукта Японии — это сенча.

    АРТ ФОРМА
    Третьей характеристикой зеленого чая является его употребление в порошкообразной форме. Сегодня матча используют в напитках, латте и десертах, включая мороженое.Он также является центральным элементом известного японского обычая — чайной церемонии. Этот ритуал включает чай матча, японские сладости, а участники часто носят кимоно. Подробнее об этой церемонии позже.

    «Матча позволил нам развить искусство традиционной чайной церемонии, а в наши дни он придает особый чудесный вкус различным напиткам и сладостям», — добавил Накадзима.

    [email protected]

    Зеленый чай — суперпродукт

    Зеленый чай не только освежающий напиток, который можно выпить во время отдыха с друзьями или в тишине, он считается суперпродуктом многими экспертами в области здравоохранения.

    По данным Японской чайной ассоциации центральных общественных интересов, одна чашка чая (около 4 унций) содержит около 30-50 миллиграммов кофеина, 70-120 миллиграммов катехина и 10 миллиграммов витамина С, а также другие питательные вещества, такие как теанин, кальций, магний, железо, бета-каротин, витамин Е, хлорофилл, белок и пищевые волокна.

    Так же, как кофе и черный чай, кофеин в зеленом чае имеет пробуждающий эффект, который помогает нам сохранять бодрость и бодрствовать, снимая усталость.Также говорят, что он помогает сжигать жир и улучшать кровообращение.

    Катехин ограничивает всасывание глюкозы, поддерживая низкое кровяное давление и, как считается, предотвращает ожирение. Катехин также обладает стерилизующим эффектом, поэтому в Японии можно увидеть, как люди используют его для полоскания рта после еды, чтобы убить бактерии и предотвратить кариес.

    Теанин — вещество, уникальное для зеленого чая. Он воздействует на клетки мозга и дает расслабляющий и лечебный эффект. Еще одним дополнительным преимуществом является количество витамина С в зеленом чае, который придает ему антиоксидантный эффект, который мы хотим помочь предотвратить простуду и повысить иммунитет.

    Достаточно честно. Теперь вы знаете, почему зеленый чай называют суперпродуктом, не так ли? Давайте пить его ежедневно и поправим здоровье!

    Где это достать

    Сегодня зеленый чай доступен по всей стране. Вы можете купить листья зеленого чая практически в любом супермаркете, универмаге и магазинах по цене от 1000 до 1500 иен (9-13,50 долларов США) за 100 грамм или 3,5 унции.
    Хотя вы можете купить зеленый чай где угодно, Накадзима рекомендует поискать специализированный чайный магазин, так как в нем обычно есть сотрудники, хорошо разбирающиеся в чайных фактах, и они могут помочь вам найти вашу идеальную чашку.

    Поскольку чайные листья — это свежий продукт, лучше покупать их небольшими партиями и хранить дома в холодильнике. Зеленый чай нужно употреблять в течение месяца после покупки.

    Разница между чаями

    Зеленый, черный чай и чай улун — все по-разному на вкус, но знаете ли вы, что они сделаны из одного и того же чайного куста? Единственная разница заключается в том, как обрабатываются собранные листья, ферментируются ли они и как долго. Зеленый чай не ферментируют, а готовят на пару.Черный чай подвергается глубокой ферментации, в то время как улун подвергается легкой ферментации во время производства.

    Еще больше усложняет ситуацию то, что зеленый чай доступен во многих различных вариантах:
    — Сенча (приготовленный на пару) — это самая популярная и наиболее распространенная форма зеленого чая. После обработки паром и охлаждения чайные листья мнутся и сушатся перед упаковкой.
    — Банча (низкокачественный приготовленный на пару чай) — Несмотря на то, что у него такой же процесс пропаривания и сушки, как и у сенча, банча является более грубым чаем, потому что он состоит из листьев, собранных после сбора урожая сенча.Несмотря на то, что банча считается чаем более низкого качества, многие региональные вариации и различные методы производства делают чай популярным среди любителей чая.
    — Гёкуро — Этот сорт состоит из листьев растений, выращенных под навесом за три недели до сбора урожая. Гёкуро обладает сладким глубоким вкусом и считается элитным чаем.
    — Ходзича (жареный чай) — Для этой чашки листья зеленого чая обжариваются на сильном огне и традиционно на специальной сковороде, называемой хуроку.Благодаря этой обжарке цвет чая меняется на красивый золотисто-коричневый и приобретает свежий аромат и вкус.
    — Тенча — Как и гёкуро, чай тенча готовят из листьев растений, выращенных в тени тростниковых ширм за четыре недели до сбора урожая. Однако, в отличие от гёкуро, тенча готовится на пару без мяки листьев.
    — Матча (порошкообразный чай) — Известная и популярная форма зеленого чая, матча состоит из листьев тенча, которые обрабатываются паром, сушатся, а затем измельчаются с помощью каменной мельницы до мелкого порошка.Этот чай используется во время традиционной чайной церемонии, а также придает неповторимый вкус различным сладостям и напиткам.
    — Genmaicha — Этот чай изготавливается путем смешивания жареного риса с зеленым чаем сенча или банча. Благодаря приятному аромату жареного и маслянистому вкусу чай пользуется популярностью во всем мире.

    — Источник: Ассоциация инструкторов Нихонча

    Почему чай горький

    Зеленый чай может показаться слишком горьким, чтобы его оценить. Такое впечатление могут произвести катехин и кофеин в чае.Однако оба они известны своей пользой для здоровья, включая профилактику заболеваний.

    Итак, как нам смягчить горечь?

    Добавление прохладной некипяченой воды помогает заваривать сладкий вкусный чай. И кофеин, и катехин легче растворяются в горячей воде, поэтому более горячий чай становится горьким, поскольку он содержит больше этих веществ. Если вы хотите смягчить горечь, обязательно заваривайте чай при более низкой температуре, чтобы уменьшить экстракцию чая, сохранив при этом вкус и аромат умами.

    Смешивание матча

    Как упоминал Накадзима, маття любят многие люди во всем мире, и его используют для приготовления различных блюд и сладостей.

    Сладости и напитки из матча

    • Ролл маття
    • Печенье матча
    • Попкорн матча
    • Macha Pokkie
    • Чизкейк Матча
    • Шоколад матча
    • Орехи матча
    • Пудинг Матча
    • Матча латте
    • Молоко матча

    Элегантная чайная церемония «Чаною»

    Маття является популярным вкусом, но является центральным элементом традиционной чайной церемонии.

    Чайная церемония, известная как чаною, возникла в Китае, но была разработана и усовершенствована в Японии 16 века. Церемония объединяет философию дзен и уникальную эстетику «ваби», где искусство — это гармония, простота и спокойствие.

    По словам Накадзимы, «ва-кей-сэй-дзаку» — это четыре слова, обозначающие искусство чайной церемонии. («Ва» означает спокойствие, «кей» означает почтение к гостю, «сэй» означает чистоту и чистоту, а «дзаку» означает спокойствие).

    «Короче говоря, ритуальное искусство чайной церемонии показывает, как вы приветствуете гостей, заваривая и подавая чашку чая матча», — сказал он.

    В музеях и на различных мероприятиях есть много возможностей поучаствовать в традиционной чайной церемонии, так что не упустите возможность попробовать ее на себе!

    Как производить зеленый чай

    1. Сбор чайных листьев в поле
    2. Приготовление листьев на пару
    3. Сушка и измельчение чайных листьев
    4. Расположение листьев по размеру
    5. Полностью высушить листья

    Как заваривать вкусный чай

    Заваривание собственной чашки может показаться устрашающим, особенно если вы думаете, что должны быть экспертом после прочтения описания Накадзимы.Не волнуйтесь, это просто!

    При заваривании помните, что насыщенность и сладость можно регулировать в зависимости от соотношения чая к воде и продолжительности заваривания.

    • Для получения более сладкого и насыщенного чая используйте больше чайных листьев и заваривайте его в теплой воде, не доводя до кипения.
    • Для получения более мягкой и сбалансированной чашки используйте меньше чая и заваривайте в теплой воде.
    • Если вы не против горечи, но хотите сделать ее мягкой, то примените кипяченую воду и настаивайте заварку всего на несколько секунд.
    • Помните: чем дольше заваривается, тем крепче чай.

    Ниже приводится способ заваривания, рекомендованный Ассоциацией инструкторов Nihoncha. Сначала попробуйте, а затем отрегулируйте температуру воды и время заваривания, чтобы придать ему свой любимый вкус.

    1. Приготовьте чашки и чайник.
    2. Залейте все чашки кипяченой водой. (4 унции на чашку)
    3. Положите заварку в чайник. (Для трех человек: около 9-10 грамм)
    4. Когда кипяченая вода в чайных чашках остынет примерно до 70–80 градусов Цельсия, налейте воду в чайник поверх чайных листьев.
    5. Подождите одну-две минуты, чтобы чайные листья настоялись. В то время как первая заварка занимает одну или две минуты, вторая — всего около 30 секунд.
    6. Налейте чай в чашки. Не наполняйте чашки чаем за один раз. Вместо этого налейте небольшое количество в каждую чашку, а затем продолжайте добавлять, пока все чашки не будут заполнены, потому что это обеспечит распределение насыщенности и сладости по всем чашкам.

    Чайные приборы
    A: (Юноми) Чаван — чашка для чая
    B: Кюусу — чайник
    C: Чазуцу — чайная банка
    D: Юсамаси — чаша для охлаждения кипяченой воды
    E: Chasaji — чайная ложка
    F: Chataku — блюдце для чашки

    Традиционные сладости и зеленый чай

    Попробуйте эти традиционные вагаси (традиционные японские сладости) и Рюкюкаси (традиционные окинавские сладости), которые хорошо сочетаются с зеленым чаем.

    Вагаси (материковая часть Японии)

    Dango — Сладкие клецки разных цветов, приготовленные из злаков и риса. Для придания аромата часто используют соевый соус и пасту из сладких бобов. Добавление сахара к хорошо растерзанному данго может сохранить его надолго.

    Monaka — Вафля, наполненная пастой из бобов адзуки. Пасту можно приготовить из семян кунжута, каштанов или риса. Большинство вафель имеют квадратную форму.


    Senbei — Японские рисовые крекеры различных форм, размеров и вкусов, которые обычно запекают или жарят на углях. Типичный сенбэй приправлен соевым соусом, мирином и обернут слоем морских водорослей. Есть также сенбэй со вкусом соли и сахара.

    Рюкюкаси (Окинава)
    Чинсуко — Окинавское печенье, появившееся во времена династии Рюкю. Его делают из пшеничной муки, сахара и сала. Чинсуко — одна из самых важных традиционных сладостей на Окинаве.


    ЧиИрунко — Чирунко, часто называемый «окинавским касутера», представляет собой ярко окрашенный пирог, приготовленный на пару, покрытый небольшим количеством арахиса, окрашенного в красный цвет с кожурой цитрусовых, сваренных в сахарном сиропе. Рецепт включает большое количество яиц, которых было мало и поэтому они высоко ценились во времена династии Рюкю.
    Говорят, что этот торт ели только знать.
    Senjuko — Красивый торт в форме лотоса с выпечкой снаружи, наполненный смесью кунжутного и арахисового масла и освежающе ароматным


    Киппан — Традиционная окинавская сладость, приготовленная путем варки смеси местных цитрусовых и сахарного сиропа до образования жевательной текстуры моти.Обычно эту сладость присыпают белой сахарной пудрой.
    Hanabo-ru — Печенье из пшеничной муки и яичного желтка в форме цветка глицинии. Этот Рюкюкаши требует умелых приемов опытного шеф-повара-кондитера. Португальцы завезли эту сладость в континентальную Японию в 1600-х годах, а позже она была завезена на Окинаву.

    — Источник: Масаэ Аракаки из Аракаки Кашитен

    Музеи для посещения

    Если вы хотите узнать больше о чае или посетить чайную церемонию, посетите музеи, расположенные ниже.

    Fujinokuni Chanomiyako Museum
    В этом музее собрано множество информации о чае, здесь проводятся чайные церемонии, демонстрации заваривания и измельчения чайных листьев.
    Расположение: 3053-2 Канаяфудзимичо, город Симада, преф. Сидзуока. (1 час 40 минут езды от лагеря Фудзи)
    Часы работы: среда — пн, 9:00 — 17:00
    Вход: 300 иен; Студенты колледжа и младше 70 лет и старше: бесплатно
    URL: https: // tea-museum.jp /
    Тел .: 0547-46-5588

    Городской музей Ирумы ALIT (Музей чая)
    Город Ирума славится своим местным чаем Саяма. В музее представлены несколько чайных домиков, приспособления для выращивания чая, сотни панелей, объясняющих зеленый чай.
    Расположение: 100 Nihongi, Iruma City, Saitama Pref. (20 минут езды от Yokota AB)
    Часы работы: Вт — Вс, 9:00 — 17:00
    Вход: взрослый: 200 иен; учащиеся средней школы и колледжа: 100 иен; Учащиеся средней и начальной школы: 50 йен
    URL: http: // www.alit.city.iruma.saitama.jp/
    Тел .: 04-2934-7711

    Для получения дополнительной информации о японском чае и его культуре:

    Japan Tea Central Public Interest Incorporated Association
    Расположение: 2-8-5 [5F] Higashi Shimbashi, Minato-ku, Tokyo
    URL: www.nihon-cha.or.jp/
    Facebook: @ nihoncha.public
    Тел .: 03-3434-2001

    Окинавцы сохраняют прохладу с Санпин ча

    Shoji Kudaka, Stripes Japan

    Заваривая зеленый чай дома или наслаждаясь красивой чашкой в ​​чайном домике в Японии, магазины и супермаркеты предлагают гораздо более удобный вариант в бутылочной форме.

    Быстрый просмотр предложений в вашем местном магазине покажет вам, сколько разновидностей брендов и вкусов доступно для потребителей. На Окинаве в разделе напитков доминирует еще один сорт — санпин ча, или жасминовый чай.

    История Санпин Ча восходит к королевству Рюкю (1429–1879).

    По словам Цутому Суги, обозревателя, автора нескольких статей об истории чая, название «Санпин» происходит от китайского слова «香片 (xiāngpiàn)», обозначающего жасминовый чай.Шуга считает, что жасминовый чай раньше считался фирменным продуктом Фучжоу, Китай. По словам Шуги, учитывая тот факт, что у королевства Рюкю был форпост в этом портовом городе на восточном побережье Китая, жасминовый чай, скорее всего, был доставлен в Рюкю оттуда. Ей пришлось подождать, пока не закончится конец королевства, чтобы достичь всех жителей Рюкю, а не только знати.

    Сегодня его подают в ресторанах и наряду с другими сортами чая в магазинах. По словам Шуги, санпин ча может быть либо полностью ферментированным, как это было в Фучжоу, либо полуферментированным, как на Тайване, либо даже зеленым чаем с ароматом жасмина, импортированным из Китая.

    Мне нравится жасминовый чай как освежающий и восстанавливающий силы напиток. На вкус он немного мягче, чем чай улун, с тонкой горчинкой и отчетливым ароматом, который одновременно расслабляет и пробуждает ваши чувства.

    И этот чай напоминает мне о посещении дедушкой и бабушкой дома в детстве. Его с Сата Андаги (окинавский пончик) или Курозату (черный сахар) все еще вызывает воспоминания о былых временах.

    Чаепитие с местными сладостями по-прежнему довольно популярно, но вы также найдете новые сочетания, такие как коктейль санпин-ча-вари, в котором санпин ча смешивается с окинавским ликером Авамори.

    Согласно книге «Ча то Рюкю-дзин (чай и люди Рюкю)» Коичи Такеи, еще одним популярным чаем во времена королевства Рюкю был Кума ча, зеленый чай, собранный в префектуре Кумамото (тогда известный как Хиго). Автор отмечает сходство между сильным ароматом Кума-ча и ароматом санпин-ча, в том числе то, как сильный аромат привлекал жителей Рюкю, чтобы выпить и то, и другое жарким летом субтропического острова.

    Санпин ча остается частью этой стратегии сохранения прохлады жарким окинавским летом.Что касается меня, запах и вкус одновременно освежают меня и напоминают мне о прошлом.

    [email protected]

    ПРОДЛЕНИЕ СРОКА ХРАНЕНИЯ КАРТОФЕЛЬНЫХ ПОЛУФАБРИКОВ С ПОМОЩЬЮ НАТУРАЛЬНЫХ КОНСЕРВАНТОВ

    СанПиН 2.3.2.1324-03 Гигиенические требования к срокам годности и условиям хранения пищевых продуктов [СанПиН 2.3.2.1324-03 Гигиенические требования к срокам годности и условиям хранения пищевых продуктов]

    ГОСТ Р 31986-2012 Услуги общественного питания.Метод органолептической оценки качества продукции общественного питания [ГОСТ Р 31986-2012 Услуги общественного питания. Методика органолептической оценки качества продуктов общественного питания]

    МУК 4.2.187-04 Методические указания. Санитарно-эпидемиологическая оценка обоснования сроков годности и условий хранения пищевых продуктов [МУК 4.2.187-04 Методические указания. Санитарно-эпидемиологическая экспертиза обоснования сроков годности и условий хранения пищевых продуктов

    Богатырева Т.Технология пищевых продуктов с длительным сроком хранения / Богатырева Т.В. — Спб: -Profession.-2013-184с. [на русском]

    Джеймс М. Современная пищевая микробиология / Джеймс М. — М: Бином. Лаборатория знаний-2011г.-866с. [на русском]

    Ловачева Г.Н. Стандартизация и контроль качества продукции.- М: Экономика, 1990-230 с., С. 43-58; С. 114-119. [на русском]

    Люк Эрих. Консерванты пищевой промышленности / Люк Эрих. — Спб, 2003. — 255с. [на русском]

    Сикхна Н.К. Настольная книга производителя и переработчика плодовоовощной продукции / Сихна Н.К. Пер. с английского. — СПб: Профессия — 2014, 912с. [на русском]

    Цена, Вт.E. Роль воскового кожного слоя в потере влаги во время обезвоживания чернослива / Price, W.E., Sabarez, H.T., Storey, R. et al. // J. Agric. Food Chem. 48 (9), 2000, 4193–4198, DOI: https://doi.org/10.1021/jf9

    i. PubMed

    Тао, Ю. Нейро-нечеткое моделирование для прогнозирования физико-химических и микробиологических параметров частично сушеных помидоров черри во время хранения: влияние на активность воды, температуру и время хранения [Электронный ресурс] / Тао, Ю., Ли, Й., Чжоу, Р. . и другие.// J Food Sci Technol 53 (10), 2016, 3685–3694, — URL: https://pubmed.ncbi.nlm.nih.gov/28017983/ (дата обращения: 12.02.2021)

    Вишванатан, К.Х. Инфракрасное сухое бланширование и гибридная сушка моркови / Вишванатан, К.Х., Гивари, Г.К., и Хеббар, Х.У // Food Bioprod. Процесс. 91 (2), 89–94, 2013, DOI: https://doi.org/10.1016/j.fbp.2012.11.004.

    Микроклимат в доме: параметры, требования и контроль

    Что такое микроклимат

    Существует межгосударственный стандарт ГОСТ 30494-2011, который устанавливает требования к микроклимату общественных и жилых зданий.Этот ГОСТ определяет микроклимат помещения как «состояние внутренней среды помещения, оказывающее влияние на человека». Внутренняя среда — это, в большинстве случаев, воздух внутри помещения. Неудивительно далее уточнение, что микроклимат помещения характеризуется в основном температурой, влажностью и подвижностью воздуха.

    Фактически микроклимат оказывает непосредственное влияние на человека. Если он хороший («оптимальный», как выражается строгий ГОСТ), то человек испытывает чувство комфорта, а организм не тратит силы на приспособление к внешним условиям.Например, хороший микроклимат устраняет жару, в которой человеческому телу пришлось бы активировать механизмы терморегуляции.

    Микроклимат жилых и общественных зданий складывается из множества параметров, но приоритетными будут:

    Температура воздуха;
    Влажность воздуха;
    Чистый воздух;
    Свежесть воздуха.

    Все эти параметры микроклимата в помещениях можно не только измерить, но и отрегулировать с помощью климатического оборудования. Поговорим подробнее обо всех.

    температура воздуха
    Требования Все тот же ГОСТ на микроклимат нормализует температуру воздуха в помещениях. В теплый период рекомендуется диапазон 22-25 ° С. В холодное время года немного ниже: 20-23 ° C для жилых комнат, 24-26 ° C для ванной, 23-24 ° C для детей и около 20 ° C для всех остальных помещений
    Кстати, помимо Указанный ГОСТ, есть еще СанПиН 2.1.2.2645-10. Он устанавливает гигиенические требования к микроклимату помещений.Однако нормы температуры и влажности в этих документах полностью совпадают.

    Регулирование Если температура ниже комфортной, то потребуется обогреватель. А если батареи наоборот слишком сильно расходуют топливо, то вам понадобится термостат, который может значительно снизить температуру в помещении. Летом вы можете охладить комнату с помощью кондиционера. Кстати, кондиционер с функцией обогрева зимой заменит обогреватель.

    Влажность воздуха

    Требования Рекомендуемая влажность для человека — 40-60%.Превышение этой отметки — это уже сырость, чреватая материальным ущербом и появлением плесени. Влажность ниже указанной может негативно сказаться на вашем самочувствии: может возникнуть сухость в горле, глазах. Кожа тоже может пересыхать и ухудшаться — в первую очередь это касается кожи лица и рук.
    Кстати, упомянутые ГОСТ и СанПиН по микроклимату помещения указывают и другие показатели оптимальной влажности: 30-45% зимой и 30-60% летом. Однако не всем в таких показателях будет комфортно.Кстати, детям нужно больше влажного воздуха, чем взрослым.
    Измерение. Влажность можно измерить бытовым гигрометром, домашней метеостанцией или многофункциональным прибором NavyFlex (что заслуживает отдельного разговора — она ​​будет ниже).
    Регулирование С низкой влажностью боритесь с помощью увлажнителя воздуха. С повышенной влажностью побороться сложнее, но это вполне реально. Необходимо будет устранить протечку, утеплить промерзающие конструкции и — пожалуй, самое главное — установить вентиляцию (подробнее можно прочитать здесь).

    Чистый воздух

    Требования Воздух в квартире содержит загрязнения из различных источников. Во-первых, это частицы, которые попадают в комнату извне — через открытые окна или систему вентиляции без очистки. Это могут быть и пыль и пыльца, и выхлопные газы, и выбросы растений. Во-вторых, он испаряется с мебели, отделочных материалов и предметов. Часто в воздухе квартир можно встретить формальдегид. В-третьих, это биологическое загрязнение от человека — так называемые антропотоксины.Организм человека выделяет ацетон, аммиак, фенолы, амины, углекислый газ СО2.
    Конечно, данные категории загрязняющих веществ различаются по степени опасности. Например, концентрированные выбросы сероводорода от соседнего завода нанесут больший ущерб, чем любой из антропотоксинов. В любом случае хороший микроклимат в квартире подразумевает минимальное содержание в воздухе загрязняющих веществ.

    Чистый воздух

    Измерение. Глубокий анализ состава и чистоты воздуха в квартире невозможен без специального оборудования.Такой анализ может провести химическая лаборатория. Косвенным показателем чистоты воздуха является концентрация CO2. Чем он выше, тем хуже вентиляция. И чем хуже вентиляция, тем больше загрязняющих веществ накапливается в воздухе квартиры.
    Регулирование Воздух можно очищать с помощью вытяжной вентиляции с фильтром, например, компактной лопастью. Его фильтры задерживают частицы пыли, пыльцу, микроорганизмы, газы и запахи. Бризер также может работать как очиститель воздуха — для фильтрации загрязнений, источники которых находятся не снаружи, а внутри квартиры.В качестве альтернативы вы можете использовать брайзер в сочетании с очистителем воздуха, который не только защищает от инфекций и вирусов, но и уничтожает их, тем самым снижая риск заболевания.

    Свежесть воздуха

    Требования Свежесть воздуха напрямую указывает на содержание углекислого газа, которое измеряется в частях на миллион. Как и в случае с влажностью, требования государственных стандартов и рекомендации физиологов по оптимальной концентрации СО2 сильно различаются.ГОСТ «Параметры микроклимата» считает приемлемым уровень 800–1400 ppm, а врачи рекомендуют поддерживать около 800 ppm. В этот момент большинство людей чувствуют себя комфортно. По мере увеличения уровня CO2 возникает чувство удушья, вялости, усталости, снижения концентрации внимания и работоспособности.
    Измерение. Уровень CO2 измеряется датчиками. Это, например, базовая станция NavyFlex.
    Регламент Свежесть воздуха зависит от качества работы вентиляции. Необходимо обеспечить постоянный приток свежего воздуха с улицы и участок бездыханного воздуха, наполненного углекислым газом и загрязнителями.Правильная вентиляция решает сразу несколько проблем: обеспечивает поступление свежего воздуха, устраняет загрязнения из квартиры, помогает регулировать влажность.
    В предыдущем абзаце мы уже сказали несколько слов о компактном вентиляционном устройстве — брайзере. Итак, его основная функция — обеспечение притока воздуха. Бриз доставляет воздух до 4-5 человек, при необходимости очищая и нагревая его.
    Для отвода воздуха используется вытяжка на кухне, в ванной, санузле. Если вы хотите его усилить, вам следует подобрать вытяжной вентилятор.

    Управление микроклиматом

    С требованиями к микроклимату разобрались, со списком климатического оборудования тоже. Осталось только разобраться, как управлять всем этим списком.

    Для тех, кто хочет комфортный микроклимат, а постоянно следить за показателями и вручную регулировать работу техники — не хочет, есть два варианта.

    Первая — это система «умный дом», которая будет включать в себя датчики и контрольное устройство для мониторинга и регулирования «погоды в доме».Второй — это автономная система управления микроклиматом, не требующая алгоритмов и дорогостоящего оборудования «умного дома».

    Управление микроклиматом

    Более того, базовая станция является частью именно такой автономной системы. Причем центральная часть. Он измеряет основные параметры микроклимата в доме: температуру, влажность и уровень СО2 (то есть свежесть и отчасти чистоту воздуха). Если эти параметры неудобны, пользователь может войти в мобильное приложение и парой касаний установить нужные показатели.Базовая станция будет управлять климатическим оборудованием и поддерживать необходимое качество микроклимата. Теперь базовая станция работает с бризерми. В конце февраля 2017 года мы представили устройство для связи базовой станции с кондиционерами — ИК-модуль. Скоро он поступит в продажу.

    Нормативные и допустимые отклонения температуры горячей воды в квартире. Какой температуры должна быть вода из-под крана

    Я живу в доме 1970 года постройки. Капитального ремонта не было.Максимально горячая вода, которая течет из нашего крана, — 50 градусов (мерял градусником утром и вечером несколько раз). Мне кажется, должно быть погорячее. Я обращалась в разные инстанции, но там говорят, что нет нормативов на воду. Какой температуры должна быть горячая вода? Если по нормам должно быть жарче 50 градусов, можно ли пересчитать? Как убедиться, что вода, текущая из-под крана, имеет нужную температуру?

    ■ Вас вводят в заблуждение.Температура горячей воды из-под крана должна быть не менее 60 ° С и не выше 75 ° С. § П. 2.4. СанПиН 2.1.4.2496-09 «Гигиенические требования к обеспечению безопасности систем горячего водоснабжения» (утв. Постановлением Главного государственного санитарного врача РФ от 7 апреля 2009 г. № 20)

    Допустимое отклонение температуры горячей воды ночью (с 00.00 до 5.00) не более 5 ° С, а днем ​​(с 5.00 до 00.00) — не более 3 ° С.

    Так что вы имеете полное право на перерасчет.

    За каждые 3 ° C отклонения от допустимых отклонений размер платы уменьшается на 0,1% в час. А если температура горячей воды ниже 40 ° C, оплата производится из расчета на холодную воду. Расчет в этом случае также почасовой.

    § п.5 приложения № 1 к Условиям оказания коммунальных услуг собственникам и пользователям помещений в многоквартирных домах и жилых домах (утверждены Постановлением Правительства Российской Федерации от 06.05.2011 г.354)

    Если вы обнаружите, что вода течет из-под крана не той температуры, которой должна быть, немедленно позвоните в аварийно-диспетчерскую службу. Проверьте номер обращения и запишите его. Если диспетчер не знает причину низкой температуры, время осмотра специалистами управляющей компании следует согласовать с вами. По результатам проверки составляется акт, копию которого вам необходимо предоставить.

    Если управляющая компания не отвечает на жалобы и не проводит аудит, вы сами можете зафиксировать факт оказания услуг ненадлежащего качества.Необходимо составить акт и подписать его не менее 2-х потребителей и председателя советского многоквартирного дома (или председателя ТСЖ).

    § Раздел X Правил оказания коммунальных услуг … (утвержден Постановлением Правительства Российской Федерации от 6 мая 2011 г. № 354)

    Подать письменное заявление в управляющую компанию. В нем укажите, что вы неоднократно подавали жалобы, но необходимые замеры так и не были произведены. Попросите пересчитать комиссию.

    Хорошо, если у вас есть подтверждение ваших предыдущих жалоб (их копии или справочные номера). Ведь в вашей ситуации факт низкой температуры не был установлен должным образом (то есть актом проверки). Если вы проводите проверку самостоятельно — приложите копию акта к заявлению.

    Обязательно сохраните копию заявления, поданного в управляющей компании. На нем специалист компании должен поставить отметку о приемке.

    Если управляющая компания продолжает бездействовать, подать жалобу в жилищную инспекцию.Если горячая вода — не единственное, что вас беспокоит, сделайте коллективные заявления соседям. Вы также можете обратиться в суд с просьбой о перерасчете гонорара. Но, как показывает практика, проблему можно решить и без суда — через жилищную инспекцию.

    Такие удобства, как тепло, газ, электричество и вода, мы воспринимаем как составляющие обычного комфорта горожанина. Нам особенно сложно без горячей воды, которую иногда планово отключают.

    А что, если горячую воду можно назвать так только потому, что она идет из соответствующего крана. На самом деле немного теплее, но совсем не жарко. Давайте посмотрим на стандарты и узнаем, какая температура должна быть.

    Норма температуры горячей воды по СНиП

    Температурный режим горячей воды, подаваемой в системы водоснабжения многоквартирного дома, устанавливается санитарно-эпидемиологической службой, СНИПами и ГОСТами.

    Постановление СанПиН 2.1.4.2496-09 перечисляет следующие стандарты горячей воды:

    • не менее 60 градусов в открытой системе отопления;
    • минимум 50 градусов в закрытой системе отопления;
    • не выше 75 градусов, независимо от системы.

    Нижний порог установлен в диапазоне, позволяющем защитить воду от болезнетворных бактерий. Превышение верхнего предела (75 градусов) по какой-либо причине может привести к повреждению пластиковой системы водоснабжения. Такие системы сейчас есть в каждом современном доме.

    Температура горячей воды из-под крана должна быть не менее 60 0 С и не выше 75 0 С

    Стоит отметить, что в законодательстве можно найти допустимые отклонения температуры горячей воды. Их не должно быть больше:

    • три градуса днем;
    • пять градусов ночью.

    Если отклонения окажутся больше указанных значений, потребители вправе потребовать снижения платы.Когда температура воды в горячем кране не достигает 40 градусов, ее стоимость следует рассчитывать по норме, как для холодного водоснабжения.

    Как измерить температуру горячей воды в кране

    Перед тем, как подать жалобу и произвести замеры, вы можете самостоятельно контролировать температуру воды из горячего крана. Для этого необходимо сначала открыть кран и дать воде стечь в течение двух-трех минут. Это необходимо для того, чтобы вода в водопроводе приобрела постоянную температуру.Затем его собирают в емкость, куда погружают градусник. Можно использовать обычный водяной прибор.

    После того, как температура на термометре станет постоянной, запишите ее и выполните серию измерений в другое время дня. Когда во время всех произведенных измерений полоска прибора показывает температуру ниже нормативной, следует обратиться в управляющую компанию.

    Что делать, если подача ГВС не в норме

    Обязательно сообщать о несоответствии температуры воды заданным нормам по результатам замеров, так как вы платите за ресурс и имеете право требовать соблюдения нормативов.Управляющая компания должна принимать заявки как в письменной форме, так и по телефону.

    Все действия, направленные на выяснение причин нарушений, должны фиксироваться диспетчером. Он, в свою очередь, обязан уведомить заявителя о проведенных работах на водопроводе. При отсутствии проблем на водопроводе представитель управляющей компании (УК) должен приехать по указанному в заявке адресу и снять замеры. Расчетное время выхода устанавливается в течение двух часов, если с заявителем не согласовано иное.

    В процессе проведения измерений в присутствии представителя Великобритании все показания термометра фиксируются в отчете. Этот документ должен быть составлен в обязательном порядке. Именно на его основании можно требовать перерасчета платежей за горячее водоснабжение. Изготовлены две копии: одна для заявителя, вторая для Уголовного кодекса.

    При регулярном и неоднократном нарушении температурного режима потребитель вправе обратиться с жалобой в коммунальную службу.Это обязательно будет рассмотрено, но важно правильно составить документ и максимально ясно аргументировать проблему.

    Основные пункты жалобы:

    1. В шапке, помимо организации и должностного лица, которому она адресована, обязательно указать свои данные: ФИО, полный адрес регистрации, телефон для связи.
    2. Текст должен содержать всю информацию о проблеме с указанием произведенных измерений.Данные взяты из акта, составленного совместно с представителем Уголовного кодекса. Необходимо указать дату проведения измерений, температуру по показаниям прибора и данные представителя. Здесь же можно указать даты звонков и посещений по этому вопросу.
    3. В конце жалобы прописываются требования по устранению причин отклонения от норм.
    4. Жалоба скрепляется подписью заинтересованного лица и датой ее составления.

    Жалоба может быть оформлена в распечатанном виде или от руки в двух экземплярах. Один из них передан управляющей компании. В этом случае при личном посещении вы можете потребовать зарегистрировать его в присутствии заявителя и поставить входящий номер на второй экземпляр, который остается на руках заявителя.

    Пример приложения для измерения температуры горячей воды

    Срок рассмотрения жалобы установлен в 30 дней, хотя управляющие компании часто гораздо быстрее отвечают на письменные запросы.На скорость решения проблемы может повлиять коллективная жалоба, если есть несколько недовольных качеством воды.

    В случае бездействия УК необходимо обращаться в органы государственного надзора — Роспотребнадзор и прокуратуру.

    Горячая вода должна обеспечивать жильцам комфорт и безопасность сантехнического использования водных ресурсов в соответствии со всеми санитарными нормами температура горячей воды в многоквартирном доме … Оборудование для подачи и распределения ресурсов к точкам потребления по всей системе здания установлено в соответствии с со стандартами.Такие услуги должны быть безопасными, надежными и недорогими.

    Температура ГВС

    Немного о том, какой температуры должна быть вода. Диапазон температуры горячей воды от 60 до 75 градусов Цельсия. Эти значения были выбраны не просто так. Когда температура воды в кране выше рекомендуемых пределов, то возможны ожоги, особенно для чувствительной кожи ребенка. Поэтому норматив необходимо строго соблюдать в детских учреждениях и организациях здравоохранения.

    Многие жильцы недоумевают, почему именно такое значение температуры … Когда определяли температурный режим подачи горячей воды, исходили из такого явления, как размножение патологических микроорганизмов. Также учитывалась опасность получения ожоговых травм.

    Разница температур горячей воды должна быть такой, чтобы перестали существовать вредные бактерии и не возникли ожоги. Теплая свежая жидкость — отличная среда обитания для легионеллы, которая чрезвычайно опасна и размножается в центральном водоснабжении (канализация, отопление).Например, не так давно в городе Верхняя Пышма из-за этой бактерии, проникшей в квартиры через водопровод, у 160 жителей города были эпидемиологические формы пневмонии, пять человек скончались в больнице.

    Как следствие, нет необходимости оправдывать сотрудников управляющей организации, чтобы винить во всех этих проблемах жителей дома, поскольку санитарные нормы температуры горячей воды в квартирах закреплены законодательно, а Причинно-следственные связи собственников и съемщиков квартир не применяются.Главное, что нужно арендаторам — это знать, кому писать заявление о перерасчете платежей за жилищно-коммунальные услуги, которые оказывались плохо.

    ВАЖНО! Исследования, определяющие норму температуры горячей воды в квартире, следует доверить аккредитованной компании, имеющей лицензионные свидетельства, позволяющие осуществлять такую ​​деятельность.

    Горячая вода не соответствует нормам

    После измерения температуры, а норматив температуры горячей воды, подаваемой в жилище, не соблюден, необходимо подать жалобу в соответствующую организацию.Помимо отклонений показаний температуры, могут быть следующие аномалии:

    • бывает, что после открытия крана вода вытекает тёплая, а иногда и холодная, что недопустимо;
    • еще бывает, что вода из-под крана идет нестандартного цвета и пахнет от нее не очень приятно;
    • вообще нет горячей воды.

    К сожалению, качество услуг, предоставляемых компаниями, иногда бывает неадекватным, за что виновные должны нести ответственность.Когда собственники недвижимости обеспокоены такими проблемами, тогда нужно позвонить сотрудникам управляющей организации или выяснить и устранить причины нарушений.

    При этом следует учитывать, что все собственники квартир имеют право потребовать не только устранения предпосылок, причем в кратчайшие сроки, но и выполнить за горячую воду, и когда ее нет в водоснабжение, то даже не платить за эту услугу.

    Но зачастую сотрудникам компании сложно самостоятельно доказать нарушения, возникающие у жителей, они не спешат брать на себя ответственность.В таких ситуациях необходимо обращаться в другие лицензированные организации, которые проводят независимую экспертизу.

    Куда пойти

    Если горячая вода отличается от действующих норм, а качество оказываемых услуг низкое, то пишут хозяева квартиры. К нему необходимо приложить приложение в виде копии экзамена, проведенного независимой организацией. После этого остается только дождаться решения этой проблемы Уголовным кодексом, на что потребуется время.

    Когда управляющая компания ничего не делает или приходят только ответы, ответ на вопрос, что делать в случае отклонений, — нужно идти дальше. В жилищную инспекцию или прокуратуру. В действительности многие арендаторы часто сталкиваются с подобными ситуациями, когда управляющая компания не хочет устранять свои недостатки, а лишь кивает на якобы объективные обстоятельства.

    Часто говорят, что не уполномочены решать такие вопросы, не входят в их компетенцию и что управляющие компании не несут ответственности за эксплуатацию трубопроводов.Также можно узнать, что они вообще не знают, какая температура горячей воды должна быть на выходе из точки водозабора, поэтому Великобритания не собирается ничего делать для решения этого вопроса.

    Надо твердо отстаивать собственные права, ведь только управляющим компаниям доверена миссия ЖКХ. Температуру ГВС в размере от 60 до 75 градусов должны обеспечивать управляющие компании. Их прямая обязанность — отвечать на все жалобы и устранять проблемы.Если этого не сделать, то собственники вправе подать жалобу в прокуратуру и Роспотребнадзор.

    Органы надзора

    При обнаружении отклонений от нормативов горячего водоснабжения управляющая компания ведет переговоры, а в некоторых случаях самостоятельно ремонтирует инженерно-коммуникационную систему. Часто бывает, что некоторые недобросовестные подрядчики в целях экономии на пользователях уклоняются от проведения ремонтных работ трубопроводов, которые им просто необходимо выполнить.В этом случае нужно смело обращаться с жалобой в прокуратуру или Роспотребнадзор.

    Более того, можно не перенаправлять жалобу в надзорные органы, как это часто делают арендаторы. Знайте, что всегда можно договориться с управляющей компанией и по-хорошему пересчитать горячую воду. На практике многие управляющие организации сами оказываются заложниками таких ситуаций, когда от них буквально ничего не зависит.

    Перед тем, как написать заявление о перерасчете оплаты коммунальных услуг из-за некачественной услуги, следует выяснить все тонкости этого вопроса, изучить подводные камни.Это нужно делать, чтобы не попадать в различные неприятные ситуации … Все можно решить цивилизованно и по закону.

    Но когда все предпринятые попытки не привели ни к какому результату, то владельцам жилых помещений следует обращаться в надзорные структуры. Тогда дело пойдет намного быстрее, а когда проблемная ситуация действительно возникнет, то в достаточно короткие сроки она разрешится.

    Температура холодной воды

    Качество воды, подаваемой в квартиры для питьевого и хозяйственного назначения, должно соответствовать ГОСТу и СанПин.Температурный разброс холодной воды никакими стандартами не регламентируется, но следует знать, что показатели зависят от сезона. Это соответствует значениям в источниках водозабора и температуре земли, на которой проложен трубопровод.

    В магистральных трубах температура достигает почти минусовых показаний из-за того, что при высоком давлении жидкость замерзает медленнее. Хотя температура холодной воды в кране не регулируется стандартами, региональные регулирующие органы рекомендуют диапазон от 4 до 20 градусов Цельсия.В зимний период в одних помещениях очень жарко, а в других, наоборот, холодно. Это неудобно даже при соблюдении норм, поэтому в отопительный сезон они регулируются управляющей компанией.

    Несчастные случаи, влияющие на производительность

    Подогрев холодной воды часто происходит из-за смешивания в кранах центрального горячего водоснабжения. Это связано с неравномерным давлением в трубах и неустановившимся смесителем, стоящим на стояке. Иногда бывает перемешивание при проведении санитарных работ в техническом подполье.

    Необходимо знать, что все проблемы при повышении температуры холодной воды в кране управляющая компания обязана устранять в кратчайшие сроки. В противном случае может быть повреждена дорогая бытовая техника, стиральные и посудомоечные машины, работающие на холодной воде из водопроводных труб.

    Чтобы этого не происходило, при работе любых водонагревательных приборов необходимо вовремя отключать контуры горячего водоснабжения при работе ТЭНа, а также отключать котлы при заборе воды из общей стояк.При открытой двухконтурной технологии часто бывает смешивание горячей и холодной воды, что приводит к высокому давлению, а затем и к поломке сантехнического оборудования.

    Отличие использования ГВС между загородным домом и квартирой в основном состоит в том, что в системе индивидуального автономного отопления всегда можно проверить и отрегулировать температуру и давление теплоносителя, протекающего по трубам, а в централизованной системе отопление эти параметры задаются в котельной, и хозяин квартиры никак не может повлиять на регулировку характеристик рабочего тела.Но, какой должна быть температура горячей воды, вы можете контролировать ее в квартире. Это нужно сделать как минимум для того, чтобы температура горячего водоснабжения и отопления соответствовала нормам и обеспечивала комфортное проживание и использование. горячая вода в ванной, на кухне и других точках водоснабжения. Поэтому, если в течение года вместо горячей воды определенной температуры вам достается еле теплая или даже холодная вода, то вам стоит подумать, как и где написать заявку, чтобы добиться целевого расходования своих счетов за коммунальные услуги.

    Как устанавливается температурный диапазон

    О том, какой температуры должна быть горячая вода в системе водоснабжения и центрального отопления, информация изложена в СанПиН 2.1.4.2496-09 (санитарные правила и нормы, определяющие температуру горячей воды). водоснабжение и отопление) и ГОСТ Р 51617-2000 (температура воздуха в помещении при использовании отопления и горячего водоснабжения). Параметры не меняются длительное время, так как определяются целесообразностью этих значений — человек должен чувствовать себя комфортно и не испытывать никаких неудобств при использовании горячей воды в том или ином виде.

    Поскольку температура воды в ГВС зависит от технического решения водоснабжения дома или квартиры, то для холодного и горячего водоснабжения температура всегда будет разной. Температура в системе горячего водоснабжения не должна превышать 60 0 С-75 0 С для всех точек водозабора. Если контур ГВС закрытого типа, то минимально допустимая температура воды должна быть 50 0 С, для открытого горячего водоснабжения — 60 0 С.

    Нормы ЖКХ содержат следующие допустимые отклонения: понижение температуры на 5 0 С в ночное время (с 0.00 до 5.00) и снижение температуры днем ​​на 3 0 С (с 5.00 до 0.00). Эти правила основаны не только на комфорте пользования горячим водоснабжением, но и на безопасности жителей. В случае отклонения от регламента более чем на указанные лимиты на каждые 3 0 С, жители имеют право потребовать снижения платы за горячее водоснабжение на 0,1% за каждые 60 минут нарушения. Если при контрольных замерах температуры градусник показал температуру ≤ 40 0 ​​С, то оплата коммунальных услуг осуществляется по ставкам платы за холодное водоснабжение.Для подтверждения данных необходимо провести официальный замер и составить акт, удостоверяющий отклонение от правил СанПиН.

    Горячая вода в трубах может вызвать ожоги, особенно у детей. Кроме того, современные трубопроводы бывают пластиковыми или металлопластиковыми, и высокие температуры воды на них разрушительно действуют. При температуре в трубах более 76 0 С происходит нарушение регламента, а также при понижении температуры до 56 0 С, и жители имеют право написать индивидуальную или коллективную жалобу в коммунальное предприятие.


    Еще одно правило, которое заставляет регулировать подачу горячей воды в квартире в пределах 60-75 0С. В теплой воде микроорганизмы и болезнетворные бактерии начинают быстро и активно размножаться. Таким образом, предельный температурный диапазон должен охватывать указанные значения. При котором человек не получит ожогов, но микроорганизмы погибнут, не причинив вреда потребителям. Это правило особенно актуально для детских и медицинских учреждений.

    Легионелла, бактерия, вызывающая пневмонию неизвестной этиологии, хорошо размножается в теплой пресной воде.Это означает, что в большинстве случаев заболевание не обнаруживается или определяется неправильно, что приводит к неправильному лечению с соответствующими результатами, вплоть до смерти. Но в горячей воде легионелла погибает в зависимости от температуры:

    1. При 70-80 ° С вода полностью обеззараживается — все бактерии погибают мгновенно;
    2. При 66 ° C легионелла умирает за 120 секунд;
    3. При температуре 60 0 С микроорганизмы погибают за 22 минуты;
    4. При 55 ° C бактерии погибают через 6-7 часов;
    5. При температуре 20-45 ° С начинается активная фаза размножения легионелл;
    6. При температуре ≤ 20 ° C легионелла не может размножаться из-за холода.

    На основании вышеизложенного становится ясно, что при высокой температуре есть безопасное использование горячего водоснабжения с точки зрения заболеваемости, но небезопасное с точки зрения возможных ожогов:

    1. При температуре воды в системе горячего водоснабжения ≤ 50 0 С имеется достаточная степень вероятности получения ожога;
    2. При температуре ≥ 65 ° C ожоги кожи возникают за 2-5 секунд;
    3. При температуре воды 55 ° C ожог можно получить за полторы минуты.

    Проблема решается следующим образом: горячая вода при централизованном распределении по жилым домам сначала хранится в резервуарах, где поддерживается достаточно высокая температура, чтобы убить бактерии. Поскольку ГВС подается в дома, его температура падает до регулируемого уровня, и ГВС следует использовать только тогда, когда к дому одновременно подключено холодное водоснабжение.

    Качество ГВС

    Что регулируется СНиП, ГОСТ и СанПин ? В Постановлении СанПиН 2.1.4.2496-09 п. 2.4 регламентируются нормы температурного режима транспортировки воды в жилые дома, а предельные значения температуры горячей воды в квартире составляют от 60 0 С до 75 0 С. Дополнительно , горячая вода в квартире не должна иметь посторонних запахов и привкусов. Если по каким-то параметрам температурный регламент не соблюдается, можно написать жалобу в организации, осуществляющие доставку горячей воды в жилые дома, с целью устранения причины нарушения ГОСТа.В каждом регионе форма заявки будет оригинальной, поэтому вот несколько примеров таких заявлений:


    https://youtu.be/1viQbRTzQ6A

    Как измерить температуру

    Чтобы узнать, какая температура горячей воды поставка является нормой или нет, сначала проводятся независимые замеры, и только после этого необходимо пригласить официальных представителей ЖКХ для проведения официальных замеров и составить соответствующие подтверждающие документы.

    Чтобы самостоятельно измерить температуру горячей воды, откройте любой кран с горячей водой и слейте воду в течение 180 секунд, затем наполните водой любую емкость (например, литровую банку) и измерьте температуру обычным бытовым термометром. .Для этого положите его в банку на несколько минут и дождитесь, пока показания термометра перестанут меняться. Если термометр показывает заниженные или завышенные значения, обратитесь в коммунальные службы с соответствующими заявлениями. Если по каким-либо причинам невозможно подать письменное заявление, диспетчер обязан принять устную телефонную жалобу или заявку на контрольный замер от официальных представителей компании. Если нарушение устраняется без проведения контрольных замеров, то диспетчер обязан сообщить об этом заявителю.

    Если причина нарушения температурного режима неизвестна, то представитель коммунальной организации обязан явиться к заявителю для служебного не позднее, чем через 120 минут после получения любого заявления — устного или письменного. Остальные временные интервалы обсуждаются с заявителем.

    Повторные замеры температуры ГВС уже производятся чиновником, после чего должен быть составлен акт замера температуры воды, и на основании этого документа при явном нарушении должна быть произведена оплата за горячее водоснабжение. в пересчете по другим тарифам.Акт составляется в двух экземплярах, один экземпляр направляется в управляющую компанию, второй должен быть у собственника объекта недвижимости.

    Как написать жалобу в управляющую организацию

    Если график температуры ГВС постоянно и регулярно нарушается, то жильцы могут написать коллективную или индивидуальную жалобу на управляющую компанию, осуществляющую транспортировку горячей воды. Для того чтобы жалоба имела законную силу, она должна быть оформлена грамотно, с фактами и аргументами.Помочь в оформлении такого документа может любой нотариус или юрист.

    Название документа должно содержать правильное название организации, на которую подается жалоба, и имя ответственного лица (если оно известно заявителю), которому адресован документ. Ниже приведены личные данные заявителя: фамилия, имя, отчество, адрес, по которому заявитель зарегистрирован, контактная информация для последующего общения по заявке.

    Форма общей жалобы:

    1. Название документа;
    2. Заявление о нарушении температурного режима при обеспечении жителей горячей водой по заявке в соответствии с Федеральным законом от 25.07.2012 г.195 по статье 7.23;
    3. Само приложение содержит описание и суть жалобы. В документе необходимо указать, что независимые и контрольные замеры температуры горячей воды проводились с сообщением информации из ранее составленного акта: дата измерения, личные данные работника, проводящего контрольный замер температуры горячей воды. температура, температурные параметры;
    4. Жалоба должна заканчиваться требованием об устранении нарушений в подаче горячей воды или об устранении нарушений температурного режима горячей воды.Кроме того, вы можете обязать компанию информировать вас о выполнении соответствующих работ;
    5. В конце письменной жалобы указывается дата ее составления и проставляется подпись заявителя. Жалобу необходимо подать и зарегистрировать в 2-х экземплярах. Документ отправляется в управляющую организацию заказным письмом с уведомлением или самостоятельно доставляется заявителем в офис компании.

    Второй экземпляр жалобы, который остается у заявителя, должен содержать отметку о принятии документа, а также дату получения заявления и печать управляющей организации.Ответ на претензию должен быть получен не позднее 30 рабочих дней.

    Как требовать перерасчета при отклонении от температурного графика

    Как производится перерасчет платы за ГВС при нарушении температурного графика на горячее водоснабжение? Имея на руках акт контрольных замеров, подтвержденный должностным лицом управляющей компании, необходимо посетить управляющую организацию, чтобы оформить перерасчет услуги использования горячей воды.

    Если температура ГВС на момент измерения была ≤ 40 0 ​​С, то потребление ГВС должно быть оплачено, согласно законодательству, по тарифам на холодное водоснабжение. Таким образом, чтобы провести официальный перерасчет, необходимо иметь на руках акт измерения температуры ГВС. Перед составлением акта подается заявка на обмер, в документе должен быть указан регистрационный номер, время приема в делопроизводство, данные диспетчера, принявшего заявку.Если во время технического сбоя был составлен акт, и впоследствии температура горячей воды нормализовалась, диспетчер обязан известить об этом заявителя с указанием сроков аварийных работ по ГВС и времени устранения поломки в трубопроводе.

    При постоянно низкой температуре горячей воды она снижается и по необъяснимым причинам этого снижения следует согласовать с представителем компании (диспетчером) время контрольного измерения температуры горячей воды.После замера и составления нескольких экземпляров акта о количестве участников измерения документ направляется в органы, утверждающие или не утверждающие факт необходимости перерасчета.

    В зимнее время измерение производится с учетом температуры наружного воздуха и условий теплоизоляции линии ГВС.

    Особенности измерений

    1. При измерении температуры ГВС водопроводную воду необходимо слить не менее 2-3 минут;
    2. Время слива зависит от схемы подачи ГВС в водонагреватель для замера (например, от «автономной» трубы или от крана в ванной или кухне).

    Кодекс Российской Федерации об административных правонарушениях содержит статью 7.23, которая предусматривает взыскания или административные санкции за нарушение правил обеспечения населения горячим водоснабжением. Поэтому замер и последующие действия необходимо проводить официально и задокументировать, чтобы не только установить факт нарушения, но и определить точные сроки, в которые будет произведен перерасчет платы за услуги ГВС.В этом случае начальным периодом является время составления протокола замеров, окончательной датой перерасчета является дата проверки соответствия температурного режима горячего водоснабжения после устранения аварии, поломки или другой причины. за нарушение графика. В случае отказа управляющей компании в перерасчете заявитель вправе подать жалобу в Роспотребнадзор или в суд.

    Если нарушения подпадают под действие Федерального закона №195 по статье 7.23, то ответчик может быть оштрафован, при этом размер штрафа для физического лица может составлять 500-1000 рублей, для организации — 5000-10000 рублей.

    Оплачивая коммунальные услуги, Вы имеете право потребовать от управляющей компании исполнения своих обязанностей в полном объеме, а также получить за свои деньги услуги и продукты соответствующего качества. Поэтому, если вы видите, что услуга не соответствует заявленной, не бойтесь отстаивать свои права и требовать от компании, предоставляющей услуги, выполнения своих обязанностей.Обладая полной информацией о нормах горячего водоснабжения, температурных режимах и допустимых отклонениях, вы можете оспаривать неправомерные действия поставщиков услуг, сопровождая свои претензии соответствующими документами: актами измерений, заявлениями о перерасчете платежей за услуги, правильно оформленными жалобами в вышестоящую инстанцию. органы власти — Роспотребнадзор или суд.

    Что делать, если вода не соответствует требованиям СанПиН

    Если у вас возникла необходимость пересчета платежей за ненадлежащие услуги по доставке горячей воды, то ваши действия должны происходить в правовом поле, а именно соответствовать требованиям Постановление Правительства №354 Российской Федерации, устанавливающий правила оказания государственных услуг потребителям.

    Требования, согласно которым будут регулироваться ваши действия как потерпевшего потребителя:

    1. Если вы обнаружите нарушение, вы должны сообщить об этом диспетчеру письменно или устно. В любом случае не забудьте указать свои координаты — личные данные, адрес, причину обращения. Диспетчер обязан зарегистрировать ваше обращение и принять его;
    2. В ответ диспетчер должен предоставить вам свои данные, регистрационный номер вашей заявки и время ее подачи;
    3. Факт нарушения оказания услуги должен быть проверен диспетчерской службой и зафиксирован.Для этого совместно с заявителем проводится дополнительная проверка нарушения, о чем составляется акт. Согласно пункту 108 Постановления № 354 такая проверка должна быть организована не позднее, чем через два часа после получения претензии. Остальное время согласовывается с заявителем;
    4. После проверки должен быть составлен акт, по результатам которого нарушения будут устранены. В документе обязательно должно быть описание нарушения, если оно было обнаружено, как и какими средствами было проведено контрольное измерение температуры ГВС, время измерения и адрес, по которому были выполнены все описанные действия;
    5. На каждого участника проверки составляется копия акта, у заявителя также должен быть один экземпляр.

    Если вы как заявитель и потерпевший не согласны с результатами проверки и измерений, вы можете запросить дополнительное обследование. Повторная проверка согласовывается и проводится так же, как и первичная проверка, только эксперт уже участвует в ней. Если при повторной проверке факт нарушения не будет подтвержден и зафиксирован, то заявитель несет расходы по проверке.

    Действия после получения акта

    После того, как вы заполнили все документы и получили акт о нарушении качества коммунальных услуг по сдаче горячей воды, ваши дальнейшие действия заключаются в оформлении претензии о перерасчете платежа .Вы можете узнать время, для которого следует произвести пересчет, из информации, изложенной выше.

    Сроком нарушения температурного режима считается:

    1. с момента доведения информации о нарушении до диспетчера;
    2. До момента проведения теста для восстановления параметров.

    Если за это время не обновили нужную ГВС, то услуги с нарушением качества считаются неполными, а это значит, что вы имеете право подать второй запрос.

    Горячая вода — неотъемлемая часть человеческого комфорта, как электричество, газ и отопление.

    Часто граждане сталкиваются с ситуацией, когда горячую воду можно назвать только потому, что она течет из горячего крана. Естественно, что такие случаи никому не нравятся.

    Следовательно, следует разобраться, что делать в таких ситуациях, ведь температура горячей воды в кране строго установлена ​​по стандарту СНИП в 2019 году. Стандарт 2019 года остается неизменным по сравнению с предыдущими.

    В соответствии с санитарными правилами и нормами законодательства РФ допустимые пределы горячей воды должны быть в пределах от 60 до 75 градусов. Именно на этих ценностях нужно сосредоточиться.

    Все граждане имеют право пользоваться горячей водой и жаловаться при нарушении СанПиН. Поскольку, если вода льется очень холодной, то человек не только теряет комфорт, но и ставит под угрозу собственное здоровье.

    Температурный режим горячей воды, подаваемой в системы водоснабжения многоквартирного дома, устанавливается Санитарно-эпидемиологической службой, СНИПами и ГОСТами.

    Нормы горячей воды в соответствии с вышеуказанными актами следующие:

    1. Не менее 60 градусов для открытой системы отопления.
    2. Не менее 50 градусов в закрытой системе отопления.
    3. Не выше 75 градусов, независимо от системы.

    Именно такой и должна быть горячая вода в кране по ГОСТ … Нижний порог нормы установлен в таком диапазоне, чтобы защитить воду от болезнетворных бактерий.

    Если температура воды превышает 75 градусов, то это может спровоцировать выход из строя пластикового водопровода, который установлен в каждом современном доме. Но эти нормы не зависят от типа водопровода.

    Стоит отметить, что в действующем в 2019 году законодательстве можно найти допустимые отклонения от нормы.

    Их должно быть не более:

    • три градуса днем;
    • пять градусов ночью.

    Если отклонения окажутся больше указанных значений, то потребители имеют полное право потребовать снижения платы. Если горячая вода имеет низкую температуру или не достигает 40 градусов, ее стоимость следует рассчитывать как на холодное водоснабжение.

    Если температура воды слишком низкая, это может вызвать заражение жидкости инфекционными заболеваниями и бактериями. При установленном минимальном температурном пороге вредные бактерии обречены на смерть.

    Очень горячая вода может вызвать ожоги кожи … Даже при температуре 55 градусов есть опасность ожога. Поэтому гражданам, подключенным к открытой системе водоснабжения, рекомендуется смешивать горячую воду с холодной.

    Превышение температурного порога приведет к повреждению пластиковых систем водоснабжения. Придется делать ремонт, а кто за него заплатит — большой вопрос.

    Кроме того, все время, пока гражданин будет выяснять причину и искать виновника этого происшествия, ему придется сидеть без воды.

    Если температура воды упадет до 59 градусов или поднимется до 76 градусов в открытой системе водоснабжения — это считается нарушением правил предоставления коммунальных услуг. А вот незначительные отклонения от нормы правилами предусмотрены.

    Полная приостановка горячей воды возможна в двух случаях:

    1. Если на насосной станции или на подающей линии произошла авария.
    2. Ведутся плановые или профилактические работы.

    Во втором случае лишать подачи воды можно не более чем на 4 часа.

    Житель многоквартирного дома должен понимать, что если температура воды на момент забора меньше 40 градусов, то оплата за ее потребление должна производиться как за холодную воду.

    Чтобы произвести пересчет по таким показателям, необходимо измерить температуру воды.

    Если горячая вода имеет низкую температуру, в первую очередь необходимо обратиться в диспетчерскую службу управляющей компании или в жилищно-коммунальные службы.Подать заявку на температуру воды ниже указанной.

    Заявление должно быть оформлено письменно с указанием номера заявки, времени ее приема и ФИО диспетчера.

    Может оказаться, что падение температурного режима воды произошло в результате технической неисправности трубопровода или по другой причине. В таком случае диспетчер должен уведомить аварийный режим и строку поиска неисправности.

    В ситуации, когда по неизвестным причинам температура воды понижается, необходимо согласовать день и время проведения измерений.После выполнения данной процедуры составляется акт.

    Количество экземпляров должно совпадать с количеством участников процедуры … По результатам замеров перерасчет платы за горячую воду по тарификации холодной воды происходит или не происходит.

    При регулярном нарушении температурного режима воды в кране потребитель вправе обратиться с жалобой в коммунальную службу.Это обязательно будет рассмотрено, но важно правильно составить документ и максимально ясно аргументировать проблему.

    Основные пункты жалобы:

    Настоящий документ может быть составлен в печатном виде или написан от руки в двух экземплярах. Один экземпляр остается у потребителя, а второй передается управляющей компании.

    При личном посещении вы можете попросить зарегистрировать жалобу в собственном присутствии и указать входящий номер на своей копии.

    По закону жалоба потребителя должна быть рассмотрена в течение 30 дней с момента ее подачи. … Иногда управляющие компании быстрее отвечают на письменные запросы.

    Если несколько потребителей недовольны качеством воды, то коллективная жалоба повлияет на скорость рассмотрения и разрешения проблемы.

    В случае, если управляющая компания не отреагирует и не примет меры для решения проблемы, необходимо обратиться в органы государственного надзора — Роспотребнадзор и прокуратуру.

    Для того, чтобы обратиться в управляющую компанию с жалобой на несоответствие температуры воды нормативам, чтобы дать результат, необходимо иметь доказательства.

    Следовательно, гражданин, считающий себя пострадавшим из-за нарушения предписания Санпин и желающий отстоять свои права, должен знать правила измерения температуры горячей воды в квартире. Это простая процедура, не занимающая много времени.

    Температура горячей воды в кране измеряется градусником со шкалой 100 градусов.Человек должен заранее подготовить это устройство и строго придерживаться алгоритма действий, которые приводят к точному результату:

    За период времени, когда горячее водоснабжение не соответствовало норме, потребитель вправе потребовать перерасчета.

    Для этого снова потребуется акт, составленный представителями управляющей компании и подписанный двумя сторонами. Вам следует пойти с ним в компанию и написать заявление.

    В заявке необходимо указать период, за который требуется перерасчет комиссии.В этом случае датой составления акта будет начало периода, а датой окончательной проверки, если причина найдена и устранена, — концом.

    Если температура горячей воды не соответствует нормативам СанпиН, то расчетный отдел производит уменьшение счета за коммунальные услуги за горячую воду в указанный период:

    1. На 0,1%, когда показатели ниже нормы более чем на три градуса в течение дня.
    2. Если температура в кране горячей воды опускается ниже 40 градусов, плата взимается по той же ставке, что и за холодную воду.

    Таким образом, температура горячей воды в кране по стандарту СНИП в 2019 году составляет не менее 60 градусов Цельсия — если система открытая, и не менее 50 градусов Цельсия — в закрытой системе.

    Горячая вода не должна быть выше 75 градусов, этот предел не зависит от системы водоснабжения.

    В случае, когда по неизвестным причинам температура горячей воды понижается, необходимо связаться с управляющей компанией и согласовать день и час проведения измерений.На основании замеров оплата за горячую воду пересчитывается по тарифам на холодную воду.

    Главная »Стройматериалы» Нормативные и допустимые отклонения температуры горячей воды в квартире. Какой температуры должна быть вода из-под крана

    .

    Добавить комментарий

    Ваш адрес email не будет опубликован.