Санпин 17: 07.06.2017 N 83 » — 3.5.2.3472-17 «- ,

Разное

Содержание

С 1 октября вступило в силу дополнение № 17 к СанПин 2.3.2.1078-01 | Новости | Администрация Заполярный

Введение данных правил позволит искоренить практику обмана потребителей недобропорядочными производителями и поставщиками, заставляющих платить покупателей за лед.


ДОПОЛНЕНИЕ N 17
К САНПИН 2.3.2.1078-01

ГИГИЕНИЧЕСКИЕ ТРЕБОВАНИЯ
БЕЗОПАСНОСТИ И ПИЩЕВОЙ ЦЕННОСТИ ПИЩЕВЫХ ПРОДУКТОВ

Санитарно-эпидемиологические правила и нормативы
СанПиН 2.3.2.2603-10

Внести дополнение в СанПиН 2.3.2.1078-01:
1. В главу II. «Общие положения»:
В конце пункта 2.18 внести абзац следующего содержания:
«Маркировка, нанесенная на потребительскую тару, упаковку рыбной продукции должна содержать дополнительную информацию в отношении однородной пищевой рыбной продукции следующих групп:
— мороженая рыбная продукция:
а) глазированная — масса нетто должна быть указана без массы глазури;
б) производимая из мороженой рыбной продукции — указание на вторичное замораживание;
— замороженная соленая и маринованная рыбная продукция — слова «Замороженная продукция».

2. В главу III. «Гигиенические требования безопасности и пищевой ценности пищевых продуктов»:
Внести пункт 3.42 следующего содержания:
«3.42. При обработке филе рыбы с использованием пищевых добавок содержание влаги в нем после снятия глазури не должно превышать 86 процентов массы филе рыбы.
Масса глазури, нанесенной на мороженую рыбную продукцию, произведенную из рыбы, не должна превышать 5 процентов массы нетто, из креветки — 6 процентов массы нетто, а на рыбную продукцию, произведенную из иных водных беспозвоночных, водных млекопитающих, водорослей, других водных животных и растений, не должна превышать 8 процентов массы глазированной мороженой рыбной продукции».


(Постановление Главного государственного санитарного врача РФ от 21.04.2010 N 27 (ред. от 05.10.2010) «Об утверждении СанПиН 2.3.2.2603-10» (вместе с «Санитарно-эпидемиологическими правилами и нормативами СанПиН 2.3.2.2603-10 «Дополнение N 17 к СанПиН 2.3.2.1078-01 «Гигиенические требования безопасности и пищевой ценности пищевых продуктов»)

Об утверждении санитарно-эпидемиологических правил и нормативов СанПиН 3.5.2.3472-17 «Санитарно-эпидемиологические требования к организации и проведению дезинсекционных мероприятий в борьбе с членистоногими, имеющими эпидемиологическое и санитарно-гигиеническое значение»

С 09.10.2017г. вступили в силу санитарно-эпидемиологические правила и нормативы СанПиН 3.5.2.3472-17 «Санитарно-эпидемиологические требования к организации и проведению дезинсекционных мероприятий в борьбе с членистоногими, имеющими эпидемиологическое и санитарно-гигиеническое значение» (утверждены Постановлением Главного государственного санитарного врача Российской Федерации от 07.06.2017 г. № 83).

Настоящие санитарно-эпидемиологические правила и нормативы устанавливают требования к организации и проведению мероприятий по уничтожению и (или) снижению численности, созданию неблагоприятной среды обитания для членистоногих, имеющих эпидемиологическое и санитарно-гигиеническое значение.
Санитарные правила направлены на предупреждение возникновения и распространения инфекционных и паразитарных заболеваний, переносчиками или этиологией которых являются.
Соблюдение Санитарных правил является обязательным для граждан, индивидуальных предпринимателей и юридических лиц.
Контроль за выполнением Санитарных правил проводится органами, уполномоченными осуществлять федеральный государственный санитарно-эпидемиологический надзор в соответствии с законодательством Российской Федерации.
Организацию и проведение дезинсекционных мероприятий обеспечивают:
органы государственной власти субъектов Российской Федерации;
органы местного самоуправления;
юридические лица;
граждане, в том числе индивидуальные предприниматели.
Органы исполнительной власти субъектов Российской Федерации, органы местного самоуправления обеспечивают организацию и проведение:
дезинсекции (в том числе акарицидных и ларвицидных обработок) в теплый период года (весенний, летний и при необходимости — в осенний периоды) в лесопарковой зоне, на территории природных очагов, на территории населенных пунктов;
благоустройства территории населенного пункта, своевременный вывоз твердых бытовых отходов, очистку от мусора и растительности пустырей, бесхозных производственных территорий;
дезинсекционных обработок жилых зданий, помещений (в том числе подвальных), сооружений, балансодержателями которых они являются, и прилегающей к ним территории;
преобразования лесных массивов в черте населенных пунктов или на примыкающих к ним территориях в лесопарковое состояние;
ликвидации несанкционированных свалок, очистки от сухостоя, густого подлеска лесных массивов, примыкающих к населенным пунктам;
благоустройства рекреационных зон, оборудования пляжных территорий, очистки от водных растений, недопущение заболоченности водоемов.
Юридические лица и индивидуальные предприниматели организуют и проводят обученным персоналом по вопросам дезинфектологии следующие дезинсекционные мероприятия:
обследования с целью учета численности, определения заселенности объектов и территории, их технического и санитарно-эпидемиологического состояния;
профилактические (организационные, гидротехнические, инженерно-технические, санитарно-гигиенические), агро- и лесотехнические мероприятия, предупреждающие заселение объекта членистоногими в жилых зданиях, помещениях, сооружениях, а также прилегающей к ним территории;
истребительные мероприятия с использованием ограничительных, физических, химических и биологических методов;
контроль эффективности истребительных мероприятий своими силами или силами исполнителей дезинсекционных работ или сторонних организаций.
Юридические лица и индивидуальные предприниматели при организации дезинсекционных мероприятий обеспечивают:
предварительное санитарно-эпидемиологическое обследование с целью определения наличия членистоногих и их видов;
выбор метода борьбы с членистоногими;
выполнение инженерно-технических и санитарно-эпидемиологических дезинсекционных мероприятий;
контроль во время проведения дезинсекционных мероприятий и после, с целью определения эффективности.
Для уничтожения, снижения численности и создания неблагоприятных условий среды обитания членистоногих используются дезинсекционные (химические и микробиологические) средства, прошедшие государственную регистрацию.
Граждане имеют право самостоятельно осуществлять дезинсекцию собственных жилых помещений, в том числе садовых домиков, надворных построек, дворовых территорий дезинсекционными средствами, разрешенными для применения гражданами в быту.
Определены требования к проведению дезинсекции в отношении отдельных видов членистоногих. Так при выявлении головного педикулеза обработку следует проводить в соответствии с инструкцией по применению соответствующего педикулицидного средства.
В очаге головного педикулеза обработка мебели, стен, пола, а также одежды не требуется. Обработке подлежат маты в спортивных залах школ.
При выявлении платяных вшей противопедикулезные мероприятия проводятся в очаге, а также в местах осмотра людей и их одежды, помещениях (пол, стулья, кушетки, дверные ручки и другие предметы), транспорте педикулицидными средствами на основе фентиона и малатиона.
При планировании противоклещевых обработок необходимо получить сведения о видовом составе клещей-переносчиков, их численности, распространении на данной территории и числе случаев присасывания к людям.
Противоклещевые обработки против иксодовых осуществляются при численности клещей 0,5 и более особей на флаго/километр или флаго/час.
Обработку в природных биотопах проводят до наступления эпидемиологически значимого сезона или заезда людей на опасную территорию. В летних оздоровительных учреждениях для детей и взрослых обработку проводят перед каждой сменой отдыхающих.
При расположении участка, подлежащего защите, на территории большого лесного массива проводят барьерную обработку полосы, прилегающей к участку, ширина которой не должна быть менее 50 метров.
Контроль численности клещей начинают через 3-5 дней после обработки и повторные учеты ведут каждые 10 дней. По полученным результатам принимают решение о необходимости повторной обработки.
СанПиН 3.5.2.3472-17 «Санитарно-эпидемиологические требования к организации и проведению дезинсекционных мероприятий в борьбе с членистоногими, имеющими эпидемиологическое и санитарно-гигиеническое значение» введены взамен СанПиН 3.5.2.1376-03 «Санитарно-эпидемиологические требования к организации и проведению дезинсекционных мероприятий против синантропных членистоногих». СанПиН 3.5.2.1376-03 признан утратившим силу.


← Назад в раздел

17 СанПин по радиационной безопасности вернут в 2021 году

Регуляторная гильотина привела к сбоям в некоторых сферах деятельности, что стало понятно буквально спустя несколько месяцев после того, как отдельные нормативные акты прекратили своё существование. То ли чиновники не смогли разработать новые требования, то ли не захотели этого, но 17 ранее отменённых нормативных актов решили вновь ввести в действие на неопределённый срок. В основном они распространяются на радиационную безопасность.

 

Перечень выведенных из-под регулярной гильотины санитарных норм по радиационной безопасности

На официальном сайте нормативно-правовых актов уже размещён проект документа под № 115213, обсуждения которого продлятся до 3 мая 2021 года. Судя по динамике, его всё-таки примут, ведь уже сейчас он проходит последние этапы рассмотрения и сбора предложений. Как только его утвердят, в п. 7 Постановления Правительства № 2467 внесут изменения, которые позволят вернуть в действие 17 норм по радиационной безопасности, попавших под действие регуляторной гильотины.

 

Обзор нормативных актов, которые вернут в действие в 2021 году
Пункт Постановления № 2467Нормативный актДата принятия
1229СП 2.6.1.759-992 июля 1999 года
1232Постановление № 9 «О введении в действие СП 2.6.4.1115-02»14 марта 2002 года
1233Постановление № 6 «О введении в действие СанПиН 2.6.1.07-03»4 февраля 2003 года
1234Постановление № 7 «О введении в действие СанПиН 2.6.1.08-03»4 февраля 2003 года
1236Постановление № 17 «О введении в действие СанПиН 2.6.1.1202-03»12 марта 2003 года
1237Постановление № 54 «О введении в действие СанПиН 2.6.1.1281-03»17 апреля 2003 года
1242Постановление № 155 «О введении в действие СанПиН 2.2.8.49-03»28 октября 2003 года
1243Постановление № 156 «О введении в действие СанПиН 2.2.8.48-03»28 октября 2003 года
1244Постановление № 157 «О введении в действие СанПиН 2.2.8.46-03»28 октября 2003 года
1246Постановление № 5 «О введении в действие СП 2.6.1.01-04»11 февраля 2004 года
1247Постановление № 17 «Об утверждении СП 2.6.1.23-05»22 июля 2005 года
1248Постановление № 36 «Об утверждении СП 2.6.1.2040-05»28 декабря 2005 года
1249Постановление № 33 «Об утверждении СП 2.6.1.2154-06»13 декабря 2006 года
1250Постановление № 29 «Об утверждении СП 2.6.1.2205-07»28 мая 2007 года
1252Постановление № 36 «Об утверждении СанПиН 2.6.1.2368-08»16 июня 2008 года
1253Постановление № 47 «Об утверждении СанПиН 2.6.1.2523-09»7 июля 2009 года
1263Постановление № 91 «Об утверждении СанПиН 2.6.1.2891-11»7 июля 2009 года

 

Обратите внимание! Все нормативно-правовые акты, которые выводятся из-под регуляторной гильотины, утверждены главным государственным врачом Российской Федерации и закреплены в Постановлении № 2467 под определённым номером. Возможно, что после пересмотра текста документа и внесения поправок, они будут располагаться в ином порядке.

 

Следует отметить, что нужно продолжать придерживаться требований нормативных актов по радиационной безопасности, так как ранее их уже вывели из-под регулярной гильотины, но до 1 сентября 2021 года. Сейчас решается только вопрос о том, чтобы сделать их бессрочными.

СанПиН 2.2.1/2.1.1.-17 — ЭкоСвет

СанПиН 2.2.1/2.1.1.-17 «Санитарно-защитные зоны, санитарная классификация предприятий, сооружений и иных объектов»

На федеральном портале проектов нормативных правовых актов появился проект (http://regulation.gov.ru/projects#npa=62248) Постановления Главного государственного санитарного врача Российской Федерации «Об утверждении санитарно-эпидемиологических правил и нормативов СанПиН 2.2.1/2.1.1. -17 «Санитарно-защитные зоны, санитарная классификация предприятий, сооружений и иных объектов».

Основной целью регулирования является совершенствование процедуры установления санитарно-защитных зон, в том числе, предусматривающее оптимизацию сроков установления СЗЗ, а также обеспечение возможности внесения сведений об установленных СЗЗ в государственный кадастр недвижимости.

Подготовка проекта обусловлена необходимостью совершенствования действующих санитарно-эпидемиологических требований к санитарно-защитным зонам и санитарной классификации предприятий, сооружений и иных объектов в целях предотвращения угрозы жизни или здоровью населения, угрозы возникновения и распространения заболеваний. Проект разрабатывается с учетом реализации поручений Правительства Российской Федерации.

В целях оптимизации процедур, касающихся установления зон с особыми условиями использования территории (ЗОУИТ), в том числе санитарно-защитных зон, и по итогам обсуждений данных вопросов в Правительстве Российской Федерации в 2016 году, приняты решения о:

  • наделении Правительства Российской Федерации (путем внесения соответствующих изменений в Федеральный закон «О санитарно-эпидемиологическом благополучии») полномочием по утверждению общего порядка установления санитарно-защитных зон и использования земельных участков, расположенных в границах указанных зон;
  • разработке Роспотребнадзором соответствующего проекта постановления Правительства Российской Федераци

При этом Роспотребнадзору также поручено актуализировать требования санитарных правил СанПиН 2.2.1/2.1.1.1200-03 «Санитарно-защитные зоны и санитарная классификация предприятий, сооружений и иных объектов» (далее – проект СанПиН), предусмотрев замену санитарных разрывов на санитарно-защитные зоны, устанавливаемые в отношении различных источников негативного влияния на среду обитания и здоровье человека, а также установление требований к определению размера указанных зон. В этой связи подготовка Роспотребнадзором проекта СанПиН и проведение всех предусмотренных законодательством процедур в отношении данного проекта будут осуществляться параллельно с подготовкой и проведением процедур в отношении проекта вышеуказанного постановления Правительства Российской Федерации «Об утверждении Порядка установления санитарно-защитных зон и использования земельных участков, расположенных в границах указанных зон».

В Роспотребнадзоре утвердили новый СанПиН по общепиту — Мурманский вестник

Фото https://citytraffic.ru/

Главный государственный санитарный врач РФ, глава Роспотребнадзора Анна Попова утвердила новые санитарно-эпидемиологические требования к организации общественного питания. Они вступят в силу 1 января 2021 года и будут действовать до 2027 года, говорится в постановлении, опубликованном в четверг на официальном интернет-портале правовой информации.

В новый СанПиН включены требования 17 актов в сфере общественного питания. Они учитывают особенности для взрослого и детского населения, инвалидов и лиц, нуждающихся в особом питании, а также при его реализации в детских садах, школах, больницах, социальных и специализированных учреждениях. Правила направлены на снижение риска для здоровья детей, обусловленного пищевым фактором, и повышение роли здоровьесберегающей функции питания.

«Новый СанПиН разработан с учетом риск-ориентированного подхода и новейших технологий, и современных видов упаковки и сырья, используемых предприятиями общественного питания в процессе изготовления, хранения, транспортировки и реализации продукции общественного питания, исключено дублирование требований других нормативных документов. Новеллой СанПиНа является не только существенное сокращение количества требований, но и установления их исходя из факторов (биологических, химических, физических и иных факторов среды обитания)», — пояснили в Роспотребнадзоре.

Новые правила были сокращены в пять раз по сравнению с действующим до 1 января СанПиНом, сообщает ТАСС.

Как отметил в беседе с ТАСС общественный омбудсмен в сфере ресторанного бизнеса при аппарате уполномоченного по защите прав предпринимателей в Москве, владелец сети ресторанов «Мясо & Рыба» Сергей Миронов, рестораторы принимали активное участие в разработке нового документа. «Уточнили устаревшие, спящие нормы, что в принципе очень хорошо. Сократившись в 5 раз, он потерял все те нормы, которые были совершенно не применимы. Проверяющие не знали, что с ними делать, рестораторы не понимали, как с ним работать, как его выполнять. Его придумали несколько десятилетий назад и он был совершенно не актуален. Все движется вперед, меняются технологии, средства дезинфекции, подходы — во всем мире что-то происходит», — отметил он.

Миронов выразил надежду, что «и на следующих этапах, выработке дополнительных методологий к ресторанному бизнесу, подходов, способов работы с ресторанами» бизнес будет участвовать. Эксперт отметил, что только совместное участие приводит к созданию рабочих и выполнимых норм.

Постановление Главного государственного санитарного врача РФ от 04.03.2011 N 17 «Об утверждении СанПиН 2.4.3.2841-11 «Изменения N 3 к СанПиН 2.4.3.1186-03 «Санитарно-эпидемиологические требования к организации учебно-производственного процесса в образовательных учреждениях начального профессионального образования» (вместе с «СанПиН 2.4.3.2841-11. Санитарно-эпидемиологические правила и нормативы…») (Зарегистрировано в Минюсте РФ 29.03.2011 N 20327) — последняя редакция

ФЕДЕРАЛЬНАЯ СЛУЖБА ПО НАДЗОРУ В СФЕРЕ ЗАЩИТЫ
ПРАВ ПОТРЕБИТЕЛЕЙ И БЛАГОПОЛУЧИЯ ЧЕЛОВЕКА

ГЛАВНЫЙ ГОСУДАРСТВЕННЫЙ САНИТАРНЫЙ ВРАЧ
РОССИЙСКОЙ ФЕДЕРАЦИИ

ПОСТАНОВЛЕНИЕ
от 4 марта 2011 г. N 17

ОБ УТВЕРЖДЕНИИ САНПИН 2.4.3.2841-11
«ИЗМЕНЕНИЯ N 3 К САНПИН 2.4.3.1186-03
«САНИТАРНО-ЭПИДЕМИОЛОГИЧЕСКИЕ ТРЕБОВАНИЯ К ОРГАНИЗАЦИИ
УЧЕБНО-ПРОИЗВОДСТВЕННОГО ПРОЦЕССА В ОБРАЗОВАТЕЛЬНЫХ
УЧРЕЖДЕНИЯХ НАЧАЛЬНОГО ПРОФЕССИОНАЛЬНОГО ОБРАЗОВАНИЯ»

В соответствии с Федеральным законом от 30.03.1999 N 52-ФЗ «О санитарно-эпидемиологическом благополучии населения» (Собрание законодательства Российской Федерации, 1999, N 14, ст. 1650; 2002, N 1 (ч. I), ст. 2; 2003, N 2, ст. 167; 2003, N 27 (ч. I), ст. 2700; 2004, N 35, ст. 3607; 2005, N 19, ст. 1752; 2006, N 1, ст. 10; 2006, N 52 (ч. I), ст. 5498; 2007, N 1 (ч. I), ст. 21; 2007, N 1 (ч. I), ст. 29; 2007, N 27, ст. 3213; 2007, N 46, ст. 5554; 2007, N 49, ст. 6070; 2008, N 24, ст. 2801; 2008, N 29 (ч. I), ст. 3418; 2008, N 30 (ч. II), ст. 3616; 2008, N 44, ст. 4984; 2008, N 52 (ч. I), ст. 6223; 2009, N 1, ст. 17; 2010, N 40, ст. 4969; 2011, N 1, ст. 6) и Постановлением Правительства Российской Федерации от 24.07.2000 N 554 «Об утверждении Положения о государственной санитарно-эпидемиологической службе Российской Федерации и Положения о государственном санитарно-эпидемиологическом нормировании» (Собрание законодательства Российской Федерации, 2000, N 31, ст. 3295; 2004, N 8, ст. 663; 2004, N 47, ст. 4666; 2005, N 39, ст. 3953) постановляю:

Утвердить санитарно-эпидемиологические правила и нормативы СанПиН 2.4.3.2841-11 «Изменения N 3 к СанПиН 2.4.3.1186-03 «Санитарно-эпидемиологические требования к организации учебно-производственного процесса в образовательных учреждениях начального профессионального образования», утвержденным Постановлением Главного государственного санитарного врача Российской Федерации, Первого заместителя Министра здравоохранения Российской Федерации от 28.01.2003 N 2 (зарегистрированы в Минюсте России 11.02.2003, регистрационный номер 4204), с изменениями, внесенными Постановлением Главного государственного санитарного врача Российской Федерации от 28.04.2007 N 24 «Об утверждении СанПиН 2.4.3.2201-07 — Изменения N 1 к СанПиН 2.4.3.1186-03» (зарегистрированы в Минюсте России 07.06.2007, регистрационный номер 9610), Постановлением Главного государственного санитарного врача Российской Федерации от 23.07.2008 N 45 «Об утверждении СанПиН 2.4.5.2409-08 (зарегистрированы в Минюсте России 07.08.2008, регистрационный номер 12085), Постановлением Главного государственного санитарного врача Российской Федерации от 30.09.2009 N 59 «Об утверждении СанПиН 2.4.3.2554-09 — Изменения N 2 к СанПиН 2.4.3.1186-03» (зарегистрированы в Минюсте России 06.11.2009, регистрационный номер 15197) (приложение).

Г.Г.ОНИЩЕНКО

Утверждены
Постановлением
Главного государственного
санитарного врача
Российской Федерации
от 04.03.2011 N 17

ИЗМЕНЕНИЯ N 3 К САНПИН 2.4.3.1186-03

САНИТАРНО-ЭПИДЕМИОЛОГИЧЕСКИЕ ТРЕБОВАНИЯ
К ОРГАНИЗАЦИИ УЧЕБНО-ПРОИЗВОДСТВЕННОГО ПРОЦЕССА
В ОБРАЗОВАТЕЛЬНЫХ УЧРЕЖДЕНИЯХ НАЧАЛЬНОГО
ПРОФЕССИОНАЛЬНОГО ОБРАЗОВАНИЯ

Санитарно-эпидемиологические правила и нормативы
СанПиН 2.4.3.2841-11

Внести изменения в СанПиН 2.4.3.1186-03:

1. В пункте 2.4.2.3 — первый абзац исключить.

2. Пункт 2.4.2.4 — исключить.

«Светило так, что глаза слепли»: тульские рекламщики устроили жителям «дискотеку» под окнами

https://www.tulapressa.ru/2021/10/svetilo-tak-chto-glaza-slepli-tulskie-reklamshhiki-ustroili-zhitelyam-diskoteku-pod-oknami/

Туляки не первый год жалуются на яркий рекламный экран

Жители дома №17 в Городском переулке Тулы не первый год жалуются на рекламный светодиодный экран, установленный напротив окон их многоэтажки. От яркого света не спасают никакие шторы, и спать по ночам, как заявляют жители, совершенно невозможно.

«В Туле по улице Городской переулок поставили баннер. Мы живём в доме номер 17, баннер стоит прямо напротив наших окон. Это какой то ужас, он светит так, что спать невозможно, не помогают никакие шторы. Помимо штор, окна и балконы завешиваем покрывалом. Владельцы ООО «ТСН» (владельцами экрана является тульская группа компаний «Медиа Траст», а ООО «ТСН» входит в холдинг, — прим. редакции) по настроению убавляют яркость, а ещё тогда, когда приходят из Роспотребнадзора. Устали уже звонить и писать, говорят, что всё нормально, а люди страдают из-за таких иллюминаций», — рассказала в соцсетях тулячка Лариса М. (орфография и пунктуация автора сохранены, прим. редакции).

В разговоре с корреспондентом «Тульской прессы» женщина добавила, что жители многоэтажки неоднократно обращались в Управление Роспотребнадзора и писали коллективные письма с жалобами.

«К нам и к соседям приходили с аппаратом замеряли, а потом ответили, что все в норме», — рассказала она. По словам тулячки, во время проверок рекламщики убавляют яркость экрана, но потом добавляют вновь.

Такая «дискотека» у туляков происходит с завидной регулярностью. «Вчера [6 октября] светило так, что глаза слепли», — жалуется Лариса.

Добавим, что на территории областного центра тульскому «Медиа Трасту» принадлежат более 20 светодиодных рекламных экранов: большинство из них находятся рядом или напротив жилых домов. В комментариях к посту многие отмечают, что проблема слишком ярких экранов наблюдается не только в Городском переулке: «У нас в Заречье возле Комсомольского парка стоит и лупит, как сварка», — пишет тулячка Алена.

Согласно требованиям СанПиН и СНиП, в дневное время суток яркость рекламных видеоэкранов не ограничивается, но вот с наступлением темноты максимально допустимая яркость рекламных видеоэкранов не должна превышать допустимых значений. Но, видимо, в оружейной столице этими правилами пренебрегают, отчего жители близлежащих домов вынуждены из года в год привлекать внимание к своей проблеме через социальные сети.

Новости | Инфекционные болезни и микробиология | Pitt Public Health

Медицинский филиал Техасского университета в Галвестоне предложил КЕВИНУ МЕЛОДИ (IDM ’17) постдокторантуру в исследовательской группе BSL-4, возглавляемой Томасом Гейсбертом. Из-за безопасности и профессиональных навыков, необходимых для выполнения работы, Кевин пройдет обширную подготовку перед тем, как приступить к исследованиям, связанным с патогенами с высокой степенью сдерживания.
«Отличная компания в отличной отрасли», — говорит ЗАХАРИ СВАН (IDM ’16), который недавно получил должность специалиста по нормативным вопросам, специалиста по клинической стратегии в CRO в парке исследовательского треугольника по имени Cato Research.
Помогая с представлением Чрезвычайного плана президента США по борьбе со СПИДом (PEPFAR), EMERSON EVANS (IDM ’12) в настоящее время работает в Южной Африке над деталями с CDC.
Премия Сан-Пин Ван за лучшую устную презентацию аспирантов на конференции Общества фундаментальных исследований хламидий в 2017 г. была вручена Тейлору ПОСТОНУ (IDM ’17). Эта награда учреждена в честь памяти доктора Ф.Сан-Пин Ван и денежный приз были щедро пожертвованы благотворительным фондом Сан-Пин Ван.
В 2012 году, за год до завершения магистра здравоохранения, КРИСТИНА ФАРМАРТИНО (IDM ’13) была нанята в качестве исполнительного директора компании Open Door, которая предоставляет вспомогательное жилье и услуги репрезентативных получателей платежей людям, живущим с ВИЧ / СПИДом, включая активных потребителей инъекционных наркотиков. улучшить свое здоровье и стабильность жилья. Помимо прочего, Farmartino за три года привлекла более 250 000 долларов дополнительного диверсифицированного финансирования.
ДЖЕННИФЕР БОУЛИНГ (IDM ’21) посетила Конференцию по науке и технологиям химической и биологической защиты, чтобы представить свой доклад «Влияние пола на защиту, обеспечиваемую вакцинацией ослабленными штаммами Francisella tularensis в модели кролика».
ТИТУСВИЛЛ ГЕРАЛЬД — Члены сообщества и студенты из кампуса Питта в Титусвилле собрались, чтобы услышать, как LINDA FRANK из IDM обсуждает злоупотребление наркотиками в сравнении со злоупотреблением наркотиками, связь опиоидной эпидемии с распространением ВИЧ / СПИДа и гепатита С, доступные стратегии профилактики и лечения и последствия для медицинские работники, семьи, члены сообщества и местные организации.
Профессор Рассел Рул Райчек был эпидемиологом, который занимался обучением и наставничеством студентов. Он считал, что у специалистов общественного здравоохранения должен быть «профессиональный портфель», полный инструментов и навыков, необходимых для оказания воздействия на здоровье населения. Эта награда позволяет студентам магистратуры здравоохранения развивать дополнительные навыки и компетенции для профессиональной деятельности. В этом году победителями стали ROSA DE FERRARI (BCHS) и ASHYLN LANCASTER (IDM).
ЭШЛИН ЛАНКАСТЕР и ГЕНРИ МА, оба студенты IDM, получили стипендию Оуэна от университета.По завещанию Сэмюэля Т. Оуэнса-младшего предоставляются стипендии для студентов, которые обещают высокие академические достижения.
NEW YORK TIMES. Исследователь инфекционных заболеваний ЭРНЕСТО МАРКЕС говорит, что около 3 процентов из 1000 беременных бразильских женщин в недавней выборке были инфицированы вирусом Зика. «Проблема никуда не делась. У нас все еще есть дела. А будущее уже рожденных детей, рожденных вирусом Зика, осложняется бедностью и ограниченными ресурсами. «Большинство этих младенцев имеют низкий социально-экономический статус и полагаются на систему здравоохранения для оказания помощи.Мана очень сложно …

Samurai Champuru Shimizuten — Меню: Напитки (Симидзу / Идзакая (паб в японском стиле))

オ リ オ ン ビ ー ル

Пиво Орион

サ ッ ポ ロ 静 岡麦 酒 生

Пиво Sapporo Shizuoka

コ ロ ナ エ ク ス ト ラ

Корона Экстра

Виды напитков
Пиво
Страна происхождения
Мексика
Содержание алкоголя
4.5%

サ ッ ポ ロ プ レ ミ ア ム ア ル ー ル フ リ ー

Sapporo Premium Безалкогольный

Виды напитков
Безалкогольное пиво

シ ャ ン デ ィ ガ フ

Шандыгафф

Виды напитков
Коктейли (пивная база)
Виды напитков
Коктейли (пивная база)

ブ ラ ッ ク ア イ

Черный глаз

Виды напитков
Коктейли (пивная база)

は い さ い ボ ー ル

Хайболл

Виды напитков
Хайбол?

Виски, смешанный с газированной водой.

ち ゅ ら さ ​​ん ボ ー ル

Чурасан Хайбол

Виды напитков
Хайбол?

Виски, смешанный с газированной водой.

て ぃ だ さ ん ボ ー ル

Тейдасан Хайбол

Виды напитков
Хайбол?

Виски, смешанный с газированной водой.

角 ハ イ ボ ー ル

Каку Хайболл

Виды напитков
Хайбол?

Виски, смешанный с газированной водой.

ジ ン ジ ャ ー ハ イ ボ ー ル

Имбирный хайбол

Виды напитков
Хайбол?

Виски, смешанный с газированной водой.

コ ー ラ ハ イ ボ ー ル

Кола Хайболл

Виды напитков
Хайбол?

Виски, смешанный с газированной водой.

Виды напитков
Прочие ликеры

沖 縄 パ ン チ

Окинавский пунш

Виды напитков
Прочие ликеры
Виды напитков
Прочие ликеры

カ シ ス さ ん ぴ ん

Cassis and Sanpin Tea (окинавский жасминовый чай)

Виды напитков
Коктейли (Cassis Base)

ピ ー チ サ ン ピ ン

Peach and Sanpin Tea (окинавский жасминовый чай)

Виды напитков
Коктейли (персиковая база)

エ メ ラ ル ド ピ ー チ

Изумрудный персик

Виды напитков
Коктейли (персиковая база)

し ま く ~ ら ~

Шимаку-ра-

Виды напитков
Прочие ликеры
Виды напитков
Прочие ликеры
Виды напитков
Японское саке
Виды напитков
Японское саке

雪 下 香梅 大 吟 醸

Sekkakoubai Daiginjo

Виды напитков
Дайгинджо Саке?

Изготовлен в основном из риса, шлифованного до 50% исходного зерна, рисового солода, воды и дистиллированного спирта.

さ ん ぴ ん 茶

Sanpin Tea (окинавский жасминовый чай)

Виды напитков
Безалкогольные напитки

う っ ち ん 茶

Ucchin Tea (окинавский чай)

Виды напитков
Безалкогольные напитки

* Фотографии показаны только для иллюстрации.

* Цена может отличаться.

* Цена в японских иенах (JPY)

Система многоязычного преобразования — оригинальная система Gurunavi, защищенная патентами (патент Японии № 5898365, № 5952479).

(PDF) SOX17 регулирует эпителиально-стромальные перекрестные помехи матки, действуя через дистальный энхансер выше Ihh

.

дельта-значений Ct были рассчитаны с использованием 18 S контрольных результатов амплификации для получения

относительных уровней мРНК на образец.Информация для всех праймеров представлена ​​в

дополнительной таблице 2.

Анализ на микрочипах. Качество РНК оценивали с помощью Agilent 2100 Bioanalyzer

(Agilent Technologies). Анализ микроматрицы был выполнен с помощью Genomic и

RNA Profiling Core в Медицинском колледже Бейлора. После амплификации библиотеки и маркировки

отдельные образцы кДНК гибридизовали с массивом Agilent G3 Mouse GE

8 × 60 k в соответствии с инструкциями производителя (Agilent Technologies).

Данные массива были проанализированы с использованием Bioconductor с квантильной нормализацией. Гены

,

с нескорректированным значением p <0,01 и абсолютным кратным изменением ≥1,4 были идентифицированы

как дифференциально регулируемые.

Иммунопреципитация и секвенирование хроматина. Цельную ткань матки промывали вспышкой

и отправляли в компанию Active Motif для иммуно-осаждения и секвенирования (ChIP-seq) анализа хроматина Factor-Path хроматина

. Ткань фиксировали, а затем

быстро разрезали на мелкие фрагменты перед иммунопреципитацией антителом

SOX17 (AF1924; R&D Systems).Связанная с SOX17 ДНК была очищена и амплифицирована

для создания библиотеки и секвенирована с использованием анализатора генома 2 компании Illumina.

Необработанные чтения ChIP-Seq (36 нуклеотидов, односторонние) были обработаны и сопоставлены с эталонным геномом мыши

( mm9; Genome Reference Consortium Mouse Build 37

от июля 2007 г.) от Active Motif. Интервалы, связанные с SOX17, были идентифицированы с использованием анализа ChIP-Seq на основе модели

(MACS 1.3.7.1) и сопоставлены с соседними генами

в пределах 25 КБ с помощью разработки сценария Perl.

Анализ данных. Дифференциально экспрессируемые гены, сгенерированные из данных микрочипов

, были проанализированы с использованием программного обеспечения Ingenuity Pathway Analysis (IPA, http: // www.

ingenuity.com) и базы данных для аннотаций, визуализации и интегрированного обнаружения

covery (DAVID, http : //david.ncifcrf.gov/). Транскриптомы, аналогичные профилю экспрессии гена

Sox17ed / ed, были идентифицированы путем поиска доступных наборов данных в

базе данных NextBio (https: // www.nextbio.com/). Данные ChIP-Seq были проанализированы с использованием программного обеспечения Cistrome (http://cistrome.org/ap/). Программное обеспечение GraphPad Prism

было реализовано для одностороннего дисперсионного анализа, теста множественного сравнения и анализа t-критерия Стьюдента

для qRT-PCR и децидуальных влажных весов. Гормональный ответ

элементов идентифицировали с использованием анализа мотивов HOMER de novo (http: //homer.salk.

edu / homer /). Тепловые карты с иерархической кластеризацией были созданы с использованием микрофонов Partek Geno-

Suite 6.6 программное обеспечение.

Доступность данных

Данные, подтверждающие выводы этого исследования, доступны из статьи и файлов с дополнительной информацией

или у соответствующего автора по запросу. Необработанные файлы данных

FASQ (GSE118264) и данные полногеномного секвенирования (GSE118327)

депонированы в базе данных NCBI Gene Expression Omnibus под регистрационным номером SuperSeries

GSE118328.

Получено: 6 марта 2018 г. Принято: 31 августа 2018 г.

Ссылки

1.Lydon, J. P. et al. У мышей, лишенных рецептора прогестерона, наблюдаются плейотропные

репродуктивные аномалии. Genes Dev. 9. С. 2266–2278 (1995).

2. Rubel, C.A. et al. Gata2-зависимая транскрипционная сеть регулирует чувствительность матки к прогестерону и функцию эндометрия. Cell Rep. 17,

1414–1425 (2016).

3. Lee, K. et al. Индийский еж является основным медиатором передачи сигналов прогестерона в матке мыши. Nat. Genet. 38, 1204–1209 (2006).

4. Rubel, C. A., Franco, H. L., Jeong, J. W., Lydon, J. P. & DeMayo, F. J. GATA2

экспрессируется в критические моменты в матке мыши во время беременности. Ген.

Expr. Узоры 12, 196–203 (2012).

5. Rubel, C.A. et al. Ресурсы исследования: Полногеномный профиль связывания рецептора прогестерона

в матке мыши. Мол. Эндокринол. 26. С. 1428–1442 (2012).

6. Шеперс Г. Е., Тисдейл Р. Д. и Купман П. Двадцать пар sox: степень,

гомология и номенклатура семейств генов факторов транскрипции sox мыши и человека

.Dev. Cell 3, 167–170 (2002).

7. Абделалим Э. М., Эмара М. М. и Колаткар П. Р. Факторы транскрипции SOX

как ключевые игроки в плюрипотентных стволовых клетках. Корень. Cells Dev. 23, 2687–2699

(2014).

8. Kamachi, Y. & Kondoh, H. Белки Sox: регуляторы спецификации клеточной судьбы

,

и дифференцировки. Разработка 140, 4129–4144 (2013).

9. Кифер, Дж. К. Назад к основам: гены Sox. Dev. Дин. 236, 2356–2366 (2007).

10.Уилсон, М. и Купман, П. Соответствие SOX: белки-партнеры и кофакторы

семейства SOX регуляторов транскрипции. Curr. Opin. Genet. Dev. 12,

441–446 (2002).

11. Wegner, M. Sox универсального применения: многие роли белков Sox в экспрессии гена

. Int. J. Biochem. Cell Biol. 2010. Т. 42. С. 381–390.

12. Вегнер М. С головы до ног: множественные аспекты белков Sox. Nucleic

Acids Res. 27, 1409–1420 (1999).

13.Саркар А. и Хочедлингер К. Семейство факторов транскрипции sox: универсальные регуляторы судьбы стволовых клеток и клеток-предшественников. Клеточные стволовые клетки 12,15–30 (2013).

14. Klaus, M. et al. Ингибирование взаимодействия ДНК SOX18 / Prox1-

, опосредованное структурой и ловушкой. Nucleic Acids Res. 44. С. 3922–3935 (2016).

15. Ferrari, S. et al. SRY, как и HMG1, распознает острые углы в ДНК. EMBO J.

11, 4497–4506 (1992).

16. Pontiggia, A. et al.Изменяющие пол мутации влияют на архитектуру ДНК-комплексов SRY-

. EMBO J. 13, 6115–6124 (1994).

17. Александер Дж. И Стейнир Д. Ю. Молекулярный путь, ведущий к образованию энтодермы

у рыбок данио. Curr. Биол. 9. С. 1147–1157 (1999).

18. Clements, D. & Woodland, H.R. Изменения в судьбе эмбриональных клеток, вызванные экспрессией

фактора энтодермальной транскрипции, Xsox17. Мех. Dev. 99,

65–70 (2000).

19.Hudson, C., Clements, D., Friday, R.V, Stott, D. & Woodland, H.R.

Xsox17alpha и -beta опосредуют образование энтодермы у Xenopus. Cell 91,

397–405 (1997).

20. Kanai-Azuma, M. et al. Истощение дефинитивной энтодермы кишечника у Sox17-нулевых мышей

мутантных. Development 129, 2367–2379 (2002).

21. Ким И., Сондерс Т. Л. и Моррисон С. Дж. Зависимость Sox17 отличает регуляцию транскрипции

плодных гемопоэтических стволовых клеток от взрослых.Cell

130, 470–483 (2007).

22. Spence, J. R. et al. Sox17 регулирует сегрегацию клонов органов вентральной части передней кишки

клеток-предшественников. Dev. Cell 17,62–74 (2009).

23. Uemura, M. et al. Экспрессия и функция мышиного гена Sox17 в спецификации

предшественников желчного пузыря / желчных протоков во время раннего морфогенеза передней кишки

. Biochem. Биофиз. Res. Commun. 2010. Т. 391. С. 357–363.

24. Инь, С. Молекулярные механизмы факторов транскрипции Sox ​​во время развития печени, желчных протоков и поджелудочной железы.Семин. Cell Dev. Биол. 63,68–78

(2017).

25. Лилли, А. Дж., Лако, Г., Кускофф, В. Факторы транскрипции SOXF в развитии сердечно-сосудистой системы

. Семин. Cell Dev. Биол. 63,50–57 (2017).

26. Kandoth, C. et al. Мутационный ландшафт и значимость для 12 основных

типов рака. Nature 502, 333–339 (2013).

27. Hirate, Y. et al. Гаплонедефицит мыши Sox17 приводит к снижению фертильности самок

из-за нарушения имплантации.Sci. Реп.6, 24171 (2016).

28. Guimaraes-Young, A., Neff, T., Dupuy, A. J. и Goodheart, M. J. Условная делеция

Sox17 выявляет комплексные эффекты на аденогенез матки и функцию

. Dev. Биол. 414. С. 219–227 (2016).

29. Soyal, S. M. et al. Cre-опосредованная рекомбинация в клеточных линиях, экспрессирующих рецептор прогестерона

. Бытие 41,58–66 (2005).

30. Daikoku, T. et al. Lactoferrin-iCre: новая линия мышей для изучения функции гена

эпителия матки.Эндокринология 155, 2718–2724 (2014).

31. Jeong, J. W. et al. Foxa2 необходим для развития эндометриальных желез мыши

и фертильности. Биол. Репродукция. 2010. Т. 83. С. 396–403.

32. Стюарт, С. Л. Роль фактора ингибирования лейкемии (LIF) и других цитокинов

в регулировании имплантации у млекопитающих. Анна. NY Acad. Sci. 734, 157–165

(1994).

33. Kelleher, A. M. et al. Коробка с вилкой a2 (FOXA2) необходима для функции и фертильности матки.Proc. Natl. Акад. Sci. USA 114, E1018 – E1026 (2017).

34. Костер, М. И. и Руп, Д. Р. Механизмы, регулирующие стратификацию эпителия.

Анну. Rev. Cell Dev. Биол. 23,93–113 (2007).

35. Финн К. А. и Мартин Л. Контроль имплантации. J. Reprod. Fertil. 39,

195–206 (1974).

36. Мартин, Л., Дас, Р. М. и Финн, К. А. Ингибирование прогестероном маточной пролиферации

эпителиальной пролиферации у мышей. J. Endocrinol.57, 549–554 (1973).

37. Багчи И. К., Чеон Ю. П., Ли К. и Багчи М. К. Рецептор прогестерона —

регулируемые генные сети при имплантации. Передний. Biosci. 8, s852 – s861 (2003).

38. Пан, Х., Дэн, Ю. и Поллард, Дж. У. Прогестерон блокирует индуцированный эстрогеном синтез ДНК

посредством ингибирования лицензирования репликации. Proc. Natl Acad. Sci.

USA 103, 14021–14026 (2006).

39. Li, Q. et al. Антипролиферативное действие прогестерона на эпителий матки

опосредуется Hand2.Science 331, 912–916 (2011).

40. Kim, T.H. et al. ARID1A необходим для функции эндометрия на ранних сроках беременности. PLoS Genet. 11, e1005537 (2015).

41. Ruiz-Alonso, M. et al. Массив восприимчивости эндометрия для диагностики и персонализированный перенос эмбрионов

в качестве лечения пациентов с повторной неудачей имплантации

. Fertil. Стерил. 100, 818–824 (2013).

42. Diaz-Gimeno, P. et al. Инструмент для геномной диагностики восприимчивости эндометрия человека

на основе транскриптомной подписи.Fertil. Стерил. 95,50–60

(2011). 60 e1-15.

43. Tapia-Pizarro, A. et al. Экспрессия гена эндометрия обнаруживает нарушение передачи сигналов прогестерона

у женщин, невосприимчивых к имплантации эмбриона. Репродукция.

Биол. Эндокринол. 12, 92 (2014).

СВЯЗЬ В ПРИРОДЕ | DOI: 10.1038 / s41467-018-06652-w СТАТЬЯ

СВЯЗЬ В ПРИРОДЕ | (2018) 9: 4421 | DOI: 10.1038 / s41467-018-06652-w | www.nature.com/naturecommunications 13

Содержимое предоставлено Springer Nature, применяются условия использования.Права защищены

SOX17 регулирует эпителиально-стромальный перекрестный ток матки, действуя через дистальный энхансер выше Ihh

Abstract

Беременность у млекопитающих зависит от способности матки поддерживать имплантацию эмбриона. Предыдущие исследования выявили ген Sox17 как нижележащую мишень сети Pgr- Gata2-зависимой транскрипции, которая управляет геномными действиями в эндометрии матки, восприимчивом к имплантации эмбриона. Здесь мы сообщаем, что удаление Sox17 в эпителии матки нарушает передачу сигналов фактора ингибирования лейкемии (LIF) и индийского гомолога хэджхог (IHH), что приводит к неудаче имплантации эмбриона.In vivo делеция SOX17-связывающей области на 19 т.п.н. выше локуса Ihh с помощью технологии CRISPR-Cas снижает экспрессию Ihh , специфически в матке, и изменяет собственно эпителиально-стромальные взаимодействия эндометрия, тем самым нарушая беременность. Этот интервал связывания SOX17 также связан с GATA2, FOXA2 и PGR. Этот кластер связывания факторов транскрипции является общим для 737 генов матки и может представлять собой ключевой регуляторный элемент, необходимый для экспрессии генов эпителия матки.

Введение

Стероидный гормон прогестерон (P4) действует через свой родственный рецептор PGR, регулируя восприимчивость матки к имплантации эмбриона. PGR регулирует пролиферацию эпителиальных клеток матки, принятие эпителием инвазии эмбриона и децидуальную дифференцировку стромальных клеток в поддержку развития эмбриона 1 . Индийский еж (кодируется Ihh ), экспрессируемый в эпителии матки, находится под контролем P4 через PGR, а также его модификатор передачи сигналов GATA2, способствуя перекрестному взаимодействию компартментов матки, необходимому для эпителиально-стромального взаимодействия и облегчения успешной беременности 2 5 .Идентификация факторов, модулирующих активность PGR, имеет решающее значение для определения молекулярных механизмов, регулирующих фертильность. Недавние исследования с использованием полногеномного транскриптомного подхода идентифицировали SOX17 как регулятор действия PGR в эпителии матки 5 .

SOX17 (кодируется Sox17 ) представляет собой фактор транскрипции, принадлежащий к семейству группового бокса Y-связанной области Y, определяющего пол, а именно SOX. Каждый из геномов мыши и человека кодирует 20 Sox генов 6 , многие из которых ( Sox2, Sox9, Sox17, Sox4, и Sox18 ) являются ключевыми детерминантами клеточной идентичности и регулируют способность к репрограммированию. судьба клетки — новатор в области эпигенетического ремоделирования генома 7 13 .Чтобы выполнять такую ​​роль, факторы транскрипции SOX могут специфически связывать и изгибать ДНК с углами в диапазоне от 60 ° до 70 ° 14 16 . В частности, SOX17 регулирует эмбриогенез 17 20 , поддержание фетальных и неонатальных гемопоэтических стволовых клеток 21 , сегрегацию вентральных энтодермальных органов передней кишки 22 7 развитие сосудов 25 .Недавно SOX17 был идентифицирован как мишень для PGR 5 и нового мутированного гена в карциноме тела матки 26 , что предполагает потенциальную роль опосредования действия PGR в матке во время беременности и болезненных состояний.

Самки мышей с потерей одного аллеля Sox17 продемонстрировали снижение фертильности 27 . Сообщалось, что мыши с удалением Sox17 в PGR-положительных клетках не имеют маточных железистых структур и бесплодны 28 .Точно так же удаление Sox17 в эпителии матки также приводит к бесплодию 28 . Здесь мы предоставляем механистическое понимание регуляции фертильности SOX17, где эпителиальный SOX17 посредством регуляции экспрессии Indian hedgehog Ihh регулирует пролиферацию эпителиальных клеток матки, способность эпителия поддерживать имплантацию эмбриона и последующую децидуализацию клеток стромы эндометрия. Цистромный и транскриптомный анализы в сочетании с редактированием in vivo показывают, что SOX17 регулирует экспрессию Ihh , воздействуя на энхансерную область в 19 т.п.н., удаленную от промотора Ihh .Анализ элементов, связывающих эту область энхансера, предполагает наличие общей кассеты регуляторных элементов, состоящих из факторов транскрипции, для регуляции экспрессии генов эпителия матки.

Результаты

Мыши, лишенные SOX17 в эпителии матки, бесплодны

Временная и пространственная экспрессия SOX17 в отделах матки на протяжении доимплантационного периода, день беременности (GD) от 0,5 до 4,5, была проанализирована с помощью иммуногистохимии у беременных самок дикого типа. мышей (дополнительный рис.). GD 0,5 соответствует утру наличия посткоитальной пробки. Окрашивание на белок SOX17 было видно как в просветном эпителии (LE), так и в железистом эпителии (GE). К GD 1.5 экспрессия SOX17 как в LE, так и в GE увеличивалась и оставалась постоянной до GD 4.5. SOX17-положительные клетки также были обнаружены в меньшинстве клеток в стромальном компартменте (дополнительный фиг. 1a ).

Физиологическая роль SOX17 в функции взрослой матки была исследована путем скрещивания мышей с условным аллелем Sox17 ( Sox17 f / f мышей) 21 с Pgr Cre 29 или Ltf iCre 30 мышей для удаления Sox17 в PGR-положительных клетках U5 / d ) или конкретно в эпителии матки ( Sox17 ed / ed ) соответственно.Помимо того, что он специфичен для эпителия матки, удаление гена у мышей Ltf iCre инициируется в период полового созревания 30 . Анализ с помощью количественной ПЦР в реальном времени (qRT-PCR) показал снижение мРНК Sox17 ( P <0,01, дисперсионный анализ (ANOVA) с апостериорным тестом Тьюки) во всей матке обоих Sox17 ed / ed и Sox17 d / d самок мышей по сравнению с Sox17 f / f матки (дополнительный рис.). Иммуногистохимический анализ показал, что уровни SOX17 не определялись в эпителии матки взрослых самок Sox17 d / d и Sox17 ed / ed мышей (дополнительная фиг. в стромальном отделе матки. Эти SOX17-положительные клетки проявляют реактивность изолектина B4, что свидетельствует об эндотелиальной идентичности (дополнительная фигура 1c ). Кроме того, не было обнаружено различий в экспрессии SOX17 в матке у мышей Sox17 f / f и Pgr cre / + на GD 3.5 (Дополнительный рис. 1d ).

Sox17 d / d и Sox17 ed / ed самки мышей были бесплодны. Хотя в контрольной группе, Sox17 f / f , мыши родили 48,2 ± 3,6 детенышей на самку за 6-месячный период, в среднем 8,0 ± 0,6 детенышей на помет ( n = 4), ни Sox17 ed / ed или Sox17 d / d самки мышей за это время дали потомство.Чтобы определить причину бесплодия, самок мышей Sox17 ed / ed и Sox17 d / d тестировали на имплантацию эмбриона, децидуализацию стромы матки и пролиферацию эпителия. Мышей умерщвляли при GD5.5, и матки исследовали на наличие участков имплантации эмбрионов. Как показано на рис. (Верхняя панель), в то время как Sox17 f / f показал нормальные места имплантации эмбриона, никаких видимых участков имплантации не было обнаружено ни в Sox17 ed / ed / ed / ed , ни на Sox17 d / d самок мышей.Суперовуляция показала, что овуляция у этих мышей была нормальной, а дефект имплантации был вызван тем, что эмбрионы не смогли прикрепиться к эпителию эндометрия на GD 4.5 (дополнительный рис. 1e, f ). Это указывало на то, что неудача имплантации была связана не с отсутствием эмбрионов, а скорее с неспособностью этих эмбрионов прикрепиться и имплантироваться в матку.

Фенотип условной делеции Sox17 в матке взрослой мыши. a Участки имплантации эмбрионов (верхняя панель) и формирование искусственной децидуомы (нижняя панель) в Sox17 f / f (контроль), Sox17 ed / ed ( Ltf Sox17 f / f ) и Sox17 d / d ( Pgr Cre Sox17 9057 n = 5).Масштабные линейки: 10 мм. IS, место имплантации. b Отношение децидуального к контролю веса рупора в Sox17 f / f (черные точки), Sox17 ed / ed (синие квадраты) и Sox17 (розовые треугольники) мышей ( n = 5). c Иммуногистохимическое окрашивание Ki67 (ряд 1), FOXA2 (ряд 2), TRP63 (ряд 3) в 2-месячной матке Sox17 f / f , Sox17 ed / ed и Sox17 d / d самок мышей в GD 3.5 ( n = 3). В строке 4 показано окрашивание TRP63 8-месячной матки ( n = 3). Масштабные линейки: 100 мкм. S — строма; LE, люминальный эпителий; ГЭ, железистый эпителий. d Количество эндометриальных желез в 2-месячной матке от Sox17 f / f (черные точки), Sox17 ed / ed (синие квадраты) и Sox17 d / d (розовые треугольники) мышей при GD 3,5 ( n = 3 мыши × 2 секции на мышь = 6).Различные буквы в верхнем индексе обозначают значимые ( P <0,05, ANOVA с апостериорным критерием Тьюки) различия. Данные представлены как средние значения ± S.E.M

В дополнение к нарушению имплантации эмбриона, была проанализирована способность клеток стромы эндометрия подвергаться искусственно индуцированной децидуализации. Матка мышей Sox17 f / f , обнаружила устойчивую децидуальную реакцию, о чем свидетельствует увеличенный размер и влажный вес децидуомы, сформированной в стимулированном левом роге матки ( P <0.01, ANOVA с апостериорным тестом Тьюки) (рис., Нижняя панель). Однако матки мышей Sox17 ed / ed и Sox17 d / d не смогли сформировать децидуальную оболочку (рис., Нижняя панель), и влажный вес стимулированного рога не был отличается от нестимулированного рупора ( P > 0,01, ANOVA с апостериорным тестом Тьюки) (рис.).

SOX17 контролирует пролиферацию и дифференцировку эпителия

Во время доимплантационного периода матка первоначально пролиферирует в ответ на выброс овуляторного эстрогена (E2), а по мере повышения уровня P4 PGR ингибирует пролиферацию, индуцированную E2.Анализ пролиферации эпителиальных клеток матки, измеренный с помощью окрашивания Ki67, показывает, что при GD 3,5 мыши Sox17 f / f показали минимальное окрашивание Ki67 (H-балл; 2,86 ± 2,00), тогда как обе мыши Sox17 ed / ed (H-оценка; 217,30 ± 9,68) и Sox17 d / d (H-score; 179,10 ± 6,03) положительное окрашивание эпителия матки ( P < 0,05, ANOVA с Тьюки апостериорный тест) для Ki67 и, таким образом, не продемонстрировал ингибирования пролиферации в доимплантационный период (рис., ряд 1 и дополнительный рис. ). Интересно, что окрашивание Ki67 в Sox17 ed / ed больше ( P <0,05, ANOVA с апостериорным тестом Тьюки), чем у Sox17 d / d . Это изменение в пролиферации является неожиданным и может быть связано с аблацией Sox17 у новорожденных, или изменениями в эпителии матки из-за фенотипа фокальной стратификации.

SOX17 определяет характеристики эпителия матки.

Анализ морфологии эпителия матки показал потерю Sox17 , влияющую на дифференцировку эпителиальных клеток матки. Sox17 d / d матки показали уменьшение количества маточных желез по сравнению с Sox17 ed / ed и Sox17 f / f мышей (рис. Затем мы проанализировали экспрессию двух генов, специфичных для эндометриальных желез матки, Foxa2 и Lif . Фактор транскрипции FOXA2 является критическим регулятором постнатального развития маточных желез 31 . Фактор ингибирования лейкемии (LIF) представляет собой цитокин, экспрессируемый в железах матки, и является критическим регулятором имплантации эмбриона 32 .Экспрессия FOXA2 не определялась в GE как Sox17 d / d , так и Sox17 ed / ed матки мыши по сравнению с Sox17 f / f Рис., Ряд 2). Как показано на дополнительном рисунке 1f , мРНК Foxa2 и Lif были значительно снижены в Sox17 ed / ed и Sox17 d / d по сравнению с маткой мыши по сравнению с маткой мыши. Sox17 f / f матка изолирована от GD 3.5 мышей. Было показано, что потеря Foxa2 до начала полового созревания приводит к бесплодию из-за потери маточных желез, тогда как потеря Foxa2 у взрослых приводит к сохранению морфологии маточных желез, но все же потере фертильности из-за отсутствия маточных желез. GE экспрессия цитокина LIF 33 . Следовательно, как и в случае с FOXA2, Sox17 имеет решающее значение для развития маточных желез новорожденных и функции маточных желез у взрослых.

Предыдущая работа продемонстрировала, что потеря маточных желез приводит к дефектам имплантации и что дефект имплантации может быть устранен введением рекомбинантного LIF, rLIF, беременным мышам.Чтобы определить, был ли дефект имплантации у мышей с потерей Sox17 исключительно следствием железистого дефекта и потери LIF, мы попытались исправить дефект имплантации путем введения rLIF. В этом эксперименте мыши с делецией Foxa2 с использованием мыши Pgr Cre служили в качестве контроля, поскольку было показано, что эта мышь имеет дефект имплантации, который может быть повторно использован rLIF 33 . Внутрибрюшинные инъекции мышиного rLIF на GD 3.5 не спасла имплантация эмбриона у мышей Sox17 ed / ed по сравнению с положительным контролем ( Sox17 f / f мыши, получавшие носитель; и Foxa2 d / d мыши, получавшие мышиный rLIF) и отрицательный контроль ( Sox17 ed / ed мыши, получавшие носитель) (дополнительная фигура 1i ). Это демонстрирует, что хотя экспрессия LIF зависит от SOX17, др. Пути, регулируемые с помощью SOX17 в GE, являются критическими для имплантации в матку мышей.

Анализ морфологии эпителия матки показал, что вместо простого столбчатого эпителиального слоя просвета, наблюдаемого в матке Sox17 f / f , у Sox17 d / d клетки матки отображались вторые слой в 2-х месячном возрасте. Этот эпителий показал положительное окрашивание базальных клеток на TRP63 34 . Эпителий матки у самок мышей Sox17 ed / ed не демонстрировал этой стратификации, а TRP63-положительные клетки выявлялись только спорадически вдоль эпителия матки у самок мышей в возрасте 2 месяцев (рис., ряд 3). Количественная оценка с помощью qRT-PCR показала, что мРНК Trp63 была самой высокой ( P <0,05, ANOVA с апостериорным тестом Тьюки) в Sox17 d / d матки и все еще оставалась высокой ( P <0,05 , ANOVA с апостериорным тестом Тьюки) в матке Sox17 ed / ed по сравнению с экспрессией Trp63 в матке Sox17 f / f (дополнительный рисунок 1g ). Из-за разного времени событий рекомбинации между Pgr Cre и Ltfi Cre , дальнейший морфологический анализ и окрашивание TRP63 были проведены в матке 8-месячных мышей.Оба Sox17 ed / ed и Sox17 d / d матки демонстрировали эпителиальную стратификацию со значительным увеличением количества TRP63-положительных базальных клеток по сравнению с Sox17 f / f / uteri (рис., 4 ряд). Этот анализ показывает, что эпителиальный SOX17 имеет решающее значение для поддержания эпителия матки. Этот анализ также продемонстрировал, что экспрессия SOX17 в эпителии матки имеет решающее значение для функции матки.Поскольку Sox17 ed / ed и Sox17 d / d показали аналогичный фенотип, следующий функциональный анализ роли Sox17 был проведен только с использованием Sox17 ed / ed мышей.

SOX17 регулирует передачу сигналов E2 и P4 в матке.

Поскольку функция матки регулируется стероидными гормонами яичников 35 38 , было исследовано влияние абляции Sox17 на передачу сигналов E2 и P4.Иммуногистохимический анализ матки мышей GD 3.5 в возрасте 2 месяцев Sox17 ed / ed показал увеличение общего (ESR1) и фосфорилированного (pESR1) рецептора эстрогена как в эпителиальных, так и в стромальных клетках (рис.). Одновременно, как нижестоящая мишень ESR1, уровни мРНК Ltf и Greb1 были повышены, но Lif подавлялся в Sox17 ed / ed uteri; и не было обнаружено различий в уровне мРНК Lifr между Sox17 f / f и Sox17 ed / ed uteri (рис.). Уровни PGR снижены в эпителиальных клетках и ниже в стромальных клетках из-за отсутствия индукции в предимплантационный период. Нижестоящая мишень PGR, Areg и Ihh также подавлялась в матке Sox17 ed / ed / ed (рис.)

Нарушение регуляции передачи сигналов эстрогена и прогестерона в окне Sox17 -дефицит восприимчивости. a Иммуногистохимическое окрашивание ESR1, фосфорилированных ESR1 и PGR в GD 3.5 маток от мышей Sox17 f / f и Sox17 ed / ed ( n = 3). Окрашивание IgG в качестве отрицательного контроля. Масштабные линейки: 100 мкм. b Количественная оценка генов-мишеней ESR ( Ltf, Greb1, Lif, Lifr ), а также генов-мишеней PGR ( Areg, Ihh ) в матке GD 3.5 из Sox17 f / f (черный точек) и Sox17 ed / ed (красные точки) мышей ( n = 7).* P <0,05 (тест Стьюдента t ). Данные представлены в виде средних значений ± SEM

Sox17 абляция нарушает сигнальный путь Indian hedgehog

Отмечая, что IHH является основным медиатором передачи сигналов PGR в матке мыши 3 и значительно снижается в матке, удаленной Sox17, мы далее исследовали эффектор ниже IHH сигнальных путей для передачи сигналов между эпителием матки и стромой (Fig.). Иммуногистохимический анализ матки двухмесячных мышей Sox17 ed / ed на GD 3.5 показано снижение рецепторов IHH, то есть PTCh2 и PTCh3, в основном в стромальных клетках матки, а также снижение нижестоящих медиаторов, COUP-TFII (NR2F2) и HAND2 39 в стромальных клетках под эпителием матки. (Инжир. ). Следовательно, повышенный уровень фосфорилированного FRS2 (pFRS2) был обнаружен в эпителии матки мышей Sox17 ed / ed (фиг.). qRT-PCR показала аналогичный паттерн экспрессии генов для Ptch2 , Nr2f2 , Hand2 , а также Fgf9 и Fgf12 в Sox17 ed / ed i .5 (рис.).

Изменение сигнальных путей Indian Hedgehog (IHH) во время окна восприимчивости. a Иммуногистохимическое окрашивание рецепторов IHH PTCh2 и PTCh3, а также нижестоящего медиатора COUP-TFII, HAND2 и фосфорилированного FRS в матке GD 3.5 из Sox17 f / f и ed Sox17 мышей ( n = 3). Масштабные линейки: 100 мкм. b Количественная оценка генов, связанных с передачей сигналов IHH, в GD 3.5 маток от Sox17 f / f (черные точки) и Sox17 ed / ed (красные точки) мышей ( n = 7). * P <0,05 (тест Стьюдента t ). Данные представлены как средние значения ± SEM

SOX17 регулирует транскриптом матки для восприимчивости

Для дальнейшей идентификации основного молекулярного механизма для фенотипа повторяющейся неудачной имплантации, наблюдаемого у мышей Sox17 ed / ed , анализ микроматрицы РНК была проведена на цельной ткани матки, взятой на GD 3.5 естественной беременности. В общей сложности 1595 генов не регулировались при GD 3,5, причем 760 генов были активированы, а 835 генов подавлены (дополнительные данные 1 ). Среди генов с нарушенной регуляцией 125 генов были непосредственно связаны с восприимчивостью и имплантацией матки, как показано на тепловой карте (рис.), Включая гены, отвечающие за E2 (например, Clca3, Fzd10, Greb1, Igfbp5, Wnt4, Ltf, Muc1, Sprr2f ). , P4-чувствительные гены (например, Fosl2, Il6, Msx1, Msx2, Msx3, Osmr, Runx1, Stat3 ), LE-специфические гены ( Cldn7, Alox12e, Calb1, Cln5, Cnn3, Cobl, Ctsd, Hdc, Irg1 , Jam2, Areg ), ГЭ-специфические гены ( Calca, Cbs, Foxa2, Ier3, Il6st, Lif, Prss28, ​​Prss29, Spink3 ), гены, связанные с передачей сигналов hedgehog ( Ihh, Dhh, Glipr2, Ptch2, Ptch3, Fgf12 ), гены, связанные с пан-маточным эпителием (например,g., Btg2, Cd14 , Gata1, Ltf, Muc1, Muc16, Mt1, Mt2, Sox17, Sprr2f ) и другие гены, связанные с рецептивностью и имплантацией матки ( Foxo1, Notch2, Notch4 ). Экспрессия в эндометрии мышей некоторых из этих генов была подтверждена с помощью qRT-PCR (дополнительная фигура 4 ). Обогащенные наверху аннотации «Путь изобретательности» для списка аберрантно регулируемых генов (1595 генов) включали (1) развитие, функции и аномалии репродуктивной системы; (2) развитие и функция сердечно-сосудистой системы; (3) онкологические и дерматологические заболевания; (4) воспалительная реакция; и (5) молекулярный транспорт (рис.). Полный список функциональных аннотаций можно найти в дополнительных данных 2 . Интересно, что были затронуты пути, связанные с эндометриозом (поражен), имплантацией (деактивирован), эпителиальным раком (активирован), воспалением (активирован), а также транспорт и секреция молекул (деактивированы). Измененные пути участвуют в пролиферации и воспалении онтогенетических клеток, которые важны для имплантации эмбриона.

SOX17 регуляция транскриптома матки. a Тепловая карта генов, связанных с функцией матки, дифференциально регулируемых между Sox17 f / f и Sox17 ed / ed матки мыши на GD 3,5, полученной на основе анализа микрочипов. b Обогащение функциональной аннотации в дифференциально экспрессируемых генах между Sox17 f / f и Sox17 ed / ed матки мыши при GD 3,5 с помощью анализа IPA. c Перекрытия и корреляции транскриптомов Sox17 KO с Foxa2 KO или Arid1a KO, полученные при сравнении профилей экспрессии генов NextBio. d Иммуногистохимическое окрашивание ARID1A в матке GD 3.5 от Sox17 f / f и Sox17 ed / ed мышей ( n = 3; строка 1), а также GD 3.5 uteri от Arid1a f / f и Arid1a d / d ( Pgr Cre Arid1a

f7 / f85 905 905 905 905 905 905 905 905 905 9057 = 3; строка 2) Масштаб: 100 мкм

Затем мы выполнили корреляционный поиск, чтобы определить, какие доступные наборы данных в базе данных Illumia BaseSpace Correlation Engine показали сходство с профилем экспрессии генов Sox17 ed / ed в матке во время окна восприимчивости.Двумя верхними наборами данных, которые имеют сходные паттерны экспрессии генов с регулируемым SOX17 транскриптомом на GD 3.5, были (1) транскриптом, регулируемый FOXA2, и (2) транскриптом, регулируемый ARID1A (рис.). Транскриптомы Sox17 ed / ed и Foxa2 ed / ed имеют общие 482 затронутых гена, причем 212 генов активированы, а 235 генов подавлены (дополнительные данные 3 ). Это открытие дополнительно подтверждает нашу гипотезу о том, что потеря эпителиальных функций желез у мышей Sox17 ed / ed , вероятно, происходит через путь, опосредованный Foxa2 . Sox17 изд / изд и Arid1a ed / ed транскриптомов имели 344 общих нерегулируемых гена, причем 106 генов были активированы, а 178 генов подавлены (дополнительные данные 4 ). Хотя уровень мРНК Arid1a не изменился в микрочипе Sox17 KO, иммуногистохимический анализ показал снижение ARID1A в матке Sox17 ed / ed по сравнению с Sox17 f / 905 матки в GD 3.5 (рис., Ряд 1), что могло быть связано с посттрансляционной регуляцией. Однако не было обнаружено различий в экспрессии SOX17 между Arid1a -аблированной маткой и маткой дикого типа на GD 3.5 (рис., Строка 2), что свидетельствует об иерархической роли SOX17 в регуляции ARID1A, которая имеет решающее значение для фертильности матки и значительно ниже. эндометрий у женщин с эндометриозом 40 .

Сигнальный путь SOX17 присутствует в эндометрии человека

Чтобы изучить роль SOX17 в функции эндометрия человека, мы проанализировали паттерн его экспрессии в ткани эндометрия у женщин с эндометриозом и без него на пролиферативной и секреторной фазах ( n = 7 на фазу на болезнь).SOX17 был высоко экспрессирован в эпителии эндометрия у женщин без эндометриоза в пролиферативной (H-балл; 288,00 ± 8,25) и секреторной фазах (H-балл 278,57 ± 9,01), однако его экспрессия была значительно снижена в эпителии эндометрия у женщин с эндометриоз в пролиферативной (H-оценка; 119,29 ± 38,83), а также секреторной фазах (H-оценка 48,57 ± 12,94) по сравнению с контролем (рис.). Это демонстрирует, что экспрессия SOX17 в эпителии матки консервативна у мышей и человека, а в эндометрии человека на экспрессию SOX17 влияет эндометриоз.Затем корреляция между SOX17 и IHH была исследована в эндометрии человека. Уровни мРНК SOX17 и IHH были положительно коррелированы в эндометрии человека из двух независимых когорт, {«type»: «entrez-geo», «attrs»: {«text»: «GSE4888», «term_id»: «4888 «}} GSE4888 и {» type «:» entrez-geo «,» attrs «: {» text «:» GSE58144 «,» term_id «:» 58144 «}} GSE58144 (рис.), Поддерживающие сохранение выражения между мышью и человеком. При сравнении генов, измененных в Sox17 -ablated матке на GD 3.5 с биомаркерами рецептивности эндометрия человека 41 43 , 31 человеческий ортолог был идентифицирован (рис.). Во время окна восприимчивости 23 из этих генов подавлялись в матке, подвергшейся абляции по Sox17 , но подавлялись в восприимчивом эндометрии человека; и восемь генов были усилены в матке, подвергнутой аблации Sox17, , но подавлены в эндометрии человека, что позволяет предположить, что роль SOX17 в эндометрии человека и мыши является консервативной.

Консервативный путь SOX17 для восприимчивости эндометрия у человека.Иммуногистохимическое окрашивание a и количественная оценка H-балла b SOX17 в срезе эндометрия человека от женщин с эндометриозом и без него в пролиферативной и секреторной фазе менструального цикла. Масштабные линейки: 50 мкм. * P <0,001 (ANOVA с апостериорным тестом Тьюки). Данные представлены в виде средних значений ± S.E.M. c Корреляция уровней между IHH и SOX17 в эндометрии человека ({«type»: «entrez-geo», «attrs»: {«text»: «GSE4888», «term_id»: «4888»}} GSE4888 и { «type»: «entrez-geo», «attrs»: {«text»: «GSE51981», «term_id»: «51981»}} GSE51981). d Сравнение генов, измененных в Sox17 -аблированной матке при GD 3,5, с биомаркерами рецептивности эндометрия человека. Зеленый шрифт обозначает подавление гена; красный шрифт обозначает активацию гена

SOX17, а основные регуляторы матки показывают совместную занятость генома

Поскольку абляция Sox17 повлияла на дифференцировку эпителия матки, трудно определить, какие изменения экспрессии генов связаны с прямой транскрипционной регуляцией экспрессии генов или с последствиями дифференцировки эпителиальных клеток.Чтобы определить, какие гены потенциально регулируются SOX17 на уровне транскрипции, мышей Sox17 f / f сделали овариэктомию, отдыхали в течение 2 недель и затем вводили P4. Через 6 часов рога матки мгновенно замораживали и ткань подвергали анализу ChIP-seq. SOX17 ChIP-seq продемонстрировал повышенное связывание с промотором и 5′-нетранслируемыми областями (дополнительная фигура 3a, b ). Анализ мотивов Гомера de novo описал, что SOX17 в первую очередь связывается в местах с элементами ответа ядерного рецептора, в которых семейства SOX, GATA, а также PGR были среди мотивов, обогащенных сверху (дополнительный рис. 3c ). В результате 11 277 генов были идентифицированы как связанные с SOX17 в пределах 25 т.п.н. выше и / или ниже границы гена (дополнительные данные 5 и 6 ).

Чтобы идентифицировать гены, потенциально регулируемые SOX17, дифференциально экспрессируемые гены между Sox17 ed / ed и контрольной маткой перекрывались списком связанных с SOX17 генов. Из 1595 дифференциально регулируемых генов 807 генов были идентифицированы как содержащие сайты связывания SOX17 в пределах 25 т.п.н. выше и / или ниже границы гена (рис.и дополнительные данные 7 ). Особый интерес представляет 78 генов, которые, как было показано, связаны с восприимчивостью и имплантацией матки, 34 из которых являются специфичными для эпителия матки (рис.). Основываясь на выводах, что транскриптомы Sox17 ed / ed и Foxa2 ed / ed в значительной степени перекрываются и Sox17 является целью PGR 5 на ранних сроках беременности 2 , мы оценили общие пики связывания путем сравнения набора данных SOX17 ChIP-seq с тремя другими независимыми наборами данных ChIP-seq мыши (FOXA2 44 , PGR 5 и GATA2 2 ).Этот анализ выявил 624 общих пика (отнесенных к 737 генам) (рис.). При дальнейшем перекрытии с 1595 дифференциально регулируемыми генами в матке, подвергнутой воздействию Sox17 , 92 гена были идентифицированы как гены-мишени SOX17 с общими сайтами связывания FOXA2, PGR и GATA2. Многие из них ( Areg, Btg2, Cnn3, Cobl, Glul, Ihh, Irg1, Lrp2, Pfkfb3, Sox17, и Sprr2f ) являются хорошо известными генами, специфичными для эпителия матки, что указывает на то, что SOX17 может взаимодействовать с другими факторами транскрипции для регулируют экспрессию генов матки.

Связывание и регуляция Ihh с помощью анализа цистрома матки SOX17. a SOX17 ChIP-seq с использованием Sox17 f / f мышей, идентифицированных до 11277 генов с интервалами связывания в пределах 25 т.п.н. от границы гена. Из этих генов 807 дифференциально регулировались в микроматрице Sox17 KO на уровне GD 3.5, а 78 генов были непосредственно связаны с восприимчивостью и имплантацией матки. b Анализ наборов данных SOX17, FOXA2, PGR и GATA2 ChIP-seq выявил 624 общих пика, которые приписывались 737 генам.Из этих генов 92 гена были идентифицированы как гены-мишени SOX17 с общими сайтами связывания для FOXA2, PGR и GATA2. c Браузер генома отслеживает связывание SOX17, FOXA2, PGR и GATA2 с предполагаемыми энхансерами для гена Ihh в P 4 -обработанной матке или GD 3.5 uteri. Представления браузера генома UCSC, показывающие сопоставленное покрытие чтения данных SOX17, FOXA2, PGR и GATA2 ChIP-seq. Локус гена Ihh и области, нацеленные на гРНК для делеции CRISPR / Cas9 in vivo, выделены синим и желтым цветом соответственно.Ihh29, предполагаемый энхансер на 19 т.п.н. выше локуса гена Ihh

Интересно, что события связывания SOX17 in vivo происходили в предполагаемом энхансере на 19 т.п.н. выше локуса гена Ihh (рис.). Анализ ChIP-seq показал, что FOXA2 44 , PGR 5 и GATA2 2 также связаны в этой области (рис.). Эта область на 19 т.п.н. выше гена Ihh расположена во внутригенной области гена Nhej1 . Nhej — / — Было получено мышей, и нарушение не изменило область Ihh29 . Мыши Nhej — / — были жизнеспособными и фертильными 45 . Функциональный анализ роли области Ihh29 может быть проведен без каких-либо опасений, что изменение экспрессии Nhej может затруднить анализ фейотипа матки. Поэтому, чтобы оценить значимость этих сайтов связывания для восприимчивости матки, в частности передачи сигналов IHH, мы использовали технологию CRISPR / Cas9 для удаления этого предполагаемого энхансера in vivo (рис.). Таким образом, линия мыши ( Ihh29 d / d ) была создана с делецией 577 п.н., содержащей предполагаемый энхансер SOX17 (фиг. И дополнительный фиг. 3d ).

Энхансер эндометрия для

Ihh контролирует восприимчивость матки

Мыши, несущие делецию на 19 т.п.н. выше гена Ihh , родились с нормальными менделевскими частотами без явных дефектов скелета, как сообщалось у мышей с делецией зародышевой линии Ihh 46 .Эта делеция не повлияла на экспрессию Ihh , которая необходима для нормального развития. Затем мы проанализировали влияние делеции Ihh29 на экспрессию и тканевую специфичность Ihh в кишечнике и матке самок мыши GD 2.5. Экспрессия Sox17 и Areg в матке также была проанализирована (фиг.). По сравнению с контролем ( Ihh + / + , дикий тип) мРНК Ihh была подавлена ​​( P <0.05) в матке Ihh29 d / d именно в матке, не влияя на уровни мРНК Sox17 и Areg (рис.). Экспрессия Ihh не была изменена в кишечнике (рис.). Иммуногистохимическое окрашивание дополнительно подтвердило подавление IHH в матке Ihh29 d / d при GD 2,5 (дополнительный рисунок 4a ). Однако потеря экспрессии IHH не была полной, поскольку клетки, положительные по IHH, можно было идентифицировать в матке Ihh29 d / d в GD 2.5 (Дополнительный рис. 4a ). Поскольку у мышей не проявлялись другие неутробные фенотипы, связанные с аблацией Ihh , делеция энхансера пораженной фланкирующей области Ihh была специфичной для матки.

SOX17-связывающая область на 19 т.п.н. выше гена Ihh управляет окном восприимчивости матки. a Количественное определение Sox17 , Areg , Экспрессия гена Ihh в матке и / или кишечнике из Ihh + / + и Ihh29 женщина d / d .5 ( n = 5). b Щенки, рожденные от Ihh + / + и Ihh29 d / d самок мышей в ходе 6-месячного испытания по разведению ( n = 4). c , d Места имплантации эмбрионов ( c ) и количественная оценка ( d ) в матке из Ihh + / + и Ihh29 d / d .5 ( n = 5). Масштабные линейки: 10 мм. e , f Формирование искусственной децидуомы ( e ) и соотношение веса децидуального и контрольного рогов ( f ) в Ihh + / + и Ihh29 d / d самки мышей в DD2 ( n = 6) и DD5 ( n = 5). Масштабные линейки: 10 мм. г Количественная оценка гена Ihh в децидуальном и контралатеральном роге из Ihh + / + и Ihh29 d / d самок мышей на DD2 () n . h j Иммуногистохимическое окрашивание SOX17, TRP63, FOXA2, ESR1, pESR1, PGR, PTCh2, COUP-TFII, HAND2 и pFRS2 в матке GD 3.5 из Ihh и Ihh + / +/h d / d мышей ( n = 3). Масштабные линейки: 100 мкм. Черные точки обозначают Ihh + / + , а желтые точки обозначают Ihh29 d / d . * P <0,05 (тест Стьюдента t для a , b , d и ANOVA с апостериорным тестом Тьюки для f , g ).Данные представлены в виде средних значений ± SEM

Фенотипические последствия делеции Ihh29 -связывающей области затем были проанализированы на основе способности матки поддерживать беременность (включая места имплантации), подвергаться искусственно индуцированной децидуальной реакции, IHH сигнализация в матке и морфология матки. Ihh29 d / d самок продемонстрировали недостаточную фертильность, о чем свидетельствует меньшее количество ( P <0,05) детенышей, рожденных на самку и детенышей на помет в 6-месячном испытании по разведению, по сравнению с Ihh + / + мышей (рис.). Кроме того, меньшее количество ( P <0,05) участков имплантации при GD 5,5 (рис.) И нарушение децидуализации (рис.) Могут объяснять такую ​​субфертильность у Ihh29 d / d самок. Уменьшение количества мест имплантации не было связано с влиянием на овуляцию или развитие эмбриона, поскольку не было разницы в количестве эмбрионов, выведенных из матки и яйцевода при GD 2,5 между Ihh29 d / d и контрольными мышами при GD 2,5. GD 2.5 (Дополнительный рис. 4b ). Не было различий в уровне P4 в сыворотке между этими двумя группами, что указывает на нормальную эндокринную регуляцию секреции гормона (дополнительный рисунок 4c ).

Иммуногистохимический анализ показал, что уровни экспрессии и распределение эпителиальных SOX17 и FOXA2 матки в матке GE не различались между Ihh + / + и Ihh29 d / d GD3 у мышей.5 (рис.). Также не было TRP63-положительного окрашивания базальных клеток в эпителии матки между ними (рис.). Однако анализ оси передачи сигналов IHH показал, что мыши Ihh29 день / день показали значительное снижение PTCh2, COUP-TFII, HAND2 в стромальных клетках и увеличение pFRS2 в основном в эпителиальных клетках матки при GD. 3.5 (рис.). Общий ESR1 был повышен в основном в стромальных клетках, а pESR1 увеличивался как в эпителиальном, так и в стромальном компартментах Ihh29 d / d матки по сравнению с Ihh + / + мышей при GD.5 (рис.). Кроме того, PGR снизился в эпителиальных и стромальных клетках мышей Ihh29 d / d по сравнению с Ihh + / + мышей (рис.). Хотя удаление матки Ihh сделало мышей полностью бесплодными 3 , Ihh29 d / d мышей обнаружил гипоморфный фенотип матки Ihh , неполная абляция, скорее всего, из-за неполной абляции Ihh Ihh. , что подтверждается обнаружением ( P <0.05) мРНК Ihh в децидуальной оболочке, а не в контралатеральном роге Ihh29 d / d матки в DD2 (эквивалент GD6.5) (рис.).

Discussion

Здесь мы демонстрируем, что эпителиальный SOX17 матки является критическим для регуляции пролиферации эпителиальных клеток матки, развития и дифференцировки маточных желез, имплантации эмбриона и способности матки поддерживать беременность (Рис.). Транскриптомный и цистромный анализы продемонстрировали, что SOX17 регулирует транскрипцию генов эпителия матки.Среди генов, регулируемых SOX17, есть Ihh . Удаление Sox17 или SOX17-связывающей области дистальнее гена Ihh изменяет собственно эпителиально-стромальный перекрестный обмен в матке, необходимый для беременности 3 , 39 , в котором SOX17 и PGR ко-регулируются сигнализация PGR и сигнализация IHH. Нарушение передачи сигнала IHH от эпителия к строме впоследствии повлияло на стромальный PGR через его регулятор, стромальный COUP-TFII (рис.). Экспрессия SOX17 законсервирована в эндометрии человека, и показано, что многие из генов, регулируемых SOX17 у мышей, являются маркерами восприимчивости матки у людей.

SOX17 регулирует путь передачи сигналов IHH, чтобы управлять эпителиально-стромальными взаимодействиями матки во время окна рецептивности.

Sox17 был идентифицирован как измененный при раке эндометрия 26 . Мыши, полученные в этом отчете (т.е. Sox17 d / d и Sox17 ed / ed ), не заболевают раком эндометрия.Это указывает на то, что Sox17 не является основной причиной рака эндометрия. Однако этот анализ показывает, что SOX17 ингибирует пролиферацию эпителиальных клеток матки. Кроме того, транскриптомные изменения в ответ на абляцию эпителия Sox17 перекрываются с транскриптомом, ослабленным Arid1a . ARID1A сильно мутирован при раковых заболеваниях, связанных с эндометриозом, таких как рак яичников и рак эндометрия 47 . Это указывает на то, что роль Sox17 в развитии рака матки может заключаться в модификации критического регулятора гомеостаза клеток эндометрия.

Ранее сообщалось, что самки мышей с гаплонедостаточностью Sox17 являются субфертильными из-за нарушения имплантации 27 . Этого не наблюдалось в Sox17 d / + или Sox17 ed / + в данном исследовании, в котором Sox17 d / + ( Pgr Created / + Sox17 f / + ) дали средний размер помета 5.3 ± 0,79 детенышей / помет ( n = 5 маток), в то время как Sox17 f / + самок дали помет 5,9 ± 0,89 детенышей / помет ( n = 4 матки), что позволяет предположить, что снижение фертильности у мыши Sox17 +/- , вероятно, являются следствием неутробных действий SOX17. Также сообщалось, что мыши с эпителиальной делецией Sox17 с использованием мышей Sprr2f Cre бесплодны с нормальным аденогенезом 28 .Наши результаты также показывают, что удаление Sox17 в эпителии матки с помощью Ltf iCre приводит к полной отмене имплантации эмбриона, что не только согласуется с предыдущим отчетом, но также предоставляет более подробную функциональную временную шкалу эпителия Sox17. по плодородию. Модель с нокаутом Sprr2f Cre Sox17 также показывает наличие желез в матке, которое отличается от такового у Pgr Cre -опосредованная Sox17 модель абляции 28 905 .Было высказано предположение, что постоянство желез было связано с участием SOX17-экспрессирующих стромальных клеток. Наши результаты идентифицировали SOX17-экспрессирующие клетки в стромальном компартменте как эндотелиальные клетки. Более того, удаление Foxa2 в эпителии матки после полового созревания также позволяет формировать железы, несмотря на бесплодие 33 . Следовательно, наличие сальников в моделях Sprr2f Cre и Ltf iCre , вероятно, связано со сроками абляции Sox17 .В обеих моделях рекомбинация генов откладывается до периода полового созревания 30 , 33 , 48 .

Роль Sox17 в матке мыши двоякая. Во-первых, он регулирует развитие и дифференцировку маточных желез. Во-вторых, он регулирует экспрессию ключевых генов, регулирующих фертильность матки. Потеря эпителия Sox17 постнатально уменьшила количество желез и вызвала расслоение эпителия в матке двухмесячных мышей.Постпубертатная аблация Sox17 привела к задержке расслоения эпителия и отсутствию железистой редукции в 8-месячной матке. Однако функция маточных желез была изменена, о чем свидетельствует снижение экспрессии Lif . Это предполагает, что подобно Foxa2 , Sox17 регулирует постнатальный аденогенез, и как только маточные железы развиваются, они регулируют функцию желез. Более того, значительное снижение FOXA2 в GE Sox17 -аблированной матки в GD 3.5, и отсутствие связывания SOX17 с локусом гена Foxa2 указывает на непрямую регуляцию SOX17 на экспрессию гена Foxa2 . Примечательно, что потеря LIF в этой модели была не единственной причиной бесплодия, поскольку введение рекомбинантного LIF не спасало фенотип имплантации. Это наблюдение предполагает, что дополнительные пути, параллельные оси FOXA2-LIF, также необходимы для постпубертатных функций железы.

Эпителиальная стратификация с экспрессией маркера базальных клеток TRP63 в Sox17 KO сходна с фенотипами матки, наблюдаемыми после удаления β-катенина 49 , Wnt4 50 или G 2 и условная маточная активация сглаженная 51 .Это делает SOX17 регулятором целостности эпителия матки наряду с передачей сигналов P4, WNT и hedgehog. Сообщается, что SOX17 ингибирует передачу сигналов WNT 52 . Однако в этом случае фенокопия потери SOX17 вызывает потерю WNT4 / β-catenin, указывая на то, что его действие в эпителии матки не ингибирует передачу сигналов WNT, а работает совместно с этими сигнальными путями, регулируя дифференцировку эпителия матки.

Причина бесплодия у мышей Sox17 ed / ed связана с потерей двух основных сигнальных путей.Передача сигналов LIF и IHH изменена в этой модели мышей. LIF продуцируется GE и действует на его рецепторы в LE, регулируя инвазию эмбриона и децидуализацию стромы 32 . IHH инициирует эпителиально-стромальную коммуникационную сеть, которая необходима для прекращения пролиферации маточных эпителиальных клеток, инвазии эмбрионов и децидуализации 3 . Однако механизм, с помощью которого SOX17 изменяет эти пути, затрудняется его действием по регулированию эпителиальной и железистой дифференцировки.Сходные транскриптомные изменения между Sox17 ed / ed и Foxa2 ed / ed дополнительно предполагают существенную роль SOX17 в аденогенезе и поддержании функциональных желез в матке. Транскриптомный, цистромный анализ и анализ редактирования генома показывают, что роль SOX17 в регуляции функции матки может быть не вторичной по отношению к изменениям дифференцировки эпителия матки, но может быть следствием прямой регуляции генов, критических для фертильности матки.Анализ сайтов связывания для SOX17 продемонстрировал 737 генов, которые имеют общие сайты связывания (624 пика) для PGR, GATA2 и FOXA2. Среди этих генов 92 были идентифицированы в ответ на регуляцию SOX17 через общие маточные энхансеры, то есть некодирующие области, содержащие цис- -регуляторные элементы, которые связаны с факторами транскрипции и могут определять клеточную идентичность 53 , 54 . Предполагаемый энхансер на 19 т.п.н. выше гена Ihh был идентифицирован на основе данных SOX17, FOXA2, PGR и GATA2 ChIP-seq из ткани матки.Таким образом, энхансер Ihh29 был дополнительно удален in vivo с использованием технологии CRISPR / Cas9 и подтвержден секвенированием. Мыши были субфертильными с нарушенной передачей сигналов IHH только в ткани матки, что подтверждает связь дистального энхансера матки с помощью SOX17, который регулирует ген Ihh . Анализ этой области энхансера идентифицировал кассету сайтов связывания факторов транскрипции, которые могут иметь решающее значение для экспрессии гена эпителия матки. Легко предположить, что некоторые комбинации этих факторов транскрипции позволят дифференцировке клеток-предшественников достичь фенотипа эпителиальных клеток матки.Эпителиальные клетки матки трудно культивировать in vitro, поэтому понимание регуляции этих факторов транскрипции и с их помощью может привести к разработке лучших моделей in vitro эпителиальной функции матки.

Методы

Образцы эндометрия человека

Это исследование было проведено в соответствии с федеральными правилами, регулирующими исследования на людях. Все процедуры были одобрены следующими комитетами по этике: Наблюдательный совет / комитет-A (IRB) системы здравоохранения Гринвилля (файл IRB № Pro00000993 и Pro00013885) и IRB Университета Кейпел-Хилл в Северной Каролине (файл №: 05-1757).Информированное согласие было получено от всех пациентов до их участия в этом исследовании. Чтобы изучить паттерны экспрессии SOX17 в эутопическом эндометрии у женщин с эндометриозом и без него (контрольная группа по сравнению с группой с эндометриозом), всего было использовано 28 образцов из пролиферативной и секреторной фаз ( n = 7 на фазу на группу).

Животные

Все исследования на животных проводились в соответствии с руководящими принципами Комитета по уходу и использованию животных Национального института здоровья и окружающей среды (NIEHS) и в соответствии с протоколом, одобренным NIEHS.Мышей, несущих аллель Sox17 f / f (инвентарный номер: 007686, лаборатория Джексона, Бар-Харбор, штат Мэн), разводили на Ltf icre / + или Pgr cre / cre / + мышей для создания Ltf icre / + Sox17 f / f или Pgr cre / + Sox17 f / 90/857 9057 905 905 .

CRISPR / Cas9-опосредованная делеция энхансерной области in vivo

CRISPR / Cas9 однонаправляющие РНК, нацеленные на Ihh29 энхансерную область, были идентифицированы с использованием инструмента MIT CRISPR Design (http: // crispr.mit.edu) 55 57 , то есть GGTACAGACTGGAGCCCTTA и TTATAGATAGCAGGCACTAT. Каждую sgRNA клонировали в плазмидный вектор pDR274 и транскрибировали in vitro с использованием набора MEGAshortscript T7 (Life Technologies). МРНК Cas9 синтезировали in vitro. МРНК Cas9 (50 нг мкл -1 ) и sgRNA (25 нг мкл -1 для каждой) микроинъектировали в цитоплазму оплодотворенных яиц суперовулированных самок мышей C57BL / 6 J (JAX) и имплантировали в яйцеводы псевдопеременных .Мышей-основателей скрещивали с мышами C57BL / 6 J дикого типа с получением F1-гетерозиготных мышей ( Ihh29 d / + ). Мышей F1 с идентичным генотипом скрещивали для получения гомозиготных мышей F2 ( Ihh29 d / d ). Все мыши были генотипированы с помощью ПЦР-амплификации геномной ДНК, выделенной из кончика хвоста, с последующим секвенированием по Сэнгеру. Большие делеции были идентифицированы с помощью серийного генотипирования ПЦР с использованием праймеров, которые были разработаны для амплификации ~ 500 п.н., охватывающих целевую последовательность.

Анализ фертильности животных

Фертильность оценивалась путем спаривания 8-недельного возраста (1) Ltf icre / + Sox17 f / f или Pgr cre / + Sox17 ф / ж суки; и (2) Ihh29 + / + или Ihh29 d / d самок с самцами C57BL / 6 J дикого типа в течение 6 месяцев. Регистрировали количество пометов и детенышей.

Оценка имплантации эмбриона

Самка в возрасте восьми недель Sox17 f / f , Ltf icre / + Sox17 f / f Crew / + Sox17 f / f мышей, а также самок Ihh29 + / + и Ihh29 d / d интактных мышей были скрещены с интактными мышами C57BL / 6. мышей-самцов, отдельно.Наличие копулятивной пробки регистрировали как GD 0,5. Мышей умерщвляли инъекцией пентобарбитала натрия (Fatal Plus; Vortech Pharmaceuticals, Дирборн, Мичиган) утром, через 5 дней (т.е. GD 5.5) после наличия половой пробки, для определения количества мест имплантации.

Искусственная децидуализация

Чтобы оценить способность стромы подвергаться дифференцировке и пролиферации независимо от прикрепления эмбриона, самкам мышей в возрасте 6 недель подвергали овариэктомии и обрабатывали экзогенными гормонами для имитации беременности перед применением ручного стимула к одному рогу матки ( протокол, описанный ранее Finn and Martin, 1972) 58 .После овариэктомии и 2-недельного отдыха для выведения эндогенных стероидов яичников мышам вводили ежедневные инъекции E2 (100 нг на мышь) в течение 3 дней. После 2 дней отдыха мышей обрабатывали E2 (6,7 нг на мышь) и P4 (1 мг на мышь) в течение 3 дней. На третий день (DD0) мышам вводили однократную инъекцию 0,05 мл кунжутного масла в правый рог матки. Мышам вводили E2 и P4 еще в течение 5 дней и умерщвляли на пятый день (DD5). Регистрировали влажный вес матки стимулированных и контрольных рогов.Весовые отношения рассчитывали путем деления веса стимулированного рога на вес нестимулированного рога.

Анализ суперовуляции

Суперовуляцию индуцировали у самок мышей с помощью i.p. инъекция пяти международных единиц (МЕ) гонадотропина сыворотки беременных кобыл (EMD Millipore, Billerica, MA), затем 5 МЕ хорионического гонадотропина человека (Pregnyl, Merck & Co., Inc., Whitehouse Station, NJ) через 48 часов и помещали с самцами мышей C57BL / 6J дикого типа. Через 24 часа мышей умерщвляли в результате смещения шейных позвонков под анестетиком авертином (2.2-трибромэтиловый спирт, Sigma-Aldrich, Сент-Луис, Миссури) и ооциты вымывали из яйцеводов и подсчитывали.

LIF rescue assay

Попытка исправить дефект имплантации у мышей Sox17 ed / ed была выполнена с использованием протокола, описанного Kelleher et al. 33 . Вкратце, самки мышей получали две внутрибрюшинные (i.p.) инъекции (одну через 1000 часов и одну через 1800 часов) носителя или 10 мкг рекомбинантного мышиного LIF на GD 3.5, а места имплантации эмбрионов оценивались на GD 5.5.

Иммуногистохимия и двойная иммунофлуоресценция

Ткани фиксировали в 4% параформальдегиде и заливали парафином. Заложенные ткани разрезали на 5 мкм и запекали в течение 1 часа при 60 ° C. После охлаждения предметные стекла депарафинизировали с использованием очищающего агента Citrisolv (номер по каталогу 22-143-975, Thermo Fisher, Уолтем, Массачусетс, США) в убывающем градиенте чистого этанола. Для окрашивания гематоксилином и эозином (H&E) ткани адекватно окрашивали H&E, а затем обезвоживали перед наложением покровных стекол.Для иммуногистохимии поиск антигена выполняли в соответствии с инструкциями производителя (Vector Labs Antigen Unmasking Solution H-3300). Эндогенный перекись блокировали с помощью 3% перекиси водорода, разбавленной в метаноле. Ткань блокировали 5–10% нормальной ослиной сывороткой перед нанесением первичных антител в течение ночи при 4 ° C. Вторичные антитела разбавляли 1% бычьим сывороточным альбумином в концентрации 1: 200 при необходимости. Реагент ABC наносили на ткани в соответствии с инструкциями производителя (Vestor Labs ABC PK-6100).Сигнал был разработан с использованием окрашивания Vector Labs DAB ImmPACT в соответствии с инструкциями производителя (Vector Labs SK-4105). Ткань подвергали контрастному окрашиванию гематоксилином и обезвоживали перед прикреплением покровных стекол. Для сравнения интенсивностей иммуногистохимического окрашивания использовали полуколичественную систему оценки (H-балл) 59 . H-балл был рассчитан с использованием следующего уравнения: H-балл = Pi (i), где i = интенсивность окрашивания со значением 1, 2 или 3 (слабое, умеренное или сильное, соответственно) и Pi — процент окрашенных клеток для каждой интенсивности, варьирующийся от 0 до 100%.Для двойной иммунофлуоресценции было выполнено извлечение антигена и эндогенный пероксид был заблокирован, как указано выше. После блокирования ткани 5–10% нормальной ослиной сывороткой в ​​течение 1 часа одновременно применяли два первичных антитела от разных видов в течение ночи при 4 ° C. Срезы, исследованные первичными антителами, инкубировали с двумя соответствующими вторичными антителами (Alex 488 и 568) в разведениях 1: 200 в течение 1 часа при комнатной температуре, а затем промывали фосфатно-солевым буфером и покрывали Prolong Gold Antifade с 4 ‘, 6- диамидино-2-фенилиндол.Перед микроскопическим анализом слайды хранили при 4 ° C в темноте. Информация для всех антител представлена ​​в дополнительной таблице 1 .

Выделение РНК

Замороженную ткань гомогенизировали в реагенте TRIzol (Thermo Fisher). Выделение РНК проводили с использованием хлороформа и осаждали изопропанолом с ресуспендированием в воде. Для РНК, приготовленной для микроматрицы, использовали реагент TRIzol с последующим выделением водной фазы с использованием 1-бром-3-хлорпропана и второй водной фазы с использованием хлороформа.На водный слой наносили чистый этанол, и весь раствор вводили в колонку мини-препаративного набора Qiagen RNEasy RNA. Колонку промывали и выделяли РНК, следуя инструкциям производителя (Qiagen, Valenica, CA).

ПЦР с обратной транскриптазой и QRT-PCR

Обратную транскрипцию РНК в кДНК проводили с использованием обратной транскриптазы MMLV (Thermo Fisher) в соответствии с инструкциями производителя. QRT-PCR выполняли с использованием зондов Taqman Master Mix (Life Technologies) и Taqman (Applied Biosystems).Значения дельта-дельта Ct рассчитывали с использованием результатов 18 S контрольной амплификации для получения относительных уровней мРНК на образец. Информация для всех праймеров представлена ​​в дополнительной таблице 2 .

Анализ на микрочипах

Качество РНК оценивали с помощью биоанализатора Agilent 2100 (Agilent Technologies). Анализ микроматрицы был выполнен Центром геномного анализа и профилирования РНК Медицинского колледжа Бейлора. После амплификации библиотеки и мечения отдельные образцы кДНК гибридизовали с массивом Agilent G3 Mouse GE 8 × 60 k в соответствии с инструкциями производителя (Agilent Technologies).Данные массива были проанализированы с использованием Bioconductor с квантильной нормализацией. Гены с нескорректированным значением p <0,01 и абсолютным кратным изменением ≥ 1,4 были идентифицированы как дифференциально регулируемые.

Иммунопреципитация хроматина и секвенирование

Вся ткань матки была мгновенно заморожена и отправлена ​​в компанию Active Motif для анализа иммунопреципитации хроматина по факторному пути и секвенирования (ChIP-seq). Ткань фиксировали, а затем быстро разрезали на небольшие фрагменты перед иммунопреципитацией антителом SOX17 (AF1924; R&D Systems).Связанная с SOX17 ДНК была очищена и амплифицирована для создания библиотеки и секвенирована с использованием анализатора генома 2 компании Illumina. Необработанные чтения ChIP-Seq (36 нуклеотидов, односторонние) были обработаны и сопоставлены с эталонным геномом мыши (mm9; Genome Reference Consortium Mouse Сборка 37 от июля 2007 г.) от Active Motif. Интервалы, связанные с SOX17, были идентифицированы с использованием основанного на модели анализа ChIP-Seq (MACS 1.3.7.1) и сопоставлены с соседними генами в пределах 25 КБ с помощью разработки Perl-скрипта.

Анализ данных

Дифференциально экспрессируемые гены, полученные из данных микрочипов, анализировали с использованием программного обеспечения Ingenuity Pathway Analysis (IPA, http: // www.ingenuity.com) и База данных для аннотаций, визуализации и интегрированного обнаружения (DAVID, http://david.ncifcrf.gov/). Сходные транскриптомы профиля экспрессии гена Sox17 ed / ed были идентифицированы путем поиска доступных наборов данных в базе данных NextBio (https://www.nextbio.com/). Данные ChIP-Seq анализировали с помощью программного обеспечения Cistrome (http://cistrome.org/ap/). Программное обеспечение GraphPad Prism было реализовано для однофакторного дисперсионного анализа, теста множественного сравнения и теста Стьюдента t для qRT-PCR и децидуальных влажных весов.Элементы гормонального ответа были идентифицированы с использованием анализа мотивов HOMER de novo (http://homer.salk.edu/homer/). Тепловые карты с иерархической кластеризацией были созданы с использованием программного обеспечения Partek Genomics Suite 6.6.

Июнь 2001 Columns Magazine — Новости ассоциации: Памяти

1920-е годы

  • Кэрролл Хэске , ’24, Аркадия, Калифорния, 96 лет, 28 января.
  • Карл Майрон Кливленд , 26 год, Сиэтл, 97 лет, 30 января.
  • Кэтрин Маргарет Бриттон , 27 г., Сиэтл, 95 лет, 3 апреля.
  • Чарльз В. Франклин , 27 год, Восточный Венатчи.
  • Лорна Логан , 27 год, Сан-Франциско, 94 года, 6 марта.
  • Ора Элеонора Стоуэлл , 27 год, остров Бейнбридж, 96 лет, 28 января.

    1930-е годы

  • Джордж М. Хокинг , 31 год, Оберн, 92 года, 13 февраля.
  • Джейн Биксби Маккой , 31 год, Кливленд, 90 лет, 18 февраля.
  • Дональд А. Дата , ’32, Тоусон, Мэриленд, 18 января.
  • Бернард Гойни , 32, 42, Берег, 90 лет, 25 февраля.
  • Элвин Ховард Палмер , 32 года, Палм-Бич Гарденс, Флорида, 93 года, 17 марта.
  • Мэри Кэтрин Симеон , ’33, ’35, Сиэтл, 91 год, 11 марта.
  • Чарльз П. Даффи , ’36, ’39, Портленд, штат Орегон, 86 лет, 17 февраля.
  • Хелен М. Лафлин , ’37, Сиэтл.
  • Дороти МакДевитт , ’38, ’40, Лейквуд, 85 лет, 8 декабря 2000 г.
  • Raymond Royal , ’38, ’42, Сиэтл, 84 года, 11 января.
  • Сидни Дункан Кэмпбелл , ’39, Бельвью, 84 года, 16 марта.
  • Мэри Элизабет Стрейн Копернолл , ’39, ’40, Бельвью, 83 года, 28 марта.
  • Мэри Ричардс Хиди , ’39, Сиэтл, 83 года, 18 февраля.

    1940-е

  • Уильям Д. Кастл , ’40, Гонолулу, 31 января.
  • Дуглас П. Пейн , 40 г., Сиэтл, 81 год, 5 марта.
  • Рассел Крейг , 41 год, Фоллс-Черч, Вирджиния, 82 года, 14 марта.
  • Джон Р. Уоллес младший , 41 год, Иссакуа, 85 лет, 14 марта.
  • Уоррен Л. Флок , 42 года, Боулдер, штат Колорадо, 80 лет, 4 марта.
  • Фредерик Джеймс Орт , ’44, Кенмор, 85 лет, 8 марта.
  • Джеральд Б. Талбот , ’44, ’48, Бельвю, 88 лет, 16 декабря 2000 г.
  • Дональд Уэйн Арнцен , 45 г., Сиэтл, 75 лет, 7 марта.
  • Джеймс С. Эдмундс , ’46, ’47, Палм-Спрингс, Калифорния, 75 лет, 5 января.
  • Джанет Брэндон Погги , ’46, ’73, Редмонд, 79 лет, 9 января.
  • Деннис Уоррен Бодди , ’47, ’55, Портленд, штат Орегон, 78 лет, 9 января.
  • Клара Мэй Хамель , 47 год, Сиэтл, 74 года, 15 марта.
  • Фрэнк Э. Сили , ’47, остров Бейнбридж, 79 лет, 14 декабря 2000 г.
  • Гарольд Джеймс Картер , ’48, Фриланд, 76 лет, 23 марта.
  • Джеймс Патрик Карран , ’48, Кент, 82 года, 30 января.
  • Гарри А. Данлоп , ’48, ’49, Цинциннати, 72 года, 9 марта 2000 г.
  • Darby W. Huntington , ’48, Retsil.
  • Мюриэл Монтегю Крибель , ’48, Сиэтл, 75 лет, 26 марта.
  • Джордж Эдгар Шервуд , ’48, Сиэтл, 85 лет, 14 февраля.
  • Ричард Кент Стэйсер , ’48, Пенроуз, Колорадо, 79 лет, 25 января.
  • Чарльз Э.Коннер , ’49, Сиэтл, 79 лет, 18 января.
  • Рут Эйлин Уэбб Фрейзер , ’49, ’51, Кент, 73 года, 8 марта.
  • Франклин Н. Лонсбери , ’49, Сиэтл, 80 лет, 24 февраля.
  • Уильям Гарри Тейлор , ’49, Мерсер-Айленд, 76 лет, 8 апреля.
  • Ларри Уэллс , ’49, Сиэтл, 71 год, 24 января.

    1950-е

  • Роберт Милтон Арвин , 50 г., Кенмор, 76 лет, 19 марта.
  • Джек Росс Браун , 50 г., остров Бейнбридж, 75 лет, 3 апреля.
  • Джин Э. Гатри , 50 г., Киркланд, 78 лет, 13 марта.
  • Венделл Б. Лайл , ’50, Туалатин, штат Орегон, 74 года, 5 апреля.
  • Роберт Эдмунд Скарперуд , 50 г., остров Мерсер, 74 года, 2 апреля.
  • Э. Байрон Смит , ’50, Шервуд, штат Орегон, 79 лет, 23 марта.
  • Джон Р. Дональдсон , ’51, ’54, ’67, Портленд, штат Орегон, 71 год, 31 октября 2000 г.
  • Фрэнк К. Маколи , 52 года, Мерсер-Айленд, 79 лет, янв.13.
  • Дороти Луиза Сориано , 52 года, Блейн, 70 лет, 4 января.
  • Мэйбл Ф. Элиасон , 53 г., Бремертон, 92 года, 1 февраля.
  • Мартин Дж. Омот , 53 г., Сиэтл, 80 лет, 15 января.
  • Роберт Н. Чанг , ’54, Сан-Франциско.
  • Роберт Чарльз Эли , 54 г., Снохомиш, 70 лет, 9 марта.
  • Джоан Л. Камм , ’54, Сиэтл, 28 февраля.
  • Paul L. Koepsell , ’54, Brookings, S.Д., 70 лет, 17 марта.
  • Дэвид Х. Торснесс , ’54, Анкоридж, Аляска.
  • Алида Тулуза , 57 г., Бельвю.
  • Джордж Г. Каннингем , ’59, Гилфорд, Коннектикут.
  • Дональд Роджер Хайнле , ’59, Редмонд, 63 года, 17 января.
  • Альберт Ф. Хиксенбо , 59 г., Оберн, 70 лет, 22 декабря 2000 г.
  • Bill E. Mahlik , ’59, Сиэтл, 9 января.
  • Вальтер Марселья , ’59, ’62, Такома.

    1960-е

  • Ллойд А. Олден , ’60, Арлингтон, Вирджиния, 65 лет, май 2000 г.
  • Пол Стэкхаус , ’60, Сиэтл, 69 лет, 22 декабря 2000 г.
  • Майкл А. Гейтс , 61 год, Уолдпорт, штат Орегон, 63 года, 24 февраля.
  • Мэри Эллен Фиппс , 61 год, Ботелл, 83 года, 13 марта.
  • Ричард Дуглас Каннингем , 62 года, Сиэтл, 62 года, 25 марта.
  • Вера А. Хортон , 62 года, Порт-Орчард.
  • Дороти Д. Клэджет , ’64, Кинг-Сити, штат Орегон, 88 лет, 30 ноября 2000 г.
  • Линди-Лу Холверстотт , ’65, ’68, Линнвуд, 72 года, 3 февраля.
  • Арлин Брауэр Брой , 66 год, Сиэтл, 78 лет, 2 марта.
  • Фрэнк Бруйе , 68 г., Пуйаллап, 72 года, 20 января.
  • Джордж Бертон , 1969 год, остров Мерсер, 76 лет, 28 января.
  • Эмили Янг Чинн , 1969, Бельвью, 53 года, 14 марта.

    1970-е

  • Лоуренс Ли Одл , ’70, ’71, ’73, возраст 85, 3 апреля.
  • Хайро Чавес , 71 год, Колумбия, 54 года, 8 января.
  • Дениз М. Эрл , 71 год, Айдахо-Фолс, Айдахо, 52 года, 13 февраля.
  • Энн Гросвенор Робинсон , 71 год, Сиэтл, 81 год, 11 марта.
  • Филипп К. Тарро , 71 год, Маунт-Вернон.
  • Грегори Кейт Харрисон , ’72, ’74, Мэйпл-Вэлли, 51 год, 1 марта.
  • Хесус Салинас , 72 г., Сиэтл, 63 года, 21 марта.
  • Джордж Блай Уилкокс , ’72, ’75, Мэрисвилл, 51 год, 27 февраля.
  • Дональд Артур Сондерс , 76 г., Сиэтл, 66 лет, 29 декабря 2000 г.
  • Джанет Уилсон де Кардона , ’77, ’82, Тусон, Аризона, 46 лет, 27 января.
  • Маргарет Д. Лазетти , ’77, Бельвью.
  • Джеймс Эдвард Сталекер , ’77, Даллас.
  • Деннис М.Хибберт , 79 г.

    1980-е годы

  • Майло Дж. Клэнси , ’80, Сиэтл.
  • Трэйс Линн Джонсон , 81 год, Сиэтл, 46 лет, 25 января.
  • Роберт Пол Уэллс , 81 год, Сиэтл, 41 год, 10 марта.

    1990-е годы

  • Кэтрин А. Глапион , ’98, Сиэтл, 37 лет, 1 марта.

    2000-е

  • Брайан Тейлор Филлипс , ’00, Сиэтл, 25 лет, 28 марта.
  • Экспонент / Поиск экспонатов | О выставке «

    » Поиск экспонентов / экспонатов | О выставке | INTERMOLD / Die & Mold Asia / Японская выставка технологий штамповки металлов

    • ВРЕМЯ РАБОТЫ 5 октября (пн) — 16 (пт) 2021 года

    • МЕСТО ПРОВЕДЕНИЯ ТОКИО
    • ВРЕМЯ РАБОТЫ 14 апреля (ср) — 17 (сб) 2021 года

    ТОКИО

    14 апреля (ср) — 17 апреля (сб) 2021

    О ВЫСТАВКЕ

    SHENZHEN SANPIN MOLD CO., ООО

    Наименование экспонента

    SHENZHEN SANPIN MOLD CO., LTD

    SHENZHEN SANPIN MOLD CO., LTD

    будка NO. Панель
    Сайт www.sanpin-mould.com
    Электронная почта
    Телефон 86 755 23060885
    Сообщение PR SHENZHEN SANPIN MOLD CO., LTD — профессиональное предприятие по литью пластиковых форм, основанное в 2007 году, площадью 6000 кв.м и расположенное в Шэньчжэне. Sanpin специализируется на производстве высококачественных пресс-форм для автомобилей, пресс-форм для литья пластмасс под давлением и продукции для международного рынка.
    Основной предмет Пресс-формы для литья пластмасс под давлением и изделия из них (особенно для автомобильных запчастей)
    Название позиции [1] Пресс-формы для литья пластмасс под давлением и изделия из них (особенно для автомобильных запчастей)
    Категория экспонатов

    А.ФОРМЫ, МАТЕРИАЛЫ ДЛЯ ФОРМЫ

    Формы

    Компоненты пресс-формы

    © Ассоциация развития INTERMOLD ВСЕ ПРАВА ЗАЩИЩЕНЫ

    WUKONG Товарный знак компании Guangdong Sanpin Youchu Houseware Co., Ltd. — серийный номер 88855440

    Декабрь 2020 г. АДВОКАТ / ДОМ.ОТМЕНА И / ИЛИ НАЗНАЧЕНИЕ
    Дата события Описание события
    Среда, 8 сентября 2021 г. УВЕДОМЛЕНИЕ О ПРИНЯТИИ ЗАЯВЛЕНИЯ ОБ ИСПОЛЬЗОВАНИИ 930 E -72
    Вторник, 7 сентября 2021 г. РАЗРЕШЕННЫЙ ГЛАВНЫЙ РЕЕСТР — ПРИНЯТИЕ СУБЪЕКТА
    Понедельник, 2 августа 2021 г. ОФИС
    Понедельник, 2 августа 2021 г. НАЗНАЧЕН НА ЛОЖЬ
    Понедельник, 2 августа 2021 г. НАЗНАЧЕН НА ЛОЖЬ
    Четверг, 29 июля 2021 г.
    суббота, 6 февраля 2021 г. УВЕДОМЛЕНИЕ О НЕЗАКЛЮЧИТЕЛЬНЫХ ДЕЙСТВИЯХ НА ЭЛЕКТРОННУЮ ПОЧТУ
    суббота, Fe 6 февраля 2021 г. НЕЗАКЛЮЧИТЕЛЬНОЕ ДЕЙСТВИЕ ПО ЭЛЕКТРОННОЙ ПОЧТЕ
    Суббота, 6 февраля 2021 г. SU — НЕЗАКЛЮЧИТЕЛЬНОЕ ДЕЙСТВИЕ — НАПИСАНО
    Четверг, 21 января 2021 г. ЗАВЕРШЕНИЕ ОБРАБОТКИ ИСПОЛЬЗОВАНИЯ
    Вторник, 29 декабря 2020 г. ПОПРАВКА ИСПОЛЬЗУЕТСЯ
    Вторник, 19 января 2021 г. ДЕЙСТВИЕ, ПРЕДНАЗНАЧЕННОЕ ДЛЯ ИСПОЛЬЗОВАНИЯ ПАРАЛЕГАЛЬНЫХ УСЛОВИЙ
    ЗАЯВЛЕНИЕ ПО ИСПОЛЬЗОВАНИЮ 29 декабря 2020 г. TE ПОЛУЧЕНО
    Четверг, 17 декабря 2020 г. ЧАИ ИЗМЕНЕНИЕ ПЕРЕПИСКИ ПОЛУЧЕНО
    Четверг, 17 декабря 2020 г. ЧАИ ОТЗЫВ АДВОКАТА ПОЛУЧЕНО-ФИРМА
    Четверг, 17 декабря 2020 г. ОТЗЫВ TEAS / ПРИЛОЖЕНИЕ / ИЗМЕНЕНИЕ АДРЕСА ATTY / DOM REP ПОЛУЧЕН
    Суббота, 7 ноября 2020 г.
    Суббота, 7 ноября 2020 г. АДВОКАТ / DOM.REP.REVOKED И / ИЛИ НАЗНАЧЕН
    Суббота, 7 ноября 2020 г. TEAS REVOKE / APP / ИЗМЕНЕНИЕ АДРЕСА ATTY / DOM REPEIVED
    Вторник, 22 сентября 2020 г. NOA E-MAILED — SOU ТРЕБУЕТСЯ ОТ ЗАЯВИТЕЛЯ
    Вторник, 28 июля 2020 г. ПОДТВЕРЖДЕНИЕ ПУБЛИКАЦИИ ОФИЦИАЛЬНОЙ ГАЗЕТЫ ПО ЭЛЕКТРОННОЙ ПОЧТЕ
    ПОДТВЕРЖДЕНИЕ ПО ЭЛЕКТРОННОЙ ПОЧТЕ
    ПОДТВЕРЖДЕНИЕ
    930 июля, 28 июля 2020 г. ДЛЯ ОППОЗИЦИИ
    Среда, 8 июля 2020 г. УВЕДОМЛЕНИЕ ОБ УВЕДОМЛЕНИИ ОБ ПУБЛИКАЦИИ НА ЭЛЕКТРОННУЮ ПОЧТУ
    Среда, 24 июня 2020 г. УТВЕРЖДЕНО ДЛЯ PUB — ПРИНЦИП AL РЕГИСТР
    Понедельник, 22 июня 2020 г. НАЗНАЧЕН ЭКСПЕРТУ
    Среда, 8 апреля 2020 г. НОВАЯ ОФИСА ПРИЛОЖЕНИЙ ПРЕДОСТАВЛЯЕТ ДАННЫЕ В ТРАММЕ
    Суббота, 4 апреля 2020 г.

    Добавить комментарий

    Ваш адрес email не будет опубликован.