Бешенство в россии статистика: Бешенство — последние и свежие новости сегодня и за 2021 год на iz.ru

Разное

Содержание

В России участились случаи бешенства у животных

В России участились случаи бешенства у животных. В июле 2020 года выявлено в полтора раза больше зараженных этой инфекцией особей, чем в июне, следует из данных подведомственной Россельхознадзору Центральной научно-методической ветеринарной лаборатории (ФГБУ «ЦНМВЛ», Москва).

Текст: Юлия Макеева

Так, в июле 2020 года зафиксировано 117 случаев бешенства у животных, сообщили в ФГБУ «ЦНМВЛ». Тогда как в июне было выявлено 77 больных животных.

В июле наибольшее количество случаев бешенства отмечено в Ярославской, Саратовской, Пензенской, Рязанской, Челябинской, Владимирской, Самарской и Калужской областях.

Среди диких плотоядных в июле выявлен 61 случай бешенства. Больше всего инфицированных лис – 39 особей, а также 13 енотовидных собак и четыре барсука. По одному случаю инфекции зафиксировано в популяциях кабанов, волков, енотов, кротов и куниц.

Кроме того, зарегистрировано 52 случая заражения вирусом кошек и собак. Среди крупного и мелкого рогатого скота в июле зафиксировано четыре случая бешенства.

Стоит отметить, что в Москве три населенных пункта закрыты из-за этой инфекции на карантин. Ограничения введены в поселении Клёновское Троицкого округа, поселении Сосенское Новомосковского округа и на территории Нагатинского Затона в Южном округе столицы. Ветврачи напоминают, что один из эффективных способов профилактики бешенства у животных – вакцинация. Например, в Москве привить домашнего питомца можно бесплатно в городских пунктах вакцинации, их список размещен на сайте mos.ru.

Как отмечалось ранее, новую вакцину от бешенства для домашних и сельскохозяйственных животных разработали в научном учреждении Россельхознадзора – Федеральном центре охраны здоровья животных (ФГБУ «ВНИИЗЖ»). Вакцина антирабическая инактивированная эмульсионная культуральная «АРРИАХ-Рабивак» формирует у животных устойчивый иммунитет (уровень антител в 2–3 раза выше по сравнению с традиционными вакцинами) сроком более чем на 12 месяцев.

Справка «ВиЖ»

Бешенство – острая инфекционная болезнь, вызываемая вирусом Rabies virus. Заболевание приводит к специфическому энцефалиту (воспаление головного мозга) у животных и человека. Передается со слюной больного животного при укусе либо при попадании на поврежденные участки кожи или слизистые оболочки. Вирус бешенства, распространяясь по нервным путям, достигает слюнных желез и нервных клеток коры головного мозга, гиппокампа, бульбарных центров и, поражая их, вызывает тяжелые необратимые нарушения.

Подпишитесь на нас в ЯНДЕКС.НОВОСТИ и в Telegram , чтобы читать новости сразу, как только они появляются на сайте.

статистика по бешенству в России

14 Марта 2018

Роспотребнадзор: статистика по бешенству в России

Ежегодно около 400 тыс. человек в России обращаются к медикам из-за укусов животных, из них порядка 250 тыс. нуждаются в лечении от бешенства — об этом Агентству городских новостей «Москва» сообщили в пресс-службе Роспотребнадзора

«В последние годы в РФ продолжает оставаться напряженной ситуация по бешенству среди животных, отмечается тенденция к росту числа регионов, неблагополучных по данному заболеванию. При этом не во всех субъектах РФ принимаются меры, направленные на сдерживание распространения бешенства, в том числе не проводится регулирование численности безнадзорных животных в городах и сельской местности, не соблюдаются правила содержания домашних животных, не проводится их учёт, регистрация и вакцинация, не решены вопросы по организации карантинирования подозрительных на бешенство животных, неудовлетворительно проводятся мероприятия по отлову безнадзорных животных и организация мест их содержания, что приводит к возникновению новых эпизоотических очагов бешенства. Ежегодно в России по поводу укусов животных обращается около 400 тыс. человек, из них порядка 250 тыс. нуждаются в проведении специфического антирабического лечения», — заявили в пресс-службе.

Также в службе дали рекомендации по предотвращению заражения бешенством.

«Бешенство — заболевание, которое в 100% случаев заканчивается летальным исходом. Для профилактики бешенства населению необходимо соблюдать следующие правила: приобретать животных только в специализированных организациях при наличии ветеринарного освидетельствования; обязательно проводить вакцинацию против бешенства домашних и сельскохозяйственных животных; избегать контактов с безнадзорными животными, не кормить их с рук, не гладить; не осуществлять самостоятельно забой и уничтожение павших сельскохозяйственных и домашних животных без ветеринарного освидетельствования; незамедлительно обращаться за оказанием антирабической помощи в случае получения укусов, ослюнений и при контакте с неизвестным животным», — добавили в службе.

Добавим, что в Санкт-Петербурге уже 30 лет не фиксировались случаи бешенства — стараниями Госветслужбы СПб в городе с 2012 года эффективно действует программа безвозмездной вакцинации собак от этого смертельного вируса.

Бешенство — Официальный сайт Администрации Санкт‑Петербурга

Бешенство – это заразная болезнь, теплокровных животных и человека, характеризующаяся поражением центральной нервной системы, агрессивным поведением, слюнотечением и параличами.

В развитии болезни различаются продромальная стадия, стадия возбуждения и стадия параличей.

  1. Продромальная стадия характеризуется повышением чувствительности восприимчивых животных к шуму, свету, прикосновениям, изменением и снижением аппетита, нарушением зрения, повышением температуры тела. Восприимчивые животные перестают пить, прячутся. Продромальная стадия длится от 12 часов до 3 суток.
  2. Стадия возбуждения характеризуется приступами агрессии, расстройствами чувствительности, оглумоподобным состоянием. Наблюдаются судороги, парезы жевательных мышц и мышц глотки, слюнотечение, сужение зрачков, затрудненное дыхание, учащенные позывы к мочеиспусканию, слабость. Стадия возбуждения длится от 3 до 4 суток.
  3. Стадия параличей характеризуется снижением или исчезновением болевой чувствительности, понижением температуры тела, слюнотечением, параличами глотки, языка, мышц челюсти и конечностей. Стадия параличей длится до 4 суток.

ЛЕЧЕНИЯ НЕТ! Исход болезни всегда заканчивается смертью!

Как происходит заражение бешенством?

Передача возбудителя осуществляется контактным путем (при покусе больным восприимчивым животным или при попадании его слюны на поврежденную кожу или слизистую оболочку). Факторами передачи возбудителя являются слюна больных восприимчивых животных, трупы павших от бешенства восприимчивых животных, материально-технические средства и объекты внешней среды, контаминированные возбудителем.

Дикие животные являются природным резервуаром многих инфекций, в том числе бешенства, миграция диких животных приводит к его распространению. Дикое животное – это особый биологический объект, действующий на основе рефлексов, его поведение подчинено природным инстинктам.

  • Будьте бдительны и осторожны!
  • Не подбирайте больных (сбитых) диких животных!
  • Не оказывайте им помощь самостоятельно!
  • Это может быть СМЕРТЕЛЬНО ОПАСНЫМ!

Есть ли опасность заболеть животным на территории Санкт‑Петербурга бешенством?

На территории Санкт‑Петербурга в течение многих лет сохраняется эпизоотическое благополучие по бешенству, но опасность заражения при вывозе животного в другие неблагополучные регионы по бешенству есть.
В ноябре 2017 года в Ленинградской области был установлен неблагополучный пункт по бешенству диких животных на территории Тихвинского района. Периодически случаи бешенства диких животных регистрируются на территориях Новгородской области и Псковской области.

Как уберечь домашнее животное от заболевания бешенством?

Самый простой способ предупредить болезнь – это своевременно привить животное против бешенства (см. памятку «Вакцинация собак против бешенства и заразных болезней: зачем, когда, где и как?»).

Почему вакцинация собак против бешенства является обязательной?

Обязанность владельцев животных обеспечить своевременное проведение профилактических мероприятий предусмотрена Законом Российской Федерации от 14.05.1993 «О ветеринарии», требованиями Федерального закона от 27.12.2018 № 498-ФЗ «Об ответственном обращении с животными и о внесении изменений в отдельные законодательные акты Российской Федерации», Приказом Минсельхоза России от 25.11.2020 № 705 «Об утверждении Ветеринарных правил осуществления профилактических, диагностических, ограничительных и иных мероприятий, установления и отмены карантина и иных ограничений, направленных на предотвращение распространения и ликвидацию очагов бешенства», Постановлением Главного государственного санитарного врача Российской Федерации от 06.05.2010 № 54 «Об утверждении СП 3.1.7.2627-10».

ПОМНИТЕ!

Если ваше животное укусило человека, не убегайте, а сообщите пострадавшему свой адрес и доставьте свое животное для осмотра и наблюдения в районную ветеринарную станцию!

За действия (бездействие), повлекшие за собой распространение бешенства, предусмотрены административная и уголовная ответственности.

ДЕЙСТВУЙТЕ!

Если Вы обладаете информацией, стали свидетелем, располагаете фактами о заболевании животных бешенством, о найденных трупах диких животных или Ваше животное заболело бешенством, немедленно информируйте об этом Государственную ветеринарную службу Санкт‑Петербурга.

Вылечить бешенство нельзя, а предупредить можно!

Контактные телефоны Государственной ветеринарной службы Санкт‑Петербурга: 403-03-00, 527-09-46, 527-50-43.

От кого заражались бешенством в России последние пять веков

Природные очаги вируса бешенства существовали в природе в течение всей истории человека, в том числе и на территории современной России. Здесь тоже с незапамятных времен люди заражались и умирали от бешенства (водобоязни). Но первое документальное свидетельство о заражении бешенством человека в Московском княжестве было сделано в 1534 году при правительнице-регенте Елене Глинской (матери Ивана IV Грозного). С тех пор можно с достаточной достоверностью проследить, какие животные заражали людей на территории нашей страны.

Собака

Гибель людей от бешенства при контактах с собаками постоянно регистрировалась с XVI века. Удельный вес собак в заражении человека с конца XIX до середины XX веков достигал 85%. В 1960–1970-е годы показатель снижался до 30–35%, а в начале XXI века вновь увеличился — до 43%.

Волк

Заражал людей на протяжении всех пяти веков. До Второй мировой войны эпидемическое значение волка доходило до 19%, а со второй половины XX и в XXI веке гибель людей от укусов волков варьировала в пределах 2–7% случаев.

Крупный рогатый скот

Инфицировал человека на протяжении всех пяти веков, но не часто — 0,3–2% случаев.

Лисица

О случаях заражения от лисиц до конца XVIII века в России не известно. Первые свидетельства гибели людей от бешенства после укусов этих животных датируются началом XIX века. Но с 1825 года случаи бешенства у людей при контактах с лисицами отмечать перестали. Снова лисицы начали заражать людей с 1940-х годов. В отдельные годы в период 1970–1990-х лисица была источником гидрофобии в 50–52% случаев. В XXI веке ее роль в инфицировании человека снижалась до 16%, но удельный вес вида в структуре зарегистрированных бешеных животных периодами возрастал почти до 50%.

Кошка

Роль кошек в заражении людей достоверно прослежена с конца XIX века и за последние 130 лет возросла с 2 до 18%.

Енотовидная собака

Начала заражать людей после Второй мировой войны (0,4%). Ее эпидемическая роль медленно возрастала и в XXI веке достигла 11%.

Мелкий рогатый скот, лошади и свиньи

Не менее 130 последних лет, то есть с конца XIX века представляли крайне редкую эпидемическую опасность.

Корсак, барсук, куница, хорек, песец

Заражали людей редко, но участвуют в эпидемическом процессе уже не менее 50 лет, а песец — 100 лет.

Летучие мыши

На территории России зафиксировано два случая смерти человека от бешенства после укуса летучей мыши — в 1985 и 2008 годах.

Грызуны

В России люди никогда не заражались бешенством от насекомоядных, а от грызунов только в трех случаях: от двух сусликов и одной белки.

Источник: «Зоологический журнал» РАН, 2019, No4, с.437–452

Ветврачи обнаружили очаг бешенства животных в городском округе Луховицы

Специалисты Управления государственного надзора в области обращения с животными и ветеринарного контроля Министерства сельского хозяйства и продовольствия региона совместно с сотрудниками Управления Федеральной службы по ветеринарному и фитосанитарному надзору и Управления Федеральной службы по надзору в сфере защиты прав потребителей и благополучия человека по Московской области провели эпизоотолого-эпидемиологическое обследование эпизоотического очага бешенства животных на территории городского округа Луховицы, сообщает пресс-служба регионального ведомства.

«Обследование проведено 15 февраля. Бешенство выявлено у собаки возрастом 15 лет, принадлежащей жителю поселка Фруктовая. При исследовании головного мозга обнаружен антиген вируса бешенства. С жалобой на изменение в поведении беспородной собаки в Луховицкую ветеринарную станцию обратился гражданин 10 января. Животное ранее против бешенства не вакцинировалось», — сообщил исполняющий обязанности министра сельского хозяйства и продовольствия Подмосковья Сергей Воскресенский.

Со слов владельца три недели назад они видели лисицу в населенном пункте. Территория земельного участка владельца собаки, не огорожена, что не исключает возможность контакта дикого плотоядного с домашним животным.

В связи с подозрением на заболевание бешенство собака была изолирована в карантинном помещении Луховицкой ветеринарной станции.

«В связи с возникновением нового случая бешенства животных Минсельхозпродом Московской области подготовлено Представление об установлении ограничительных мероприятий (карантина) по бешенству животных на территории городского округа Луховицы с целью дальнейшего установления ограничительных мероприятий», — отметил Воскресенский.

По его словам, с начала 2021 года на территории городского округа Луховицы Московской области это четвертый очаг заболевания бешенством.

«В данных четырех случаях диагноз установлен у домашних животных — собак, у которых имеются владельцы. Причиной заболевания домашних животных явилось отсутствие профилактической иммунизации против бешенства, во всех четырех случаях собаки не были вакцинированы против бешенства в нарушении требований ветеринарного законодательства РФ», — заключил Воскресенский.

Что делать, если в муниципалитете Подмосковья объявлен карантин по бешенству>>

бешенство

Источник: Министерство сельского хозяйства и продовольствия Московской области

В последние годы в России и Курская область, увы не исключение, наблюдается рост числа заболеваний бешенством

В последние годы в России и Курская область, увы не исключение, наблюдается рост числа заболеваний бешенством.
Это крайне опасное инфекционное заболевание, при котором развивается воспаление головного мозга (энцефалит). Бешенством болеют как животные, так и человек. У людей это заболевание называется гидрофобией. Вирус бешенства передаётся со слюной при укусе больным животным или же при попадании слюны на поврежденные участки кожи или слизистую оболочку. Распространяясь по нервным путям, вирус достигает слюнных желёз и головного мозга, вызывая тяжёлые необратимые нарушения.
При заражении бешенством первые симптомы могут появиться в период от семи суток до одного года. Продолжительность скрытого (инкубационного) периода заболевания зависит от ряда факторов, наиболее существенный из которых – удаленность места повреждения от мозга.
На начальном этапе (от появления первых признаков болезни до ее разгара, длительность 1 — 4 дня) заболевание проявляется повышением температуры, головной болью, утомляемостью, потерей аппетита. Отмечаются боли по ходу нервов, ближайших к месту укуса, повышенная чувствительность кожи в месте укуса, небольшие подергивания мышц.
На следующей стадии развития заболевания (4 — 7 дней) резко повышается чувствительность на малейшие раздражения органов чувств: яркий свет, различные звуки, шум. Больные становятся агрессивными, появляются галлюцинации, бред, чувство страха, судороги, частичная или полная обездвиженность мышц. Температура повышается до 40oС.
Затем наступает паралич глазных мышц, нарушается глотательная функция. Слюнотечение в сочетании с нарушением глотания приводит к появлению пены во рту. В половине случаев отмечается водобоязнь: при питье возникают резкие непроизвольные сокращения диафрагмы и других дыхательных мышц.
Для европейской части России, в том числе и для нашего региона, характерна неблагополучная обстановка по заболеваемости бешенством, что определяется природными и климатическими факторами.
Основным возбудителем бешенства на территории области считается красная лисица. Однако зарегистрированные случаи заражения бешенством распределяются поровну между дикими и домашними животными. Среди диких животных источниками заражения являются также волки, барсуки, летучие мыши, грызуны, ежи; среди домашних животных – кошки, собаки.
Как и большинство опасных для жизни заболеваний, бешенство легче предупредить, чем вылечить. В целях профилактики заражения домашние животные должны быть зарегистрированы в ветеринарной станции по борьбе с болезнями животных и в обязательном порядке обеспечены прививками от бешенства. Выводить собак на прогулки разрешается только на коротком поводке, а бойцовых или крупных — в наморднике. Их необходимо оберегать от контактов с бездомными животными.
При любом заболевании животного и, особенно, при появлении симптомов бешенства (обильное слюнотечение, затруднение глотания, судороги) немедленно обращайтесь в ближайшую ветеринарную станцию, ни в коем случае не занимайтесь самолечением. Это опасно не только для вашего домашнего животного, но и для окружающих.
Если ваш питомец укусил человека, не скрывайтесь, а сообщите пострадавшему свой адрес, и доставьте собаку или кошку для осмотра и наблюдения ветеринарным врачом ветеринарной станции. Наблюдение за животным длится десять дней.
В свою очередь, пострадавшим от укусов следует немедленно обратиться за медицинской помощью в лечебно-профилактическое учреждение для проведения курса антирабических прививок, и ни при каких обстоятельствах не прерывать назначенного курса лечения, соблюдая рекомендованный режим.
Гидрофобию (бешенство) человека можно предупредить только полным курсом профилактических прививок, эффективность которого зависит от срока обращения за медицинской помощью. Прививки против бешенства проводятся бесплатно. Следует отметить, что беременность не является противопоказанием для проведения курса профилактических прививок.
В медицинской практике применяется вакцина, которая практически не дает осложнений и вырабатывает высокий уровень иммунитета. Курс прививок отечественной антирабической вакциной составляет всего 6 уколов, вакцина вводится в дозе 1,0 мл в плечо. Прерванный курс прививок не дает гарантии защиты организма от бешенства.

   В Курске антирабическая помощь взрослым  оказывается  круглосуточно  —  в  травматологическом  пункте городской  клинической больницы скорой медицинской помощи (ул. Пирогова, 14, тел.: 52-98-75), детям – в  травматологическом пункте  городской детской клинической больницы № 2 (ул. Хуторская, 43-а, тел.: 53-65-07).
Помните, что бешенство – это абсолютно смертельное заболевание. Относитесь серьезно к своей жизни и к жизни и здоровью ваших родных и близких.

За последние полгода в Тульской области животные покусали больше 2 тысяч человек

По данным тульского Роспотребнадзора, в Тульской области за последние пол года животные покусали 2225 человек. Отметим, что это на 9% больше, чем в прошлом году.

Отмечается также, что случаи бешенства (гидрофобии) среди людей не регистрируются уже более 20 лет, а среди диких и домашних животных регистрируются ежегодно.

Так, только за 6 месяцев 2021 года на территории региона зарегистрировано 2 случая бешенства среди животных: 1 среди домашних животных и 1 среди бездомных бродячих животных.

В Роспотребнадзоре также отмечают, что бешенство (гидрофобия) – опасное, абсолютно смертельное вирусное заболевание, общее для человека и животных, с признаками поражения центральной нервной системы, которое в 100% случаев заканчивается летальным исходом.

Бешенством болеют практически все виды млекопитающих, в первую очередь – плотоядные животные (семейства собачьи, кошачьи, куньи, енотовые и др.), могут также болеть грызуны и летучие мыши. Они же являются источником бешенства для домашних животных. От заболевших животных, происходит заражение человека. Большую опасность в передаче инфекции представляют безнадзорные животные.

Заражение вирусом бешенства происходит через слюну больных животных, главным образом при укусах, а также через ссадины, царапины, ослюнения кожных покровов, слизистую оболочку глаз, полости рта, носа.

В городских условиях источником бешенства в большинстве случаев являются домашние и безнадзорные животные.

Как избежать заражения бешенством?

Чтобы не заразиться бешенством, необходимо соблюдать следующие простые правила:

· избегать контактов с дикими и бездомными домашними животными, не кормить их с рук, не гладить; разъяснять это детям во избежание заражения не только бешенством, но и другими опасными заболеваниями,

· строго соблюдать правила содержания собак, кошек и других животных, ежегодно делать им прививки против бешенства,

· проявлять настороженность в случае необычного поведения животного или без причины агрессивного поведения любого домашнего животного и сообщать об этом в ветеринарную службу,

· при обнаружении трупов животных, не трогать их, не снимать шкурку, а в обязательном порядке сообщить в ветеринарную службу,

· по возможности, животное, покусавшее или оцарапавшее человека, необходимо изолировать и вызвать специалиста ветеринарной службы для консультации и организации наблюдения за животным в течение 10 дней.

· немедленно после укуса обратиться к врачу травматологу или хирургу для принятия решения о проведении курса антирабических (против бешенства) прививок.

Важно помнить, что антирабическая вакцинация — единственное средство, которое может предотвратить развитие бешенства (гидрофобии) у человека и спасти жизнь.

Раннее (в течение 24 часов) начало вакцинации гарантирует формирование напряженного иммунитета. Противопоказаний для экстренной антирабической вакцинации нет. Курс состоит из 6 инъекций: в день обращения (0 день), затем на 3,7, 14, 30 и 90 день. В некоторых случаях вместе с антирабической вакциной назначается антирабический иммуноглобулин. Прививки против бешенства людям проводятся бесплатно. Ни в коем случае недопустимы самовольные перерывы в проведении вакцинации, прекращение или сокращение курса, иначе прививки будут неэффективны.

Вакцинация может быть прекращена, если животное остается здоровым спустя 10 дней наблюдения, или у павшего животного не обнаруживается вирус бешенства при лабораторном обследовании.

Для получения специфического антирабического лечения после укуса животного необходимо как можно раньше обратиться в травматологический пункт ГУЗ «Тульская городская клиническая больница скорой медицинской помощи им. Ваныкина» по адресу: г. Тула, ул. Первомайская, д. 13, корп. 1 (телефон 71-49-49, доб. 318, 365 круглосуточно) или в ЛПУ по месту жительства.

Эпиднадзор за бешенством в Российской Федерации

Бешенство эндемично для Российской Федерации. Заболеваемость колеблется от 2 000 до 4 000 случаев ежегодно. Также ежегодно регистрируется от двух до шести случаев заболевания людей. Дикие животные являются основным резервуаром и переносчиком вируса, а заболеваемость бешенством лисиц и енотовидных собак составляет 50% от общего числа случаев заболевания. Когда случаются вспышки, болезнь регистрируется и у домашних животных.Для предотвращения дальнейшего распространения бешенства практикуются вакцинация домашних животных и оральная иммунизация диких животных. К сожалению, охвата вакцинацией и мер по профилактике заболеваний оказалось недостаточно для заметного улучшения ситуации с бешенством в стране.

La rage est présente à l’état endémique dans la Fédération de Russie. Заболеваемость сыном варьируется от 2 000 до 4 000 по номиналу.Deux à six cas de rage humaine sont également enregistrés chaque année. Les animaux sauvages, составляющие основной резервуар и вектор вируса, l’incidence de la rage chez le renard et le chien viverrin, представляют 50% от общего количества вирусов. En cas de foyer, la maladieffecte également les animaux Homestiques. «Вакцинация домашних животных и иммунизация оральной фауны с сохранением двойных мер». Malheureusement, la couverture vacinale obtenue et les mesures de prevention appliquées n’ont pas suffi à améliorer сигнификатор ситуации гнева.

La rabia es endémica en la Federación de Rusia, con una incidencia que va de los 2 000 and los 4 000 casos anuales. Cada año se notifican entre dos y seis casos en el ser humano. Los animales silvestres является основным резервным вектором вируса: инцидентная активность и карты, поддерживающие 50% totalidad de los casos. Cuando estallan brotes también se registran casos en animales domésticos.Para impedir que la enfermedad se siga provando seprode a la vacunación de los animales domésticos y a la inmunización oral de la fauna silvestre. Lamentablemente, la cobertura de vacunación y las medidas de preventción no han bastado para lograr una mejora sust financial de la situación de la rabia.

Ключевые слова: Заболеваемость; Лабораторная диагностика; Оральная иммунизация; Бешенство; Российская Федерация; Наблюдение.

Филодинамика вируса бешенства в Российской Федерации

PLoS One. 2017; 12 (2): e0171855.

, 1, 2, 3, * , 2, 4, 5 , 6 , 1, 3 , 7 , 6, 8 , 2 , 9 , 9, 10 и 1

Девяткин Андрей Анатольевич

1 Федеральный бюджетный научный институт Центральный научно-исследовательский институт эпидемиологии, Москва, Российская Федерация

2 Федеральный бюджетный институт Институт полиомиелита и вирусных энцефалитов им. Чумакова, Москва, Российская Федерация

3 Научно-исследовательский институт гигиены труда, Москва, Российская Федерация

Александр Н.Лукашев

2 Федеральный бюджетный институт Институт полиомиелита и вирусных энцефалитов им. Чумакова, Москва, Российская Федерация

4 Институт молекулярной медицины Первого МГМУ им. И.М. Сеченова, Москва, Россия

5 РУДН, Москва, Россия

Полещук Елена Михайловна

6 Институт природноочаговых инфекций, Омск, Российская Федерация

Владимир Григорьевич Дедков

1 Федеральный бюджетный научный институт Центральный научно-исследовательский институт эпидемиологии, Москва, Российская Федерация

3 Научно-исследовательский институт гигиены труда, Москва, Российская Федерация

Сергей Е.Ткачев

7 Институт химической биологии и фундаментальной медицины Сибирского отделения Российской академии наук (ИХБФМ СО РАН), Новосибирск, Российская Федерация

Сидоров Геннадий Николаевич

6 Институт природно-очаговых инфекций, Омск, Российская Федерация

8 Омский государственный педагогический университет, г. Омск, Российская Федерация

Галина Григорьевна Карганова

2 Федеральный бюджетный институт Институт полиомиелита и вирусных энцефалитов им. Чумакова, Москва, Российская Федерация

Ирина ВалерьевнаГалкина

9 Дальневосточный федеральный университет, Владивосток, Российская Федерация

Михаил Ю. Щелканов

9 Дальневосточный федеральный университет, Владивосток, Российская Федерация

10 Биолого-почвенный институт ДВО РАН, Владивосток, Российская Федерация

Герман А. Шипулин

1 Федеральный бюджетный научный институт Центральный научно-исследовательский институт эпидемиологии, Москва, Российская Федерация

Массимо Чиккоцци, редактор

1 Федеральный бюджетный научный институт Центральный научно-исследовательский институт эпидемиологии, Москва, Российская Федерация

2 Федеральный бюджетный институт Институт полиомиелита и вирусных энцефалитов им. Чумакова, Москва, Российская Федерация

3 Научно-исследовательский институт гигиены труда, Москва, Российская Федерация

4 Институт молекулярной медицины Первого МГМУ им. И.М. Сеченова, Москва, Россия

5 РУДН, Москва, Россия

6 Институт природноочаговых инфекций, Омск, Российская Федерация

7 Институт химической биологии и фундаментальной медицины Сибирского отделения Российской академии наук (ИХБФМ СО РАН), Новосибирск, Российская Федерация

8 Омский государственный педагогический университет, г. Омск, Российская Федерация

9 Дальневосточный федеральный университет, Владивосток, Российская Федерация

10 Биолого-почвенный институт Дальневосточного отделения Российской академии наук, Владивосток, Российская Федерация

Национальный институт здравоохранения, ИТАЛИЯ

Конкурирующие интересы: Авторы заявили об отсутствии конкурирующих интересов.

  • Концепция: AAD ANL EMP VGD GAS.

  • Формальный анализ: AAD ANL EMP GGK.

  • Расследование: AAD ANL EMP SET GNS VGD.

  • Ресурсы: EMP GNS GGK SET IVG MYS GAS.

  • Написание — оригинальная версия: AAD ANL.

  • Написание — просмотр и редактирование: AAD ANL EMP GGK.

Поступила 23.11.2016; Принята в печать 26 января 2017 г.

Это статья в открытом доступе, распространяемая в соответствии с условиями лицензии Creative Commons Attribution License, которая разрешает неограниченное использование, распространение и воспроизведение на любом носителе при условии указания автора и источника. Эта статья цитируется другими статьями в PMC. .
Дополнительные материалы

S1 Рис. Филогенетическое дерево максимального правдоподобия расширенного набора данных последовательностей N-гена вируса бешенства. (TIF)

GUID: 077E317E-0533-40CB-8F06-19246419E332

S2 Рис. Средняя протяженность морского льда в сентябре 2015 г. (слева) и в марте 2015 г. (справа) иллюстрируют соответственно минимальную и максимальную протяженность.Пурпурная линия указывает среднюю протяженность льда в сентябре и марте, соответственно, в период с 1981 по 2010 год. Карты были получены из Национального центра данных по снегу и льду (NSIDC) по адресу http://www.nsidc.org/data/seaice_index .

(TIF)

GUID: BB8680FB-FBB8-4A8F-85EF-9429B76E28CD

S3 Рис: (A) Зарегистрированные случаи бешенства среди млекопитающих в 1991 г. (за исключением бешенства летучих мышей). (B) Зарегистрированные случаи бешенства у млекопитающих в 2014 г. (за исключением бешенства летучих мышей). (C) Кампании ORV диких животных в 2005–2014 гг. [Информационная система по бешенству Центра сотрудничества ВОЗ по эпиднадзору и исследованиям бешенства, http: // www.who-rabies-bulletin.org/Queries/Maps.aspx].

(TIF)

GUID: F29B5836-36B4-4A05-801C-37C9D16BE609

S1 Файл: (Таблица A) Последовательности нуклеопротеинов вируса бешенства, использованные в этом исследовании. (DOC)

GUID: 45E76844-4D81-45D8-8BED-B3BF43DBFB5C

Заявление о доступности данных

Все соответствующие данные находятся в документе и файлах вспомогательной информации.

Реферат

Почти полные последовательности N гена вируса бешенства (1110 нуклеотидов) были определены для 82 изолятов, полученных из разных регионов России в период с 2008 по 2016 год.Эти последовательности были проанализированы вместе со 108 репрезентативными последовательностями GenBank с 1977 по 2016 год с использованием подхода байесовской коалесценции. Было оценено время основных эволюционных событий. Большинство изолятов представляли группу C степного вируса бешенства, который был обнаружен в обширном географическом регионе от Центральной России до Монголии и разделен на три группы (C0-C2) с дискретной географической распространенностью. Единственный штамм линии степного вируса бешенства был выделен на Дальнем Востоке России (Приморский край), вероятно, в результате недавнего антропогенного заноса.Впервые группа полярного вируса бешенства А2, о которой ранее сообщалось на Аляске, была описана в северной части европейской части России и на Земле Франца-Иосифа. Филогенетический анализ показал, что все группы вирусов бешенства, циркулирующие в настоящее время в Российской Федерации, были интродуцированы в течение нескольких последних столетий, при этом большинство групп распространилось в 20–900–16–900 гг. Датировка эволюционных событий полностью соответствовала историческим эпидемиологическим данным.

Введение

Бешенство — это зоонозное вирусное заболевание, которое приводит к летальному исходу при развитии клинических проявлений.Классический вирус бешенства, RABV, представляет собой вирус оцРНК с отрицательным смыслом, принадлежащий к отряду Mononegavirales , семейству Rhabdoviridae (от латинского rhabdos , что означает «палочка», поскольку представители этого семейства имеют палочковидные вирионы. ), и род Lyssavirus (Lyssa, древнегреческая богиня, олицетворение бешенства). Геном RABV состоит из пяти генов, кодирующих белок: N, P, M, G и L. Эти гены разделены межгенными участками переменной длины.Ген N обычно используется для филогенетического анализа [1].

Несмотря на значительный прогресс в борьбе с бешенством во всем мире [2] и успешные программы его искоренения в Западной Европе [3], бешенство остается важной проблемой общественного здравоохранения, вызывая потерю более двух миллионов лет жизни с поправкой на инвалидность (DALY) в год, а также ежегодные экономические затраты более 4 миллиардов долларов США в год [4]. Большинство случаев бешенства среди людей (примерно 50 000 в год) происходит в Африке и Азии [5]. Предполагается, что официальные статистические данные сильно занижены из-за отсутствия систематического надзора в некоторых странах [6].

В период с 2007 по 2011 год в Российской Федерации было зарегистрировано 22 264 случая бешенства среди животных (49,0% диких животных, 30,0% домашних животных, 19,9% сельскохозяйственных животных, 1,1% других) и 67 случаев заболевания людей. бешеных животных и ежегодно получают постконтактную профилактику [7, 8].

Генетическое разнообразие вируса бешенства во всем мире имеет четкую географическую структуру, которая является результатом недавнего распространения вируса [9]. Все известные в настоящее время вирусы бешенства в мире можно разделить на семь основных групп [10].Две из этих групп, Cosmopolitan и Arctic / Arctic-like, циркулируют в Российской Федерации. В рамках этих двух основных групп в России были зарегистрированы представители шести меньших групп [11–16]: A. Арктическое бешенство (северные части Сибири), B. Арктическое бешенство (Хабаровский край, Забайкальский край), C. степное бешенство. (Евразийская степь), D. Центральноевропейское бешенство России, E. Северо-восточноевропейское бешенство и F. Кавказское бешенство.

Целью настоящего исследования было изучить филодинамику вируса бешенства в Российской Федерации, чтобы лучше понять характер и время распространения вируса.

До этой работы 227 уникальных последовательностей N-гена вируса бешенства из России (согласно описанию последовательности) были доступны в GenBank, и только 110 последовательностей были длиннее 400 нуклеотидов. Мы секвенировали 81 штамм из коллекции НИИ природноочаговых инфекций (Омск, Россия), что почти вдвое увеличило количество доступных последовательностей. Еще один изолят был получен из национального парка «Русская Арктика» на Земле Франца-Иосифа. Хотя изоляты вируса систематически не собирались по всей стране, набор данных представлял 18 из 85 регионов как европейской, так и азиатской части России.

Материалы и методы

Почти полные последовательности N-гена (1110 нуклеотидов) изолятов RABV были идентифицированы секвенированием по Сэнгеру после полимеразной цепной реакции (ПЦР) с олигонуклеотидами N1-F ( ATGGATGCCGACAAGATTG ) / N1-R ( ATAGATGCTCAATCCGGGAG ) и N2-F ( ATGACAACTCACARAATGTGTGC ) / N2-R ( CCTCCATTCATCATGATTCG ). Номера доступа представлены в таблице A в файле S1.

Для филогенетического анализа были использованы все доступные последовательности с известными датами сбора, содержащие позиции от 100 до 1209 N-гена.К сожалению, значительное количество последовательностей не подходило для байесовского объединенного филогенетического анализа из-за неизвестной даты сбора. Затем из набора данных были исключены почти идентичные последовательности. В некоторых случаях короткие или не полностью аннотированные последовательности несли важную эпидемиологическую информацию. Филогенетическое положение таких последовательностей оценивали реконструкцией максимального правдоподобия с использованием программного обеспечения MEGA 6.0 (S1 Рис). Общая модель замещения с обратимой во времени (GTR), включающая долю неизменных сайтов (I) и гамма-распределение вариации скорости между сайтами (G4), оказалась наиболее подходящей для данных в соответствии с информационным критерием Акаике.При необходимости эти последовательности обсуждаются в тексте, но не показаны на рисунках.

Все доступные нуклеотидные последовательности (по состоянию на 4 июля 2016 г.), содержащие слова «бешенство» и «нуклеопротеин» в поле определения (12051 последовательность), были загружены из GenBank. Все последовательности короче 1110 нуклеотидов, последовательности без даты выделения и неправильно аннотированные последовательности были удалены. Поскольку в России циркулируют только две из основных групп вирусов бешенства, мы выделили всех представителей группы Cosmopolitan (нуклеотидные последовательности, которые отличались от записи GenBank {«type»: «entrez-нуклеотид», «attrs»: {«text»: » KC538853 «,» term_id «:» 478734932 «,» term_text «:» KC538853 «}} KC538853 не более чем на 6%) и арктической / арктической группе (которая отличалась от записи GenBank {» type «:» entrez- нуклеотид «,» attrs «: {» text «:» KY002890 «,» term_id «:» 1159608599 «,» term_text «:» KY002890 «}} KY002890 не более чем на 9%).Все последовательности, которые отличались от любой другой последовательности в наборе данных менее чем на 0,1% нуклеотидной последовательности, были опущены. Большинство последовательностей, принадлежащих к группам, не циркулирующим в Российской Федерации, также были исключены из дальнейшего анализа. Запись GenBank {«type»: «entrez-nucleotide», «attrs»: {«text»: «JQ685915», «term_id»: «393801511», «term_text»: «JQ685915»}} JQ685915 (летучая мышь RABV Северной Америки) был включен как чужая группа. Последовательности # {«type»: «entrez-нуклеотид», «attrs»: {«text»: «FJ424484», «term_id»: «213391767», «term_text»: «FJ424484»}} FJ424484, {«type»: «entrez-нуклеотид», «attrs»: {«text»: «U43433», «term_id»: «4096990», «term_text»: «U43433»}} U43433, {«type»: «entrez-нуклеотид», » attrs «: {» text «:» U22475 «,» term_id «:»

9 «,» term_text «:» U22475 «}} U22475, {» type «:» entrez-нуклеотид «,» attrs «: {» text » : «U22840», «term_id»: «5″, «term_text»: «U22840»}} U22840, {«type»: «entrez-нуклеотид», «attrs»: {«text»: «JF973787», «term_id» «:» 337752485 «,» term_text «:» JF973787 «}} JF973787, {» type «:» entrez-нуклеотид «,» attrs «: {» text «:» JF973796 «,» term_id «:» 337752503 «,» term_text «:» JF973796 «}} JF973796, {» type «:» entrez-нуклеотид «,» attrs «: {» text «:» KU198463 «,» term_id «:» 1024250003 «,» term_text «:» KU198463 «} } KU198463, {«type»: «entrez-нуклеотид», «attrs»: {«text»: «KU198471», «term_id»: «1024250051», «term_text»: «KU198471»}} KU198471, {«type» : «entrez-нуклеотид», «attrs»: {«text»: «KU198469», «term_id»: «1024250039», «term_text»: «KU198469»}} KU198469 и {«type»: » entrez-nucleotide «,» attrs «: {» text «:» U11375 «,» term_id «:» 508932 «,» term_text «:» U11375 «}} U11375 были добавлены искусственно с целью расширения набора данных.

Множественное выравнивание последовательностей выполняли с использованием MUSCLE, как это реализовано в программе MEGA 6.0 [17]. Регистрационные номера GenBank для всех изолятов RABV, проанализированных в этом исследовании, представлены в таблице A в файле S1. Окончательный набор данных состоял из 108 последовательностей.

Совмещение было проверено на рекомбинацию с использованием программы обнаружения рекомбинации (RDP) версии 4 [18].

Модель замещения на основе обратимого скачка использовалась для выбора модели замещения и оценки соответствующего количества параметров, в то время как выборка дерева [19] использовалась для байесовского коалесцентного анализа.Затем различные предположения о часах и модели населения сравнивались с помощью теста факторов Байеса. Наивысший байесовский фактор наблюдался в комбинации некоррелированных логнормальных расслабленных часов и модели постоянной популяции, хотя не было значительных различий между оценками для других комбинаций двух часов (строгие и расслабленные часы) и трех моделей популяции (постоянная, экспоненциальная). , и байесовский горизонт). Анализ цепи Маркова методом Монте-Карло был выполнен для 100 миллионов поколений (выборка проводилась каждые 10 000 поколений).

Сходимость оценок параметров была проверена с помощью Tracer (v1.5) и обозначена эффективным размером выборки> 200. Максимальные деревья достоверности кладов были аннотированы с помощью TreeAnnotator (v2.4.2) после того, как начальные 10% деревьев были отброшены. Полученное дерево было визуализировано с помощью FigTree (v1.4.2).

Визуализация распространения вируса бешенства на территории Российской Федерации проводилась с помощью ArcGis (ESRI ArcGis версии 10.4.1). Каждая точка указывает на наличие обозначенной группы вируса бешенства.Из-за отсутствия точной географической информации точность ограничена административными районами первого уровня.

Результаты

Перед филогенетическим анализом набор данных был протестирован на рекомбинацию. Доказательства рекомбинации в последовательности {«type»: «entrez-нуклеотид», «attrs»: {«text»: «U43432», «term_id»: «4096988», «term_text»: «U43432»}} U43432 был обнаружен методом MaxChi [20] и подтверждено филогенетической реконструкцией (данные не показаны). Значение этого изолированного открытия трудно интерпретировать.Чтобы не повлиять на филогенетический анализ, последовательность была исключена из набора данных.

Средняя скорость нуклеотидных замен, рассчитанная с использованием набора данных N-гена, составила 2,47 * 10 -4 [95% наибольшая апостериорная плотность (HPD) = 1,82–3,12 * 10 -4 ] нуклеотидных замен на сайт /год. Скорость согласуется с предыдущей оценкой скорости замены N-гена RABV, которая составляла 2,3 * 10 -4 [95% HPD = 1,1-3,6 * 10 -4 замен / сайт / год] [9].

На территории Российской Федерации циркулировали две основные линии вируса бешенства: арктическое / арктическое бешенство (группы A и B согласно ранее предложенной классификации [11]) и космополитическое бешенство (группы C, D, E и F. ) ().

Байесовский филогенетический анализ почти полных последовательностей N-генов штаммов вируса бешенства, циркулирующих в Российской Федерации.

Шкала показывает время в годах. Филиалы имеют цветовую маркировку в соответствии с описанными группами. Апостериорные вероятности узлов выше 95% показаны черными квадратами в соответствующих узлах. Апостериорные вероятности от 80 до 95% обозначены числами. Апостериорные вероятности ниже 80% не указываются. Последовательности, полученные в данном исследовании, выделены жирным шрифтом.

Филогенетический анализ показал, что самый последний общий предок (MRCA) всех вирусов, циркулирующих в настоящее время в Российской Федерации, существовал в 1670 году [1560–1782].

Группы C, D, E и F (современные российские космополитические вирусы бешенства) являются потомками своего предка, который, скорее всего, существовал около 1849 года [1796–1894]. Эти группы не были равномерно представлены в нашем наборе данных.

Группа D включала семь изолятов из центральноевропейского региона России. Эти изоляты имели общего предка в 1969 [1950–1986] и были тесно связаны с вирусом, изолированным в Венгрии в 1991 году.MRCA этих вирусов и венгерского изолята датируется 1941 годом [1915–1966]. Следовательно, данная группа, вероятно, была завезена в Россию в период с 1915 по 1986 г. (крайние границы интервалов HPD).

Большинство российских изолятов, секвенированных в данной работе (66/78), и большинство последовательностей GenBank из России в окончательном наборе данных (44/64) принадлежали к группе C. Один вирус, выделенный от кошки в Белгородской области. в 1991 г. ({«type»: «entrez-nucleotide», «attrs»: {«text»: «AY352456», «term_id»: «38017834», «term_text»: «AY352456»}} AY352456) был из внешней группы в группе C.Мы предлагаем рассматривать этот штамм как представителя независимой подгруппы вируса бешенства C0. Остальные вирусы группы C были сгруппированы вместе с апостериорной вероятностью 1,0 и разделены на две подгруппы (C1 и C2). MRCA этих подгрупп существовали примерно в 1948 году [1929–1964].

Подгруппа C1 не имела надежной поддержки (апостериорная вероятность 0,55) и могла быть альтернативно определена как «все вирусы группы C, которые не входили в подгруппы C0 или C2». В него вошли 23 вируса, в основном изолированные к западу от Тянь-Шаня и Горного Алтая ().Подгруппа C1 может быть подразделена на кластеры C1a и C1b, которые поддерживались с апостериорной вероятностью 1,0. Кластер C1a преобладал в степных и лесостепных экологических регионах европейской части России (Липецкая, Воронежская, Белгородская, Краснодарская, Волгоградская, Брянская, Саратовская области, Республика Дагестан), в Казахстане (Западно-Казахстанская область). и в центральных и восточных регионах Украины (S1 рис.). Представители кластера C1b были обнаружены в Омской, Астраханской, Оренбургской, Башкортостанской, Нижегородской областях, Казахстане, Актюбинской, Алматинской и Восточно-Казахстанской областях, а также в Синьцзян-Уйгурской автономной области Китая.

Распространение генотипов вируса бешенства в Российской Федерации и странах ближнего зарубежья.

Указано географическое распространение филогенетических групп вируса бешенства. Точность ограничена административными округами первого уровня.

Подгруппа C2 (апостериорная вероятность 1,0) включала 38 штаммов, в основном изолированных к востоку от линии Астана-Ташкент. Было частичное совпадение в распределении подгрупп C1 и C2 (). Подгруппа C2 разделена на три географически дискретных кластера.Первый кластер (C2c) обнаружен в Омской области (Россия) и Алматинской области (Казахстан), а второй (C2a) циркулировал на территории Южной Сибири (Бурятия, Хакасия, Республика Тыва, Омск и Красноярск). регионы), Казахстан (Алматинская область), Китай (регион Внутренней Монголии) и Монголия (Завхан, Гови-Алтайская и Хубсугулская области). Кластер C2b преобладал в России (Алтайский край и Омская область), Монголии (Хубсугулская область) и Казахстане (Алматинская и Восточно-Казахстанская области) (рис. И).Поддержка апостериорной вероятности для кластеров C2a, C2b и C2c составила 0,83, 0,91 и 1,0 соответственно.

Группа E включала три вируса из северо-западной части России, которые были тесно связаны с вирусом, изолированным в Эстонии в 1991 году. В целом группа E соответствует ранее описанной группе Северо-Восточной Европы [21]. MRCA российских представителей группы Северо-Восточная Европа существовала примерно в 1974 году [1962–1983]. MRCA этих вирусов и эстонского изолята существовали в 1920 году [1889–1950].

Группа E (Северо-Восточная Европа) была тесно связана с группами Западной, Восточной и Центральной Европы. MRCA групп Северо-Восточной, Западной, Восточной и Центральной Европы существовали примерно в 1889 году [1858–1924].

Группа F (Кавказское бешенство) включала два вируса из Краснодарского края и Дагестана. Эти вирусы, по-видимому, произошли от общего предка, существовавшего примерно в 1992 году [1979–2004]. Другие представители этой группы были обнаружены на Ближнем Востоке (Ирак, Иран и Турция).Иранский штамм ранее был описан как принадлежащий к филогруппе вируса бешенства Иран-1a [22]. MRCA группы F существовала примерно в 1966 году [1947–1983].

Группы A (арктическое бешенство) и B (арктическое бешенство) разошлись примерно в 1806 году [1732–1871]. Группа арктического бешенства А ранее была разделена на четыре подгруппы: Арктика-1 (А1), Арктика-2 (А2), Арктика-3 (А3) и Арктика-4 (А4). Arctic-1 состоит из штаммов, циркулирующих только в провинции Онтарио, Канада. Представители подгруппы Arctic-4 были обнаружены только в американском штате Аляска.Подгруппы Арктик-2 и Арктик-3 распространены на нескольких обширных территориях: северная часть Якутии, Аляска (A2), северная часть Красноярского края, Канада и Гренландия (A3) [23–25]. По нашим данным, подгруппа A2 возникла в 1979 г. [95% HPD 1973–1985], а подгруппа A3 возникла в 1971 году [1962–1979]. MRCA подгрупп A2 и A3 возникли примерно в 1960 году [1946–1972]. Эти результаты согласуются с предыдущими оценками с использованием N-гена [24]. Однако в другом исследовании [23] все таймфреймы были оценены как значительно более ранние.Причина такого несоответствия неясна.

Интересно, что некоторые представители подгруппы A2 ({«type»: «entrez-нуклеотид», «attrs»: {«text»: «EF611834», «term_id»: «156620229», «term_text»: «EF611834» }} EF611834, {«type»: «entrez-нуклеотид», «attrs»: {«text»: «EF611837», «term_id»: «156620235», «term_text»: «EF611837»}} EF611837, {«type «:» entrez-нуклеотид «,» attrs «: {» text «:» EF611840 «,» term_id «:» 156620241 «,» term_text «:» EF611840 «}} EF611840, {» type «:» entrez-нуклеотид » , «attrs»: {«text»: «EF611836», «term_id»: «156620233», «term_text»: «EF611836»}} EF611836, {«type»: «entrez-нуклеотид», «attrs»: {» text «:» EF611832 «,» term_id «:» 156620225 «,» term_text «:» EF611832 «}} EF611832, {» type «:» entrez-нуклеотид «,» attrs «: {» text «:» EF611835 «, «term_id»: «156620231», «term_text»: «EF611835»}} EF611835, {«type»: «entrez-нуклеотид», «attrs»: {«text»: «EF611839», «term_id»: «156620239» , «term_text»: «EF611839»}} EF611839 и {«type»: «entrez-nucleotide», «attrs»: {«text»: «EF611838», «term_id»: «156620237», «term_text»: » EF611838 «}} EF611838) [23] были изолированы в Якутской области. n в 1950–1960 гг. (поскольку точные даты неизвестны, эти последовательности были исключены из байесовского анализа).Предполагаемое появление нынешней подгруппы А2 кажется правильным, поскольку современные штаммы вируса бешенства, очевидно, не были потомками этой группы, как представлено этими архивными изолятами (данные не показаны). Судя по всему, якутская группа вымерла в соответствии с MRCA нынешних представителей подгруппы A2 в 1979 г. (95% HPD 1973–1985).

В данной работе представители подгруппы Арктика-2 были обнаружены в северной части Европейского региона России (Ненецкий автономный округ, Республика Коми) и на Земле Франца-Иосифа.Ранее случаев бешенства на Земле Франца-Иосифа не регистрировалось. В 2016 году во время мониторинга упавших животных на природном курорте Земля Франца-Иосифа была обнаружена туша песца ( Vulpes lagopus ) в неестественной позе. Инфекцию бешенства подтверждали с помощью ПЦР с обратной транскриптазой. Затем штамм вируса был выделен из ткани мозга и полностью секвенирован (за исключением 5 ’и 3’ концов). Последовательность генома была депонирована в GenBank (номер доступа {«type»: «entrez-нуклеотид», «attrs»: {«text»: «KX954123», «term_id»: «1159608026», «term_text»: «KX954123»} } KX954123).

Обсуждение

Основная цель этого исследования заключалась в предоставлении всестороннего понимания циркуляции вируса бешенства в Российской Федерации. Для выяснения филогенетических отношений между различными вирусными группами мы использовали 64 последовательности из 21 из 85 административных регионов как европейской, так и азиатской частей России и 45 последовательностей из 16 соседних стран, которые охватывают период с 1977 по 2016 год.

Степное бешенство группы С было наиболее распространенным в Российской Федерации.Он циркулирует в степных и лесостепных экологических регионах Евразии, и его основными резервуарами являются лисы ( Vulpes vulpes и Vulpes corsac ). В нашем наборе данных группа C состояла из 61 вируса, который был изолирован на большой территории и за последние 70 лет разошелся с MRCA, существовавшим примерно в 1948 году. В первой половине 20 века бешенство регистрировалось преимущественно у волков. , кошки и собаки. Первые случаи бешенства в Астраханской области (юг России) были зарегистрированы в 1942 г. у енотовидной собаки ( Nyctereutes procyonoides ).За этим последовала вспышка бешенства среди лисиц в Астраханской области в 1946 г. [26]. Это были первые задокументированные случаи бешенства лисиц в СССР [27]. Согласно историческим статистическим данным, некоторые авторы предположили, что быстрое распространение группы степного бешенства началось в Астраханской области, а затем распространилось на другие территории с аналогичными экологическими условиями со средней скоростью 40–60 км / год [28]. В 1949 г. в Казахстане было зарегистрировано бешенство лисиц. В Южной Сибири (Новосибирск) первые вспышки бешенства лисиц произошли в 1958 г. [11].Этот исторический образец распространения бешенства и гипотеза о подгруппах C1 / C2, возникших в начале 1940-х годов, были поддержаны результатами объединенного байесовского филогенетического временного анализа. По оценкам, MRCA подгруппы степного бешенства C1 / C2 существовала в 1948 году [1929–1964]. Более того, исторические свидетельства возникновения бешенства в Новосибирске в 1958 году укладываются в временные рамки вероятного MRCA подгруппы C2 в 1956 году [1941–1970]. В эту подгруппу входят вирусы, выделенные в Омской и Красноярской областях, граничащих с Новосибирской областью с запада и востока соответственно.

Практически мгновенное распространение группы степного бешенства на обширных евразийских степях и лесостепях произошло примерно в 1940-х и 1950-х годах и могло отражать эволюционную модель так называемого «большого биологического взрыва» в небольшом масштабе [29,30]. Эта гипотеза предполагает, что в эволюционном процессе существуют две качественно различные фазы: инфляционная фаза (создаются новые разнообразные группы) и фаза медленной эволюции. В 1940-х и 1950-х годах интенсивная миграция людей на территорию бывшего СССР происходила по социально-экономическим причинам.Вероятно, что животные, несущие предков вируса степного бешенства, также были транспортированы и контактировали с восприимчивой и наивной местной популяцией животных. Введение патогена в новую экологическую нишу (переход хозяина к популяции лисиц) может привести к быстрому распространению и диверсификации вируса на новых территориях (инфляционная фаза эволюции, ведущая к созданию географически дискретных сетей мутантов). Поскольку бешенство хорошо известно во всех странах мира, вполне возможно, что подобное увеличение популяции вируса происходило ранее, но не оставило следов из-за последующего исчезновения большинства вариантов вируса.

Важность гипотетических антропогенных факторов в молекулярной эволюции бешенства подчеркивается изолированием степного кластера C1a на Дальнем Востоке России. Ранее сообщалось о циркуляции только арктических штаммов вируса бешенства (группа B) в южной части Дальнего Востока России [11]. Нападение бурого медведя ( Ursus arctos ) было зарегистрировано в ноябре 2014 года в Хасанском районе Приморского края (у побережья Тихого океана). Девиантное поведение медведя привело к подозрению, что животное было бешеным.Заболевание было подтверждено несколькими методами [31,32], вирус был выделен и секвенирован (инвентарный номер {«type»: «entrez-nucleotide», «attrs»: {«text»: «KP997032», «term_id»: «924878578», «term_text»: «KP997032»}} KP997032). Примечательно, что этот штамм принадлежал к кластеру западного степного бешенства C1a. Наиболее генетически родственные штаммы выделены в степных районах европейской части России (Липецкая и Воронежская области) и в Западно-Казахстанской административной области (). Например, дальневосточный медведь изолирует {«type»: «entrez-нуклеотид», «attrs»: {«text»: «KP997032», «term_id»: «924878578», «term_text»: «KP997032»}} KP997032 и {«type»: «entrez-нуклеотид», «attrs»: {«text»: «KT965737», «term_id»: «1016572230», «term_text»: «KT965737»}} изолят KT965737, полученный в 2014 году на Западе. Казахстанская область доля 99.67% идентичности нуклеотидной последовательности во фрагменте N-гена длиной 1228 нуклеотидов. MRCA этих двух вирусов существовала в 2004 г. [1997–2012 гг.]. Расстояние между Приморским краем и Оралом (столицей Западно-Казахстанской области) составляет 5 800 км. Другие расходящиеся члены группы C были распространены в Южной Сибири, Казахстане, Монголии и северо-западных провинциях Китая (). Таким образом, антропогенный перенос вируса, произошедший менее 20 лет назад, является наиболее вероятным механизмом появления вируса бешенства группы С на юге Дальнего Востока России.

Сообщается, что в Европе эволюция вируса бешенства претерпела две исторические смены хозяев [21]. Первый произошел, когда вирус перешел от собак к лисам, гипотетически в первые десятилетия 20-го века [33]. Это предполагаемое событие соответствует общему предку групп WE, EE, CE и E (Западная, Восточная, Центральная и Северо-Восточная Европа, соответственно). Предполагаемый MRCA этих широко распространенных европейских подгрупп вируса бешенства существовал примерно в 1889 году [1858–1924], что согласуется с эпидемиологической гипотезой.Миграция бешеных лисиц на запад от бывшей советско-польской границы регистрируется с 1939 года. Согласно анализу молекулярных часов, MRCA штаммов вируса бешенства, выделенных в Польше и Германии (подгруппа Центральной Европы), а также во Франции и Италии (подгруппа Западной Европы) ) существовало примерно в 1939 г. [1919–1958], что также соответствует натурным наблюдениям [34].

Вторая смена хозяев произошла в Северо-Восточной Европе, когда вирус бешенства колонизировал енотовидных собак.В период с 1928 по 1957 год примерно 9 100 животных были завезены из Восточной Азии в более чем 70 районов бывшего СССР в попытке обогатить фауну промысловыми пушными зверями [35]. Енотовидные собаки успешно заселили западные районы бывшего СССР. Сегодня этот чужеродный вид вторгся в большую часть Европы (от России на востоке до Германии на западе, от Финляндии на севере до Словакии и Молдовы на юге). Группа вируса бешенства E (NEE по другой классификации [11]) поддерживается в двух основных резервуарах диких животных: лисах и енотовидных собаках.По нашим оценкам, MRCA группы E существовала примерно в 1920 году [1889–1950]. Ранее было неясно, был ли источником вируса у енотовидных собак инфицированные лисы или вирус, который перешел к енотовидным собакам непосредственно от собак и затем передался популяции лисиц [21]. Согласно молекулярному анализу, предковая популяция современных вирусов группы E могла существовать в Европе до появления енотовидных собак; однако широкий интервал HPD в этом узле не позволяет дать окончательный ответ.

Кавказское бешенство (группа F) относилось к ранее описанной группе Иран-1а [22]. Это группа собачьего бешенства, которая была распространена в регионе Ближнего Востока (Ирак, Иран и Турция). Первые российские представители этой группы были изолированы в 2005 г. [12]. Кроме того, самые глубокие ответвления в группе F были обнаружены на Ближнем Востоке. Таким образом, можно предположить, что эта группа вирусов не циркулировала в России до 1979 г. (нижняя крайняя граница интервала HPD для MRCA российских представителей группы F) и, вероятно, была завезена в Россию из приграничных кавказских государств совсем недавно.Между тем случаи бешенства в кавказских регионах Российской Федерации были выявлены гораздо раньше, хотя последовательности этих вирусов отсутствуют. В результате полная история группы F на территории России остается неизвестной.

Подгруппы А2 и А3 арктического бешенства распространены на обширных приполярных территориях, но их генетическое разнообразие чрезвычайно низко по сравнению с другими группами вирусов. Например, N-ген {«type»: «entrez-нуклеотид», «attrs»: {«text»: «KX954123», «term_id»: «1159608026», «term_text»: «KX954123»}} KX954123 (выделено на Земле Франца-Иосифа, Россия, в 2016 г.) акций 99.3% идентичных нуклеотидов с N-геном {«type»: «entrez-нуклеотид», «attrs»: {«text»: «JN258592», «term_id»: «359301358», «term_text»: «JN258592»} } JN258592 (изолирован на Аляске в 2008 г.). Все штаммы подгрупп A2 и A3 имели 97,39–100,00% идентичности последовательностей. Такое низкое разнообразие можно объяснить быстрым распространением вируса из-за миграции полярных хищников на большие расстояния. Действительно, в марте площадь арктического льда максимальна, и все приполярные территории (Аляска, Северная Канада, Гренландия и Север России) представляют собой единый экологический регион (S2 рис) со сходными экологическими условиями.Основным хозяином арктического бешенства является песец ( Vulpes lagopus ), который в холодное время года способен мигрировать на расстояние более 5 000 км [36]. Здесь мы описали вирус, который был обнаружен на Земле Франца-Иосифа и больше всего похож на изоляты Аляски, но не на северосибирские изоляты, что дополнительно иллюстрирует высокую пространственную скорость распространения полярного бешенства.

Бешенство передается в основном при прямом физическом контакте. Следовательно, для эффективной передачи требуется достаточная плотность популяции животных [34].Плотность популяции животных постоянно колеблется из-за изменения условий окружающей среды, что может привести к исчезновению филогенетических групп вируса бешенства. Однако после того, как плотность хозяев падает ниже критического уровня и вирус вымирает, популяции животных обычно восстанавливаются и становятся восприимчивыми к быстрому распространению вируса. Наш анализ поддерживает эту модель, которая подразумевает циклы расширения и исчезновения вирусной популяции и имеет важное практическое значение. Есть два возможных способа избавиться от вируса бешенства.Это может быть достигнуто либо за счет уменьшения плотности основных хозяев путем частичного истребления популяции животных, либо за счет уменьшения плотности восприимчивых основных хозяев путем пероральной вакцинации популяции животных. Попытки контролировать распространение бешенства в Европе путем сокращения популяции хозяев оказались неэффективными [34]. Однако реализация программ оральной вакцинации против бешенства (ORV) в странах Западной Европы (S3 Fig) оказалась наиболее эффективным методом ликвидации бешенства [37].Предыдущие безуспешные попытки ставили под сомнение возможность искоренения бешенства в России с помощью ORV [38], хотя эту неудачу можно объяснить плохой организацией [39].

Филогенетический анализ показал относительно недавнее появление всех групп вирусов бешенства, циркулирующих в настоящее время на территории Российской Федерации. Между тем бешенство было известно в России гораздо раньше [40]. Таким образом, древние варианты вируса вымерли по естественным причинам, и популяция вируса не была стабильной в долгосрочной перспективе.Этот вывод подразумевает, что давление на популяцию вируса, оказываемое пероральной вакцинацией диких хищников, может привести к исчезновению вируса. Однако необходимы дальнейшие полевые исследования для разработки эффективной общенациональной стратегии ликвидации бешенства. В то же время некоторые резервуары вируса бешенства, например летучие мыши, не могут быть задействованы в программах вакцинации [41]. Следовательно, даже в случае элиминации RABV плотоядных животных глобальное искоренение бешенства и вирусов, подобных бешенству, не представляется возможным из-за вероятности межвидового распространения инфекции [42].

Заключение

Программа искоренения бешенства была успешной в Западной Европе, но бешенство остается эндемическим заболеванием в России. Анализ показывает, что определенные группы вирусов циркулируют в различных экологических регионах. Популяция вируса на удивление проста и предполагает прямую схему распространения, которая, по-видимому, происходила в течение последних нескольких столетий при отсутствии долгосрочной эндемичности вируса. Было очевидно лишь несколько занесений вируса из соседних стран. Такая модель предполагает, что ликвидация бешенства на большей части территории России возможна.

Вспомогательная информация

S1 Рис.
Филогенетическое дерево максимального правдоподобия набора данных расширенных последовательностей N-гена вируса бешенства.

(TIF)

S2 Рис.
Средняя протяженность морского льда в сентябре 2015 года (слева) и в марте 2015 года (справа) иллюстрирует соответственно минимальную и максимальную протяженность.

Пурпурная линия указывает среднюю протяженность льда в сентябре и марте, соответственно, в период с 1981 по 2010 год. Карты были получены из Национального центра данных по снегу и льду (NSIDC) по адресу http: // www.nsidc.org/data/seaice_index.

(TIF)

S3 Рис.

(A) Зарегистрированные случаи бешенства у млекопитающих в 1991 г. (за исключением бешенства летучих мышей). (B) Зарегистрированные случаи бешенства у млекопитающих в 2014 г. (за исключением бешенства летучих мышей). (C) Кампании ORV диких животных в 2005–2014 гг. [Информационная система по бешенству Центра сотрудничества ВОЗ по эпиднадзору и исследованиям бешенства, http://www.who-rabies-bulletin.org/Queries/Maps.aspx].

(TIF)

Файл S1
(Таблица A) Последовательности нуклеопротеинов вируса бешенства, использованные в этом исследовании.

(DOC)

Благодарности

Авторы благодарят Гаврило М.В. от Национального парка «Русская Арктика», Архангельск, Российская Федерация, на предоставление образцов песца.

Доступность данных

Все соответствующие данные находятся в документе и его файлах с вспомогательной информацией.

Ссылки

1. Сайто М., Оситани Х., Орбина JRC, Тохма К., де Гусман А.С., Камигаки Т. и др. Генетическое разнообразие и географическое распространение генетически отличных вирусов бешенства на Филиппинах.PLoS Negl Trop Dis. 2013; 7: e2144 10.1371 / journal.pntd.0002144 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 2. Дицшольд Б., Фабер М., Шнелл М.Дж. Новые подходы к профилактике и искоренению бешенства. Экспертные ревакцины. 2003. 2: 399–406. 10.1586 / 14760584.2.3.399 [PubMed] [CrossRef] [Google Scholar] 3. Рупрехт К.Э., Барретт Дж., Бриггс Д., Кликет Ф., Фукс А.Р., Лумлертдача Б. и др. Можно ли искоренить бешенство? Дев Биол Базель. 2008. 131: 95–122. [PubMed] [Google Scholar] 4. Фукс А.Р., Баньярд А.С., Хортон Д.Л., Джонсон Н., Макэлхинни Л.М., Джексон А.С.Текущее состояние бешенства и перспективы ликвидации. Ланцет. Elsevier Ltd; 2014; 6736: 1–11. [Бесплатная статья PMC] [PubMed] [Google Scholar] 5. Нобель Д.Л., Кливленд С., Колман П.Г., Февр Э.М., Мельцер М.И., Миранда М. и др. Переоценка бремени бешенства в Африке и Азии. Bull World Health Organ. 2005. 83: 360–366. [Бесплатная статья PMC] [PubMed] [Google Scholar] 7. Полещук Е.М., Сидоров Г.Н., Березина Е.С. Бешенство животных в России в 2007–2011 гг. Журнал Russ Vet Journal Small Domest wild Anim. 2012; 6: 8–12.[Google Scholar] 8. Львов Д.К., Щелканов М.Ю., Алховский С.В., Дерябин П.Г. Фронт-дело Зоонозные вирусы в Северной Евразии. Эльзевир; 2015. [Google Scholar] 9. Бурхи Х., Рейнс Дж.М., Данхэм Э.Дж., Даше Л., Ларроус Ф., Хыонг VTQ и др. Происхождение и филогеография вируса собачьего бешенства. J Gen Virol. 2008. 89: 2673–81. 10.1099 / vir.0.2008 / 003913-0 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 10. Джексон AC. Бешенство: научные основы болезни и методы лечения. Третий Править Джексон А.С., редактор.Сан-Диего: Эльзевьер; 2013. [Google Scholar] 11. Кузьмин И. В., Ботвинкин А. Д., МакЭлхинни Л. М., Смит Дж. С., Орчиари Л. А., Хьюз Г. Дж. И др. Молекулярная эпидемиология наземного бешенства в бывшем Советском Союзе. J Wildl Dis. 2004. 40: 617–631. 10.7589 / 0090-3558-40.4.617 [PubMed] [CrossRef] [Google Scholar] 12. Метлин А., Рыбаков С., Груздев К., Неувонен Э., Хуовилайнен А. Генетическая гетерогенность российских, эстонских и финских вирусов полевого бешенства. Arch Virol. 2007. 152: 1645–54. 10.1007 / s00705-007-1001-6 [PubMed] [CrossRef] [Google Scholar] 13.Полещук Е.М., Сидоров Г.Н., Грибенча С.В. Обобщение данных об антигенном и генетическом разнообразии вируса бешенства, циркулирующего у наземных млекопитающих в России. Vopr Virusol. 2013; 3: 9–16. [PubMed] [Google Scholar] 14. Полещук Е.М., Сидоров Г.Н., Ткачев С.Е., Девяткин А.А., Дедков В.Г., Очкасова Ю.В. и др. Эколого-вирусологические особенности эпизоотического процесса бешенства в Центрально-Черноземном регионе России. Vet Pathol. 2013; 2: 101–108. [Google Scholar] 15. Полещук Е.М., Сидоров Г.Н., Ткачев С.Е.Молекулярная эпидемиология бешенства на юге Восточной Сибири. Russ J Infect Immun. 2013; 3: 164–164. [Google Scholar] 16. Чупин С.А., Чернышова Е.В., Метлин А.Е. Генетическая характеристика полевых изолятов вируса бешенства, выявленных в Российской Федерации в период 2008–2011 гг. Vopr Virusol. 2013; 58: 44–48. [PubMed] [Google Scholar] 17. Тамура К., Стечер Г., Петерсон Д., Филипски А., Кумар С. MEGA6: Анализ молекулярной эволюционной генетики, версия 6.0. Mol Biol Evol. 2013; 30: 2725–2729.10.1093 / molbev / mst197 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 18. Мартин Д.П., Мюррелл Б., Голден М., Хосал А., Мухир Б. RDP4: Обнаружение и анализ паттернов рекомбинации в вирусных геномах. Virus Evol. 2015; 1: 1–5. [Бесплатная статья PMC] [PubMed] [Google Scholar] 19. Bouckaert R, Heled J, Kuhnert D, Vaughan T, Wu CH, Xie D, et al. BEAST 2: программная платформа для байесовского эволюционного анализа. PLoS Comput Biol. 2014; 10: 1–6. [Бесплатная статья PMC] [PubMed] [Google Scholar] 20. Smith JM.Анализ мозаичной структуры генов. J Mol Evol. 1992. 34: 126–129. [PubMed] [Google Scholar] 22. Надин-Дэвис С., Симани С., Армстронг Дж., Фаяз А., Ванделер А. Молекулярная и антигенная характеристика вирусов бешенства из Ирана позволяет идентифицировать варианты с различным эпидемиологическим происхождением. Epidemiol Infect. 2003. 131: 777–790. [Бесплатная статья PMC] [PubMed] [Google Scholar] 23. Кузьмин И. В., Хьюз Г. Дж., Ботвинкин А., Грибенча С. Г., Рупрехт CE. Арктические и арктические вирусы бешенства: распространение, филогения и эволюционная история.Epidemiol Infect. 2008; 136: 509–19. 10.1017 / S095026880700903X [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 24. Надин-Дэвис Са, Шин М., Уанделер А.И. Недавнее появление линии арктического вируса бешенства. Virus Res. 2012; 163: 352–62. 10.1016 / j.virusres.2011.10.026 [PubMed] [CrossRef] [Google Scholar] 25. Ханке Д., Фройлинг С.М., Фишер С., Хюффер К., Хундертмарк К., Надин-Дэвис С. и др. Пространственно-временной анализ генетического разнообразия вирусов арктического бешенства и их резервуарных хозяев в Гренландии.Recuenco S, редактор. PLoS Negl Trop Dis. 2016; 10: e0004779 10.1371 / journal.pntd.0004779 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 26. Сидоров Г., Сидорова Д., Полещук Е. Бешенство диких млекопитающих в России с конца XIX до начала XX века. Russ J Zool. 2010; 88: 26–36. [Google Scholar] 27. Березина Е.С., Сидоров Г.Н., Полещук Е.М., Сидорова Д.Г. Маленькие дикие клыки и их роль в заболеваемости людей бешенством в России. Журнал Russ Vet Journal Small Domest wild Anim.2011; 2: 26–29. [Google Scholar] 28. Сидоров Г.Н. Аспекты исторического развития природных очагов райбов Европы и Северной Азии. Vet Pathol. 2002; 1: 21–25. [Google Scholar] 30. Кунин Э. В., Вольф Ю. И., Нагасаки К., Доля В. В. Большой взрыв эволюции пикорноподобных вирусов предшествовал излучению эукариотических супергрупп. Nat Rev Microbiol. 2008; 6: 925–939. 10.1038 / nrmicro2030 [PubMed] [CrossRef] [Google Scholar] 31. Щелканов М.Ю., Девяткин А.А., Ананьев В.Ю., Дедков В.Г., Шипулин Г.А., Сокол Н.Н. и др.Полная последовательность генома штамма вируса бешенства, выделенного из бурого медведя (Ursus arctos) в Приморском крае, Россия (ноябрь 2014 г.). Объявление о геноме. 2016; 4: e00642–16. [Бесплатная статья PMC] [PubMed] [Google Scholar] 32. Щелканов М.Ю., Девяткин А.А., Ананьев В.Ю., Фролов Е.В., Домбровская И.Е., Дедков В.Г. и др. Выделение и полное секвенирование генома штамма вируса бешенства, выделенного из бурого медведя (Ursus arctos), напавшего на человека в Приморском крае (ноябрь 2014 г.). Vopr Virusol. 2016; 61: 180–186.[Google Scholar] 33. McElhinney LM, Marston DA, Freuling CM, Cragg W., Stankov S, Lalosević D, et al. Молекулярное разнообразие и эволюционная история штаммов вируса бешенства, циркулирующих на Балканах. J Gen Virol. 2011; 92: 2171–80. 10.1099 / vir.0.032748-0 [PubMed] [CrossRef] [Google Scholar] 34. Андерсон RM, Джексон ХК, Мэй RM, Смит AM. Динамика численности лисиц бешенства в Европе. Природа. 1981; 289: 765–771. [PubMed] [Google Scholar] 35. Малдер JL. Обзор экологии енотовидной собаки (Nyctereutes procyonoides) в Европе.Lutra. 2012; 55: 101–127. [Google Scholar] 37. Витасек Дж. Обзор ликвидации бешенства в Европе. Vet Med — чешский. 2004; 2004: 171–185. [Google Scholar] 38. Авилов В.М., Сочнев В.В., Резябкин И.Н., Алиев А.А., Саввин А.В., Горячев И.И. Иммунизация диких хищников вакцинацией против бешенства в зонах повышенного риска. Vet Pathol. 2004. 3: 134–138. [Google Scholar] 39. Макаров В.В. Оральная вакцинация лисиц от бешенства безальтернативна. Vet Pathol. 2009; 4: 2–5. [Google Scholar] 40. Ботвинкин А, Косенко М.Бешенство в европейских частях России, Беларуси и Украины. В: Кинг А.А., Фукс А.Р., Обер М., Ванделер А.И., редакторы. Историческая перспектива бешенства в Европе и Средиземноморском бассейне. Париж; 2004. С. 47–65. 10.1016 / j.trstmh.2005.04.006 [CrossRef] [Google Scholar] 41. Рупрехт CE, Кузьмин И. В. Почему мы можем предотвратить, контролировать и, возможно, лечить — но не искоренить — бешенство. Будущий Virol. 2015; 10: 517–535. [Google Scholar] 42. Бадран Х., Тордо Н. Переключение хозяев в истории Lyssavirus от рукокрылых к отрядам хищных.J Virol. 2001; 75: 8096–8104. 10.1128 / JVI.75.17.8096-8104.2001 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]

Луи Пастер и бешенство: краткая заметка

Почти всеобщая гибель жертв нелеченного человеческого бешенства окружает болезнь понятным ужасом. Слово происходит от латинского rabere — гнев или буйство. Это было известно как собачье безумие или водобоязнь, которая вызывает паралич или порочную возбудимость, а у человека — фатальный энцефалит со спазмами горла при глотании.

Разнообразие бешенства менингоэнцефалита проявляется в «гидрофобной» или «спастической» форме, а также в «спокойной» или «паралитической» (бешенство без гидрофобии) форме, последняя с восходящим параличом типа Ландри, заканчивающимся бульбарным, респираторным и респираторным заболеваниями. и энцефалитные симптомы. История укуса собаки часто неясна, если он произошел несколькими месяцами ранее. Однако симптомы обычно развиваются через 10–50 дней после заражения; смерть наступает примерно через 10 дней. В Великобритании жесткие карантинные законы при ввозе всего домашнего скота привели к его фактическому искоренению.

В 1804 году Георг Готфрид Зинке впервые передал бешенство 1 от бешеной собаки нормальной собаке и от собаки кролику и курице путем инъекции слюны. Это доказало, что болезнь была заразной. К 1826 году Франц Кристиан Карл Кругельштейн (1779–1864) написал полный отчет о бешенстве с библиографией из 300 наименований. 2

Но восприимчивость вида была неясной, пока Виктор Гальтье не продемонстрировал серию передачи от собаки к кролику к кролику. 3 Затем он иммунизировал овец путем внутривенного заражения бешеной слюной. Это не вызвало болезни, но, что интересно, защитило животных от последствий последующей инокуляции. 4

Его работа вызвала интерес Луи Пастера, который вместе с К. Чемберлендом, ППЭ Ру и Т. Тюилье в 1881 году написали первую из своих работ, 5 , знаменовав начало исследований Пастера по бешенству. В дальнейшей работе 6 показали признаки вируса бешенства в крови.

«Сначала он поселяется и размножается в спинном и головном мозге».

Он сообщил: При передаче от собаки к обезьяне, а затем от обезьяны к обезьяне, вирулентность уменьшается с каждой передачей, а затем при повторной прививке собакам, кроликам или морским свинкам она остается ослабленной. Однако вирулентность серийно увеличивалась при передаче от кролика к кролику или от морской свинки к морской свинке. Таким образом, он смог продуцировать вирус разной степени вирулентности.Срезы бешеного спинного мозга высоковирулентного штамма после серийного прохождения через множество кроликов были подвешены в сухом воздухе; со временем вирулентность постепенно уменьшалась. Таким образом, Пастер произвел аттенуированную вакцину и успешно иммунизировал 50 инокулированных собак. 7

В понедельник 6 июля 1885 года из Эльзаса привезли к нему девятилетнего Йозефа Майстера, которого 4 июля укусила бешеная собака. С некоторой неохотой доктор Вульпиан и Гранчер из Академии медицины убедили Пастера дать доктору Гранчеру эмульсию из пуповины кролика, который умер от бешенства 21 июня и находился на сухом воздухе в течение 15 дней.Ребенку сделали еще 13 прививок за 10 дней с участками пуповины, которые становились все более свежими (более опасными), пока через три месяца и три дня он не объявил, что жизнь ребенка теперь вне опасности и его здоровье выглядит превосходным. 20 октября он успешно вылечил другого пациента, зараженного бешеной собакой шестью днями ранее. К 1886 году он вылечил 350 пациентов со всей Европы, России и Америки. 8

Это считается его величайшим триумфом.Позднее микроскопическая диагностика стала возможной благодаря открытию тела Негри Альдечи Негри (1903–1905). Ферми использовал обработку бешеных тканей фенолом для приготовления вакцины Ферми в 1908 году. Вебстер и Клоу впервые вырастили вирус в культуре ткани в 1936 году, что привело к созданию вакцины на основе культуры клеток человека, 9 и вакцины диплоидных клеток в 1978 году.

Французский язык химика Луи Пастера (1822–1895) часто называют основоположником микробиологии. 10 В 1863 году император Наполеон III поручил ему исследовать болезни, поражающие вина.Он успешно исследовал pébrine и flacherie , болезни тутовых шелкопрядов в 1860-х годах, и путем принудительной изоляции инфицированных шелкопрядов контролировал болезнь, которая разрушала производство шелка.

Его ранние исследования ферментации, которые показали, что дрожжи действуют как микроорганизмы, превращающие сахар в спирт, а не как химические ферменты, как полагали Либих и другие. Он также утверждал, что особая закваска скисает молоко. Подобно тому, как определенный микроорганизм или «зародыш» вызывает каждый тип ферментации, многие болезни также вызываются определенными ферментами ( Memoire sur la fermentation appelee lactique, 1858).Брожение напоминало наблюдаемое гниение ран. (Невидимые) микробы или ферменты витали в воздухе, и эта идея вызвала презрение среди критиков его микробной теории болезни. Его доказательство того, что болезни могут быть вызваны «микробами», было новым и крупным открытием. 8 Пастер показал, что вирулентность инфицированной крови зависит от температуры и кислорода, так что птицы с их высокой температурой тела сопротивлялись заражению сибирской язвой. Следуя работе Коха по спорам сибирской язвы в 1876 году, Пастер установил, что культура, выращенная при высокой температуре, была менее вирулентной и вызывала только легкое заболевание у овец: ослабленную «вакцину против сибирской язвы».Это было похоже на вакцинацию Эдварда Дженнера коровьей оспой для иммунизации против натуральной оспы.

В 1854 году он стал профессором химии и был избран членом Французской медицинской академии, что стало большой честью. Боннский университет присвоил степень доктора медицины, honoris causa в 1868 году, которую он возвратил в 1871 году. В свое время Пастер достиг большой известности, кульминацией которой стала публичная подписка на два с половиной миллиона франков, которая сделала возможным создание Института Пастера. в Париже.Несмотря на инсульт в возрасте 46 лет, он неустрашимо продолжал исследования до 1888 года. Он умер 28 сентября 1895 года в Гарше, Сена и Уаза. 8

Каталожные номера

  1. Цинке ГГ . Neue Ansichten der Hundswuth, ihrer Ursachen und Folgen, nebst einer sichern Behandlungsart der von tollen Thieren gebissenen Menschen . Йена: CE Gabler, 1804.

  2. Кругельштейн FCK . Die Geschichte der Hundswuth und der Wasserscheu und deren Behandlung . Гота, In der Hennings’schen Buchhandlung, 1826.

  3. Гальтье V . Études sur la rage. Энн Мед Вет 1879; 28: 627–39.

  4. Гальтье V . Les инъекций бешеного вируса в циркулирующем потоке, не вызывающем ярости и подобном ограничении. La rage peut être transmise par l’ingestion de la matiére rabique.C R Acad Sci (Париж) 1881; 93: 284–5.

  5. Пастер Л и др. . Sur la rage. C R Acad Sci (Париж) 1881; 92: 1259–60. Английский перевод на: R Suzor. Hydrophobia: счет системы М. Пастера . Лондон, 1887 г.

  6. Pasteur L , Chamberland C, Roux PPE. Nouvelle communication sur la rage. C R Acad Sci (Париж) 1884; 98: 457–63, 1229–31.Английский перевод на: R Suzor. Hydrophobia: счет системы М. Пастера . Лондон, 1887: 159–97.

  7. Пастер Л . Méthode pour prevenir la rage aprés morsure. C R Acad Sci (Париж) 1885; 101: 765–74; 1886; 102 : 459–69, 835–38; 1887; 103 : 777–85. Английский перевод первой части (1885 г.) в: Bibel. Вехи в иммунологии (1988). Мэдисон: Science Tech: Berlin Springer Verlag (см.2541).

  8. Николь Дж. . Луи Пастер. Магистр научных исследований . Лондон: Гильдия научной книги, 1962. (Среди нескольких биографий это один из лучших и подробных отчетов об основной экспериментальной работе и рассуждениях Пастера.)

  9. Виктор ТДЖ . Вакцина против бешенства на культуре клеток человека. JAMA1973; 224: 1170–1.

  10. Певица С . Краткая история медицины . Оксфорд: Clarendon Press, 1928: 225–34, 261.

Бешенство | SCDHEC

Бешенство в Южной Каролине

Бешенство — это вирус ( Lyssavirus ), который может передаваться при попадании слюны или нервной ткани инфицированного животного в организм здорового человека или животного. Он поражает клетки центральной нервной системы, вызывая болезнь мозга и, в конечном итоге, смерть.

Любое млекопитающее может переносить и передавать болезнь людям или домашним животным.Бешенство передается при попадании в организм слюны или нервной ткани инфицированного животного. Воздействие может произойти через укус, царапину или контакт слюной с поврежденной кожей или слизистыми оболочками, такими как глаза или рот.

В Южной Каролине основными переносчиками бешенства являются:
  • Еноты
  • Скунсы
  • Лисицы
  • Летучие мыши

Важно помнить, что бешенство — это неотложная медицинская помощь, но не неотложная помощь . Бешенство у людей можно на 100% предотвратить с помощью своевременной и соответствующей медицинской помощи.

Прививки

Присоединяйтесь к нам в борьбе за #EndRabies , информируя ваших питомцев (собак, кошек и хорьков) о вакцинации от бешенства. Вы также можете вакцинировать домашний скот, такой как лошади, коровы и овцы. Это не только защищает ваше животное, но и защищает вас и вашу семью от этого смертельного вируса.

Учебные материалы:

Бешенство в U.С.

За последние 100 лет бешенство в Соединенных Штатах сильно изменилось. Более 90% всех случаев заболевания животных, ежегодно сообщаемых CDC, в настоящее время происходит в дикой природе. До 1960 г. большинство из них приходилось на домашних животных.

Число смертей людей, связанных с бешенством, снизилось с более чем 100 ежегодно до одной или двух смертей в год. Смертельные случаи, связанные с бешенством, происходят среди людей, которые не обращаются за медицинской помощью, обычно потому, что они не знали о своем заражении.

Количество постэкспозиционных процедур, проводимых в Соединенных Штатах каждый год, оценивается от 40 000 до 50 000. Хотя стоимость лечения варьируется, лечение обычно превышает 3000 долларов на человека.

Медицинские работники и ветеринары

Обязательно сообщайте обо всех происшествиях с животными в DHEC. При оценке возможного заражения бешенством доступны консультации с медицинским персоналом DHEC, которые помогут вам определить, следует ли проводить постконтактную профилактику (ПКП).

Медицинские работники и ветеринары:

Сообщить об укусах животных в DHEC

Если вас укусило или поцарапало дикое, заблудшее или непривитое животное, позаботьтесь о ране должным образом и обратитесь к своему врачу. Поставщик медицинских услуг должен сообщить об инциденте в DHEC.

Если ваш ребенок укусил, и вы не обращаетесь за медицинской помощью по поводу раны, вам необходимо связаться с вашим региональным офисом службы гигиены окружающей среды DHEC, чтобы сообщить о происшествии до конца следующего рабочего дня.

CDC США приостанавливают импорт собак из более чем 100 стран из-за опасений по поводу бешенства

Люди выгуливают своих собак через Центральный парк в день весеннего равноденствия в районе Манхэттена Нью-Йорка, Нью-Йорк, США, 20 марта 2021 г. REUTERS / Кейтлин Окс

ВАШИНГТОН, 14 июня (Рейтер) — Центры США по контролю и профилактике заболеваний (CDC) заявили в понедельник, что с 14 июля временно приостановят ввоз собак из 113 стран, классифицированных как страны с высоким риском собачьего бешенства.

Дисквалификация распространяется на всех собак, включая щенков, собак эмоциональной поддержки и собак, которые выехали из Соединенных Штатов и вернулись из стран с высоким уровнем риска. Сюда также входят собаки, прибывшие из других стран, если они находились в стране повышенного риска в течение предыдущих шести месяцев.

CDC заявил, что «временные меры необходимы для обеспечения здоровья и безопасности собак, ввезенных в Соединенные Штаты, а также для защиты здоровья населения от повторного заноса варианта вируса собачьего бешенства (собачьего бешенства) в Соединенные Штаты».

Эмили Пиераччи, ветеринарный врач CDC, сообщила Reuters, что за последний год во время пандемии COVID «значительно увеличилось количество собак, которые ввозятся и предъявляют поддельные или фальсифицированные свидетельства о вакцинации от бешенства. » По данным CDC, в 113 стран входят Россия, Китай, Индия, Бразилия, Перу, Кения, Сальвадор, Гватемала, Беларусь, Афганистан, Саудовская Аравия, Пакистан, Иордания, Эквадор, Куба, Малайзия, Индонезия, Нигерия и Саудовская Аравия.

Пьераччи также отметил, что во время пандемии COVID-19 многие программы вакцинации собак по всему миру были приостановлены или отменены. Она отметила рост числа случаев собачьего бешенства на Гаити и Перу в результате сокращения вакцинации собак.

«Учитывая влияние, которое COVID оказал на эти программы вакцинации во всем мире, мы не совсем уверены, как будет выглядеть наш ландшафт с бешенством в будущем», — сказал Пиераччи.

CDC ранее оценил 1.Ежегодно в Соединенные Штаты импортируется 6 миллионов собак. По оценкам CDC, запрет на импорт, который, как ожидается, продлится год, коснется примерно 6% ввозимых собак.

CDC заявил, что из-за воздействия COVID-19 на расписание рейсов собакам, которым отказано во въезде, грозит более длительное время ожидания, чтобы их вернуть в страну отправления, что в некоторых случаях приводит к болезни и даже смерти.

Собачье бешенство было ликвидировано в Соединенных Штатах с 2007 года, но остается распространенным во многих странах и ежегодно убивает 59 000 человек во всем мире.Этих смертей можно предотвратить, если вакцинировать их до появления симптомов.

Хотя собаки в Соединенных Штатах все еще могут заразиться енотами, скунсами или летучими мышами, они не заразятся бешенством, характерным для собак, от другой собаки.

CDC на «крайне ограниченной основе» может выдать предварительное письменное разрешение, разрешающее «ввоз собак, полностью иммунизированных против бешенства, в возрасте 6 месяцев и старше из страны высокого риска».

Еще одна проблема — это поддельные сертификаты вакцинации против бешенства. Собаки из стран с высоким уровнем риска не могут въезжать в Соединенные Штаты до достижения ими возраста 16 недель и должны быть вакцинированы.

Есть несколько мест, где должным образом содержатся собаки, которым запрещен въезд в США. У CDC есть только один карантинный центр для собак в аэропорту имени Джона Кеннеди в Нью-Йорке, и его отсутствие привело к «небезопасным» условиям для работников аэропорта и собак, сказал Пиераччи.

«Некоторые из них были размещены на грузовых складах авиакомпаний в течение длительного периода времени, что привело к болезни, а в некоторых случаях к смерти собак», — сказал Пиераччи. «Мы хотим, чтобы люди могли импортировать собак, но чтобы они делали это безопасно.«

В других странах, таких как Австралия, Новая Зеландия и члены Европейского Союза, которые также ликвидировали собачье бешенство, предъявляются значительно более строгие требования к тестированию, скринингу и карантину, чем в Соединенных Штатах, — сообщил CDC.

Отчет Дэвида Шепардсона;

Наш Стандарты: Принципы доверия Thomson Reuters.

Бешенство и укусы животных | Здоровье

Бешенство у животных

Бешенством могут заразиться только млекопитающие. Птицы, рыбы, рептилии и земноводные не могут заразиться бешенством.В Фэйрфаксе чаще всего регистрируются дикие животные, страдающие бешенством, — это еноты, лисы, скунсы и летучие мыши. Кролики, белки, крысы и мыши редко болеют бешенством. Кошки — самые частые домашние животные, у которых диагностировано бешенство.

Бешеные животные в округе Фэрфакс

Ежегодно в округе Фэйрфакс выявляется от 40 до 60 животных, инфицированных бешенством (также известных как «бешеные» животные).

Признаки бешеного зверя

Бешеные животные могут вести себя странно, например, агрессивно, нападая на других животных или людей без причины или вести себя прирученными (это ненормальное поведение для диких животных).Животные, зараженные бешенством, могут быть не в состоянии есть, пить или глотать. В результате животное может пускать слюни, потому что не может проглотить слюну. Животное может пошатнуться или споткнуться при движении и его может парализовать. Бешеные животные обычно умирают в течение недели после появления симптомов.

Защитите себя, свою семью и своих домашних животных

Что делать, если на вас или вашу семью нападает дикий, бродячий или непривитый питомец

  1. Немедленно протрите раны проточной водой с мылом в течение 5–10 минут.
  2. Не пытайтесь убить или поймать атакующее животное. Однако, если вы уже убили животное, избегайте дальнейшего контакта, даже если оно мертво.
  3. Запишите полное описание атакующего животного (например, место нападения и текущее местоположение животного, размер, цвет, уникальные цветовые узоры, был ли на нем ошейник, и если да, то какого цвета был контакт с владельцем. информация), чтобы органы по контролю за животными могли должным образом расследовать и принять меры.
  4. Обратитесь за медицинской помощью к семейному врачу или в отделение неотложной помощи. Ваш врач проверит, нужна ли вам постконтактная профилактика бешенства.
  5. Сообщите о нападении животного в полицейское управление округа Фэйрфакс, используя форму отчета о воздействии бешенства и администрации PEP. Они помогут изолировать атакующее животное или проверить его на бешенство.

Что делать, если на вашего питомца напал дикий, бродячий или непривитый питомец

  1. Не осматривайте раны вашего питомца без перчаток.
  2. В перчатках промойте раны вашего питомца водой с мылом. Обязательно смывайте всю слюну атакующего животного.
  3. Не позволяйте своему питомцу вступать в контакт с другими животными, домашними животными или людьми, пока не поговорите с сотрудником службы защиты животных Департамента полиции округа Фэйрфакс.
  4. Сообщите о нападении животных в Службу защиты животных Департамента полиции округа Фэйрфакс по телефону 703-691-2131. Они помогут изолировать или проверить атакующее животное на бешенство и предоставят вам дополнительную информацию о том, как вам нужно будет следить за своим питомцем на предмет признаков бешенства.
  5. Обратитесь к ветеринару, чтобы узнать о дополнительных действиях, необходимых для обеспечения здоровья и восстановления вашего питомца.

Департамент здравоохранения штата Техас, отдел контроля за инфекционными заболеваниями> Факты

Ежегодно среди диких животных Техаса и домашних животных развивается много случаев бешенства. Бешенство — болезнь перенаселения. Он процветает там, где есть много дикой природы, как и в большинстве округов Техаса.

Это заболевание можно контролировать.Люди в нескольких зарубежных странах и в некоторых наших штатах, тесно сотрудничая со своими органами здравоохранения и дикой природы, устранили бешенство как угрозу как для животных, так и для жизни людей.

Чем больше мы понимаем врага, тем легче его победить. Это цель этой брошюры — показать читателю, что такое бешенство, а что нет, чтобы он или она могли помочь с ним справиться.

Исторические факты и вымысел

Бешенство, которое иногда называют «бешенством», уходит корнями в древность.За столетия до Рождества Христова он был распознан как у животных, так и у человека. Случаи были описаны с поразительной клинической точностью при жизни Аристотеля. Название «гидрофобия», означающее «боязнь воды», было дано ему в то время, потому что древние греки наблюдали отвращение бешеных животных к воде. На самом деле, правда в том, что они не могут пить из-за паралича горла. Именно из-за этого создается классическая картина зверя с покрытыми пеной пастью. Слюна скапливается в парализованном горле и течет из уголков рта, создавая впечатление пены бешеной собаки.Конечно, нетрудно понять, почему эти древние люди были поражены таким зрелищем и даже думали, что животное одержимо бесами. Писатели того времени приписывали бешенство вторжению в тело злого духа.

На протяжении многих лет стена суеверий была построена. Стена никогда полностью не сносилась. Даже сегодня многие люди считают, что укус циветты (или «бешеной кошки»), маленького пятнистого скунса, неизменно приводит к бешенству. На самом деле, несмотря на то, что все скунсы подвержены бешенству, лабораторные исследования доказали, что ошибочно предполагать, что все циветты бешеные.

Что такое бешенство?

Бешенство — вирусное заболевание центральной нервной системы. Он может передаваться через укус бешеного животного или через слюну бешеного животного, попавшего в свежую царапину или аналогичный разрыв кожи, и редко другими путями. Попадание слюны на неповрежденную кожу — или даже на царапинную рану старше 24 часов, на которой образовалась струпья, — обычно не требует лечения от бешенства. Вам обязательно стоит обратиться к врачу, если вы считаете, что животное может быть бешеным.

Где нашли бешенство?

Раньше бешенство встречалось почти во всех частях света. Исключение составляет Австралия, где ни разу не диагностировали ни одного случая заболевания.

Некоторые страны, когда-то пораженные бешенством, полностью искоренили бешенство с помощью строгих мер контроля и контроля. Дания, Швеция, Норвегия, Гавайи и Британские острова свободны от этой болезни в течение многих лет. Хотя он был полностью исключен из Англии до Первой мировой войны, он был вновь введен и его пришлось искоренить.В настоящее время бешенство, вероятно, наиболее распространено в России, Бельгии, Франции, США, Африке, Мексике и нижних частях Америки.

В некоторых частях США бешенство встречается крайне редко.

Когда известное бешеное животное кусает собаку или кошку

Невакцинированные собаки и кошки, укушенные известным бешеным животным, должны быть немедленно уничтожены. Если владелец не желает этого делать, животное следует вакцинировать и поместить в строгую изоляцию на 90 дней, а также сделать ревакцинацию в течение третьей и восьмой недель изоляции.Если животное в настоящее время вакцинировано, его следует немедленно ревакцинировать и удерживать (привязать и изолировать) на 45 дней.

Когда бешенство наиболее распространено?

Вопреки распространенному мнению, бешенство не ограничивается так называемыми «собачьими днями» июля и августа. Большинство случаев заражения в Техасе происходит весной, вероятно, потому, что в весенний период спаривания диких хищников больше возможностей для передачи инфекции. Бешенство действительно встречается в Техасе в течение всего года как у диких, так и у домашних животных.Бешенство у летучих мышей возникает в основном в теплые месяцы.

Какие животные болеют бешенством?

Все теплокровные животные, включая человека, восприимчивы к бешенству. В Техасе чаще всего заражаются скунсы, летучие мыши, койоты и лисы. Это не означает, что нужно начинать кампании по искоренению диких животных. Дикие виды очень полезны для сдерживания вредителей, но разумно понимать, что они могут переносить бешенство, и что контакта с ними следует избегать в любое время, особенно с явно больными.

Домашние собаки, кошки и домашний скот обычно заражаются бешенством от диких животных; Хотя количество бешеных домашних животных меньше, их опасность выше из-за их тесной связи с людьми.

Как передается бешенство?

Обычно бешеный скунс или лиса кусают и заражают одну или несколько собак или кошек во время бесстрашного вторжения в сообщество. Заболевание развивается у домашних животных вместе с угрозой передачи инфекции другим домашним животным и, возможно, людям.Дети — из-за их более тесной связи с домашними животными — чаще всего становятся человеческими жертвами. Такое быстрое распространение возможно только у непривитых домашних животных.

Если зараженная лиса или скунс попадет на скотный двор, он может укусить и заразить сельскохозяйственную собаку, кошку или другой домашний скот.

Интересно, что лисица может быть в 20 раз более серьезным агентом по распространению, чем скунс, поскольку она перемещается все быстрее и дальше; у скунсов больше вируса бешенства в слюне.

Клиническое течение инфекции бешенства

Течение болезни делится на три состояния: 1-е — инкубационный период; 2-й — клинические признаки; 3-й — паралич, оканчивающийся смертью.

Инкубационный период — это время, в течение которого клинические признаки проявляются после контакта с бешеным животным. Инкубация бешенства занимает от 14 дней до 18 месяцев, в зависимости от вида животных, количества и вирулентности вируса, возраста жертвы и места раны.

Средний инкубационный период, который сильно варьируется, для большинства видов составляет 3-8 недель.

Медицинские органы различают по клиническим признакам «яростное» и «немое» бешенство.В бешеной разновидности ярко выражены симптомы «бешеной собаки». Животное раздражительно, будет хватать и кусать реальные или воображаемые предметы. Он может бегать на многие мили и атаковать все на своем пути. Животное чрезвычайно жестокое и жестокое. Вскоре наступает паралич, обычно сначала поражаются задние лапы. Смерть наступает через четыре-семь дней после появления клинических признаков.

При немом бешенстве основными симптомами являются сонливость и паралич нижней челюсти. Может показаться, что в горле животного застряла кость, из-за чего владельцы иногда с силой открывают рот животного для исследования и невольно заражаются бешенством.

Животные, страдающие тупым бешенством, не склонны бродить, но ломаются при движении. Они совершенно нечувствительны к боли, обычно переходят в кому и умирают от трех до десяти дней после появления первых симптомов.

Лечение бешенства Пастера

Хотя бешенство преследовало как людей, так и животных с незапамятных времен, только в 1884 году великий французский бактериолог Луи Пастер впервые объявил о своем открытии вакцины против бешенства. За открытием скрывается увлекательная история.

Во времена Пастера Франция была захвачена бешенством, и исследования Пастера исходили из большой гуманистической души и ревностного желания что-то сделать, чтобы облегчить ужасную, неизбежную судьбу жертв бешенства. Однажды в деревне Арбуа, где он жил, он увидел, как одного из горожан лечили от укуса волка, прижигая рану раскаленным докрасна железом. Это был единственный известный тогда метод лечения, и он никогда не забывал это зрелище.

Пастеру так и не удалось выделить вирус, вызывающий болезнь, но он разработал вакцину против него.Он взял немного слюны у бешеной собаки и ввел ее кролику, который впоследствии умер. Затем Пастер удалил спинной мозг и дал ему высохнуть в течение 14 дней. Он рассудил, что сушка спинного мозга ослабит его вирусное содержание до такой степени, что он не вызовет заболевания при введении в организм человека, но все же запустит естественный защитный механизм организма для выработки антител против бешенства.

Он использовал эту вакцину, чтобы сделать прививку маленькому мальчику, несмотря на свои собственные опасения и громкий вой протеста со стороны общественности.Джозеф Майстер, маленький эльзасский мальчик, был сильно укушен бешеной собакой. Его мать обратилась к Пастеру как к последней надежде. Сначала ученый ввел мальчику препарат 14-дневной давности и постепенно день ото дня увеличивал вирулентность вакцины, пока он не использовал раствор 3-дневной давности, то есть спинной мозг кролика, из которого был получен приготовленной эмульсии дали высохнуть только в течение трех дней. Джозеф Майстер не заболел бешенством, и у мира было первое оружие против этой болезни,

.
Опасность лечения

Раньше риски, связанные с лечением от бешенства, были значительными; однако вакцина против бешенства и антисыворотка, которые используются в настоящее время, имеют отличные показатели безопасности.Поскольку вероятность развития болезни намного выше, чем вероятность побочной реакции на вакцину, лечение от бешенства следует проводить во всех случаях известного или неопределенного воздействия.

Когда животное кусает человека …

Каждый раз, когда теплокровное животное — собака, лиса, скунс, кошка, летучая мышь и т. Д. — кусает человека, возникает опасность, что это животное станет бешеным и у этого человека может развиться бешенство. Необходимо принять немедленные меры предосторожности:

Идентифицировать и, по возможности, изолировать кусающуюся собаку или кошку для наблюдения или отправить голову животного для лабораторного исследования.

В качестве первой помощи тщательно промойте рану горячей водой с мылом. Как можно скорее проконсультируйтесь с врачом о целесообразности лечения от бешенства.

Собаку или кошку не нужно усыплять (гуманно убивать) до появления первых клинических признаков бешенства. если собака или кошка были инфицированы во время укуса, признаки бешенства у животного обычно проявляются довольно быстро и, конечно, в течение 10 дней. У бешеных собак и кошек обычно наблюдается изменение поведения, возбудимость или паралич, за которым следует смерть.Однако кусающееся животное можно немедленно усыпить. Примечание: не калечите и не разрушайте МОЗГ. Если животное было заразным во время укуса, тест на флуоресцентные антитела подтвердит наличие вируса бешенства.

Дикие животные, участвующие в нападении на людей, должны быть немедленно усыплены, а мозг исследован на предмет бешенства. Их никогда не следует помещать в карантин.

Если симптомы бешенства появляются у животного, содержащегося для наблюдения, немедленно сообщите об этом врачу, с которым консультировались во время нападения, и вызовите компетентного ветеринара или Департамент здравоохранения штата.Врач решит, начинать ли лечение от бешенства сразу, а ветеринар проверит бешеный вид животного, а затем подготовит голову животного для лабораторного исследования.

Как в лаборатории диагностируют бешенство

Сегодняшние лаборанты имеют в своем распоряжении быстрый и сложный диагностический инструмент. Это «тест на флуоресцентные антитела», пришедший на смену диагностическому методу с тельцами Негри. Если присутствует вирус бешенства, его можно быстро и точно обнаружить с помощью метода флуоресцентных антител.

Борьба с бешенством

Возможен эффективный общественный контроль бешенства. Первым шагом к такому контролю является информированная и готовая к сотрудничеству общественность. Важное значение имеет общественное просвещение относительно проблемы и решения.

Общественный контроль бешенства может осуществляться следующими мерами:

Иммунизация всех находящихся в собственности собак и кошек: Все собаки и кошки старше 4 месяцев должны быть вакцинированы против бешенства. Вакцинацию следует проводить у частных ветеринаров или в клиниках вакцинации, спонсируемых сообществом.

Регистрация и лицензирование всех собак, находящихся в собственности: При надлежащем соблюдении программы доходы от лицензирования могут помочь в оплате общественных мероприятий по борьбе с бешенством.

Добавить комментарий

Ваш адрес email не будет опубликован.