Управление роспотребнадзора по санкт петербургу официальный сайт: Управление Федеральной службы по надзору в сфере защиты прав потребителей и благополучия человека по городу Санкт-Петербургу




Основание внесения оператора в реестр (номер приказа): 127

Адрес местонахождения оператора: 199004, г. Санкт-Петербург, пр-кт Большой ВО, д. 13

Дата начала обработки персональных данных: 01.03.2005

Субъекты РФ, на территории которых происходит обработка персональных данных: Санкт-Петербург

Цель обработки персональных данных: извлечение (получение) информации, необходимой Работодателю в связи со служебными отношениями и касающаяся конкретного гражданского служащего (получение, хранение, комбинирование, передача или любое другое использование персональных данных гражданских служащих (работников) в соответствии с действующим законодательством Российской Федерации, регламентирующим область персональных данных)

Описание мер, предусмотренных ст. 18.1 и 19 Закона: внутренняя защита: защита данных на бумажных носителях в несгораемых сейфах, защита информации на электронных ностиелях с помощью кодов, паролей и ограничения доступа, внешняя защита: дневная охрана, ночная охрана, переговорные устройства, КТС-кнопка тревожной сигнализации, ведомственная охрана ОВО СВАО, пожарная сигнализация, пропускная система для сотрудников

Категории персональных данных: фамилия, имя, отчество,год рождения,месяц рождения,дата рождения,место рождения,адрес,семейное положение,образование,доходы,

Категории субъектов, персональные данные которых обрабатываются: государственные гражданские служащие и младший обслуживающий персонал, состоящие в служебных отношениях с Оператором, граждане (субъекты), состоящие в гражданско-правовых отношениях с оператором, а также граждане, обращающиеся в Управление Роспотребнадзора по городу Санкт-Петербургу с жалобами и заявлениями

Перечень действий с персональными данными: сбор, запись, систематизацию, накопление, хранение, уточнение (обновление, изменение), извлечение, использование, передачу (предоставление, доступ), удаление, уничтожение, персональных данных

Обработка персональных данных: смешанная,с передачей по внутренней сети юридического лица

Правовое основание обработки персональных данных: Конституция РФ, Трудовой кодекс РФ, ФЗ от 27. 07.04 № 79-ФЗ «О государственной гражданской службе РФ», ФЗ от 27.07.06 № 152-Фз «О персональных данных», Указ Президента РФ от 30.05.05 № 609 «Об утверждении положения о персонадьных данных государственного гражданского служащего РФ и ведении его личного дела», Положение от 10.10.06 «О порядке обработки персональных данных гражданских служащих и ведении личного дела гражданских служащих Управления Федеральной службы по надзору в сфере защиты прав потребителей и благополучия человека по городу Санкт-Петербургу», подписки лиц, уполномоченных на получение, хранение, комбинирование, передачу или другое использование персональных данных в соответствии с действующим законодательством РФ, регламентирующим область персональных данных а также защиту персональных данных от несанкционированного доступа.

Наличие трансграничной передачи: нет

Сведения о местонахождении базы данных: Россия

Управление Роспотребнадзора по Городу Санкт-Петербургу

Управление Роспотребнадзора по Городу Санкт-Петербургу ИНН 7801378679 ОГРН 1057810212503 зарегистрировано 12. 04.2005 по юридическому адресу 191025, город Санкт-Петербург, Стремянная улица, дом 19 литер а. Статус организации: действующая. Руководителем является руководитель Башкетова Наталия Семеновна (ИНН 780506822069). Подробнее >

Основной вид деятельности — Деятельность полномочных представителей Президента Российской Федерации в регионах Российской Федерации и территориальных органов федеральных органов исполнительной власти в субъектах Российской Федерации (республиках, краях, областях). В исторических сведениях доступно 8099 записей об изменениях, последнее изменение датировано 12 февраля 2021 г..

Организация состоит на учете в налоговом органе МЕЖРАЙОННАЯ ИНСПЕКЦИЯ ФЕДЕРАЛЬНОЙ НАЛОГОВОЙ СЛУЖБЫ №9 ПО САНКТ-ПЕТЕРБУРГУ с 24 апреля 2019 г.

, присвоен КПП 784001001. Регистрационный номер в ПФР — 088027189738, ФСС — 782702033978041.

Информации об участии Управление Роспотребнадзора по Городу Санкт-Петербургу в тендерах не найдено. Есть данные об участии организации в 262 рассматриваемых и 2487 завершенных арбитражных делах. < Свернуть

Контакты контролирующий организаций

17 декабря 2020

Председатель Комитета: Лисовец Дмитрий Геннадьевич

Тел.: 571-34-06

Адрес: 191023, Санкт-Петербург, ул. Малая Садовая, д. 1
[email protected]

Официальный сайт: http://zdrav.spb.ru

Адрес: 191023, Санкт-Петербург, ул. Малая Садовая, д. 1
[email protected]

Режим работы:
пн–чт с 9.00 до 18.00, перерыв 13.00–14.00
пт с 9.00 до 17.00, перерыв 13.00–14.00


Единая информационно-справочная служба: +7 (812) 63-555-64

Приемная: +7 (812) 571-34-06

Медицинская справочная служба (бесплатно, круглосуточно): +7 (812) 63-555-63

Дежурный врач-инспектор: +7 (812) 571-09-06

  • понедельник-четверг: с 10.00 до 16.30
  • пятница: с 10.00 до 16.00
  • с 13.00 до 14.00 — перерыв

Факс: +7 (812) 314-18-14

Часы приёма граждан по вопросам дополнительного лекарственного обеспечения: среда с 10.00 до 13.00, кабинет №10.


Территориальный орган Росздравнадзора по г. Санкт-Петербургу и Ленинградской области

Начальник отдела контроля оказания медицинской помощи и мониторинга государственных программ – Шипачёва Надежда Владимировна

Адрес: 190068, Санкт-Петербург, наб. кан. Грибоедова 88-90, каб. 306 (3 этаж)

пн — чт: 9:00 — 17:45
пт: 9:00 — 16:30
сб — вс: выходные дни

Телефон: (812) 314-67-89

E-mail: [email protected]

Официальный сайт: http://78reg.roszdravnadzor.ru/

Территориальный отдел Управления Роспотребнадзора по городу Санкт-Петербургу в Адмиралтейском, Василеостровском, Центральном районах

Начальник отдела — главный государственный санитарный врач по Адмиралтейскому, Василеостровскому, Центральному районам — Бубнова Екатерина Сергеевна

Адрес: 190005, Санкт-Петербург, ул. 3-я Красноармейская, д.18

Телефон/факс: 8 (812) 316-6866

E-mail: [email protected]

Официальный сайт: http://78.rospotrebnadzor.ru/

Прокуратура Адмиралтейского района Санкт-Петербурга

Адрес: 190068, Санкт-Петербург, ул. Большая Подъяческая, дом 19

Прокурор района старший советник юстиции – Дмитренко Виктория Викторовна

Прием граждан каждый четверг с 14.

00 – 18.00, предварительная запись не требуется

Заместитель прокурора района советник юстиции — Трушанова Наталья Валерьевна ( по вопросам соблюдения федерального законодательства)

Прием граждан каждую среду с 11.00 – 13.00, предварительная запись не требуется

Тел.: 8 (812) 310-18-73

Факс: 8 (812) 310-85-22

Адреса органов власти

Министерство здравоохранения Росcийской Федерации


127994, ГСП-4, г. Москва, Рахмановский пер, д. 3

тел: (495) 628-44-53, (495) 627-29-44, (495) 627-24-00


Комитет по здравоохранению Правительства  Санкт-Петербурга


ул. Малая Садовая, д.1

тел: 635-55-77

















Комитет по здравоохранению Правительства Ленинградской области


Невский пр. , д. 113

тел: 717-93-48


Федеральный фонд обязательного медицинского страхования


127994, ГСП-4, Москва, ул. Новослободская, 37, корп. 4А

(499) 973-31-86, (495) 987-03-80, доб. 1521, 1522, 1514, 1517


Управление Росздравнадзора по Санкт-Петербургу и Ленинградской области


наб.кан. Грибоедова, д. 88-90

тел: 314-67-89


Управление Федеральной службы по надзору в сфере защиты прав потребителей и благополучия человека по Санкт-Петербургу (Управление Роспотребнадзора по Санкт-Петербургу)


ул. Стремянная, д.19

тел: 712-29-81,


E-mail: [email protected]


Управление Роспотребнадзора по Ленинградской области


Санкт-Петербург, ул. Ольминского, д.27

тел: 448-04-00, 365-18-00


Федеральная служба по надзору в сфере образования и науки


г. Москва, ул.Садовая-Сухаревская, д.16, К-51, ГСП-4,

г.Москва, ул.Шаболовка, д.33

тел./факс: +7 (495) 984-89-19


Территориальный фонд обязательного медицинского страхования Санкт-Петербурга (отдел по работе с гражданами)


почтовый адрес: 196084, Санкт-Петербург, ул. Коли Томчака, дом 9, лит. А

тел: 707-73-01(понедельник-четверг с 9.00 до 17.45; пятница с 9.00 до 16.30)


Территориальный фонд обязательного медицинского страхования Ленинградской области


г. Санкт-Петербург, Крестовский пр., д. 18

тел: 230-56-20 (в будни с 9:00 до 17:40)

Контролирующие организации | Городская поликлиника №72

Контакты контролирующих организаций

Администрация Колпинского района:
Адрес: 196653, Санкт-Петербург, г.Колпино, бульвар Победы, д.1
Телефон: (812) 576-96-13
e-mail: [email protected] spb.ru

Отдел здравоохранения администрации Колпинскоро района:
Адрес: 196653, Санкт-Петербург, г.Колпино, бульвар Победы, д.1
(Санкт-Петербург, г.Колпино, Ижорский завод, дом без номера, литера АВ)
Телефон: (812) 573-92-67
e-mail: [email protected]
Начальник отдела здравоохранения Светлана Валентиновна Нилова (прием граждан: вторник с 09.30 до 11.00).

Комитет по здравоохранению Санкт-Петербурга: 
Адрес: 191023, Санкт-Петербург, Центральный район, Малая Садовая ул., д. 1. 
Телефон: (812) 63-555-63 Телефон: (812) 573-92-67
понедельник-четверг: с 10.00 до 16.30
пятница: с 10.00 до 16.00
с 13.00 до 14.00 — перерыв
Часы приёма граждан по вопросам дополнительного лекарственного обеспечения: среда с 10.00 до 13.00, кабинет №10.

Управление Федеральной службы по надзору в сфере защиты прав потребителей и благополучии человека по Санкт-Петербургу (Управление роспотребнадзора по Санкт-Петербургу)
Адрес: 191025, Санкт-Петербург, ул. Стремянная, д. 19
Горячая линия: (812) 712-29-81
Часы работы: Пн-Чт: 10.00-17.00; Пт: 10.00-16.00; Обед: 12.00-12.45;
575-8107 (отдел надзора за питанием населения),
328-0522 (за радиац. безопасностью),
710-8937 (за условиями труда),
764-3800 (за условиями проживания),
575-8104 (эпиднадзора),
575-8110 (защиты прав потребителей),
764-7203 (за условиями воспитания и обучения)

Территориальный орган Федеральной службы по надзору в сфере здравоохранения по Санкт-Петербургу и Ленинградской области
Адрес: 190068, г. СПб, наб. кан. Грибоедова, 88-90
Приемная: тел/факс: (812) 314-67-89
Отдел лицензирования и лицензионного контроля: (812) 571-39-73;
Отдел контроля и надзора: (812) 310-61-75;

Территориальный фонд обязательного медицинского страхования Санкт-Петербурга: 
196084, Санкт-Петербург, Коли Томчака ул. , 9, литера А. 
Телефон: (812) 703-7301 — Справочная, (812) 703-7310, Факс: (812) 703-7394 
Часы работы: Пн–Пт с 9.00 до 17.45, перерыв с 13.00 до 13.30 
Сайт: http://www.spboms.ru

Прокуратура Колпинского района: 
196655, Санкт-Петербург, Колпино, Культуры ул., д. 8. 
Телефон: (812) 461-0049 
Время работы: Чт с 14.00 до 18.00, Пн-Ср, Пт-Вс: выходной 
Прокурор района: Чирков Роман Алексеевич 
Сайт: http://www.prokuratura.spb.ru

Противодействие коррупции: 
Специальная линия «Нет коррупции!»
Сайт: http://www.zakon.gov.spb.ru/hot_line

О фактах коррупционного поведения и коррупционных проявлениях в деятельности работников СПБ ГБУЗ «Городская поликлиника №72»
Вы можете сообщить:

Надзорные органы и организации

При выявлении фактов незаконной деятельности персонала нашей организации
Вы всегда можете обратиться к руководству, а также в надзорные органы и организации:



Санкт-Петербург, пер. Бойцова, д. 4, каб.1

начальник центра (государственного санитарного надзора) —
главный государственный санитарный врач

подполковник внутренней службы 

Закурдаев Владислав Викторович

тел/факс.: (812) 310-89-01, 573-31-62, e-mail: cgsenmsch[email protected]mail.ru


Санкт-Петербург, Невский проспект, д.176, 323 — 324 кабинет; 3 этаж
Начальник Отдела здравоохранения
Беженар Сергей Иванович
Часы приема граждан: пн и чт с 14-00 до 16-00
Запись на прием к начальнику отдела ведет секретарь по телефону: 717-24-16 и при личном посещении.


Ул. Малая Садовая, д. 1. Горячая линия – тел.(812)635-55-77
Председатель Комитета по здравоохранению
Колобутин Валерий Михайлович


Московский пр. , д. 120.
Телефон обращений граждан: (812) 703-73-01

Директор: Кужель Александр Михайлович

Факс: (812) 703-73-94
E-mail: [email protected]
Сайт: www.spboms.ru

в Центральном районе. 3-я Красноармейская улица, дом 18
Телефон Горячей линии: (812) 712-29-81
Часы работы
Понедельник-четверг: с 10:00 до 17:00
Пятница: с 10:00 до 16:00
Обед: с 12:00 до 12:45
телефон отдела: (812) 316-68-66


Наб. канала Грибоедова, 88/90.
Телефон: (812) 314-67-89


по городу Санкт-Петербургу Адрес: 191025, г. Санкт-Петербург, ул. Стремянная, д. 19
Тел.: 8 (812) 764-42-38
Факс: 8 (812) 764-55-83
Эл. почта: [email protected]

САНКТ — ПЕТЕРБУРГА Телефон: 635-55-77

— на специальную линию «Нет коррупции!», состоящую из электронного почтового ящика: http://www.zakon.gov.spb.ru/hot_line

и выделенной телефонной линии: 576-77-65. Телефонная линия функционирует в режиме автоответчика с 9-00 до 18-00 по рабочим дням.

— в Комитет по вопросам законности, правопорядка и безопасности по адресу: 191060 СПб, Смольный, тел.: (812) 576-79-70 факс: (812) 576-43-74, электронная почта: [email protected]

График работы Комитета:

— с понедельника по четверг — с 9.00 до 18.00; с 13.00 до 14.00 — перерыв;
— в пятницу — с 9.00 до 17.00; с 13.00 до 14.00 — перерыв на обед;
— суббота и воскресенье — выходные дни.
В предпраздничные дни время работы Комитета сокращается на 1 час.

Пресс-секретарь Комитета по вопросам законности, правопорядка и безопасности:

Телефон: (812) 576-71-70
Электронная почта: [email protected] gov.spb.ru

Культурно-досуговый центр Калининского района | Страница

Региональная Служба Спасения

Телефоны Дежурной части (круглосуточно): 380-91-19 (многоканальный), 545-47-45, 545-35-18

МЧС — 112 — единый номер службы спасения для звонков с сотовых телефонов в экстренных ситуациях (можно звонить даже без сим-карты, без денег на счете и с заблокированной клавиатурой телефона)

Телефон спасения — 01

Аварийные ситуации в быту

При запахе газа звонить


Повреждения освещения на уличных эл. сетях


Повреждения водопроводной уличной сети (холодная вода)


Повреждения водопроводной уличной сети (горячая вода)


Кабельная сеть


«Горячая линия» ГУП «ТЭК СПб»


Центр по приему обращений граждан по всем вопросам, связанным с качеством оказываемых услуг ЖКХ




Отдел ФСБ в Калининском районе УФСБ России
по г. Санкт-Петербургу и Ленинградской области





УМВД России по Калининскому району

Телефоны Дежурной части: 





Единые телефоны экстренной помощи:


102, 112


Отдел вневедомственной охраны Калининского района
филиала «УВО ВНГ РФ по Санкт-Петербургу и Ленинградской области»



Дежурная часть



Дежурный ПЦО




Телефоны «горячей линии жалоб»

Центр по приему обращений граждан по всем вопросам, связанным с качеством оказываемых услуг ЖКХ — 004

«Горячая» линия ГУП «Водоканал СПб»


«Горячая» линия ГРО «ПетербургГаз»


претензионная служба ГУП «Организатор перевозок» (работа общественного транспорта)

Телефоны дежурных помощников глав администраций районов

Адмиралтейский район


Василеостровский район


Выборгский район


Калининский район


Кировский район


Колпинский район


Красногвардейский район


Красносельский район


Кронштадтский район


Курортный район


Московский район


Невский район


Петроградский район


Петродворцовый район


Приморский район


Пушкинский район


Центральный район


Фрунзенский район



Главное управление министерства внутренних дел по Санкт-Петербургу и Ленинградской области

Официальный интернет-ресурс ГУ МВД по Санкт-Петербургу и ЛО — http://78. mvd.ru/

Телефон справочной ГУ МВД


Дежурная часть ГУ МВД


«Телефон доверия» ГУ МВД


Дежурная часть Управления уголовного розыска


Управление по контролю за оборотом наркотиков

275-03-51 — Дежурная часть

Управление ГИБДД ГУ МВД России по г. Санкт-Петербургу и Ленинградской области

http://www. 78.gibdd.ru — сайт Управления ГИБДД ГУ МВД РФ по Санкт-Петербургу и Ленинградской области

Дежурная часть 


Телефон доверия УГИБДД  335-43-80


Отдел по делам гражданской обороны, чрезвычайным ситуациям
и пожарной безопасности Комитета по вопросам законности, правопорядка и безопасности

Адрес: улица Разъезжая д. 26/28
Телефон оперативного дежурного сектора мониторинга и прогнозирования 575-75-57


Санкт-Петербургский городской суд: 273-10-81
Областной суд 273-08-26
Уставный суд Санкт-Петербурга
Мировые судьи Санкт-Петербурга

Федеральная служба судебных приставов, телефон доверия: 571-79-87


Городская прокуратура 312-81-90
Областная прокуратура 542-02-45


Президиум Санкт-Петербургской Коллегии адвокатов; Адвокатская палата Санкт-Петербурга: 713-14-03
Президиум Ленинградской областной Коллегии 273-00-86
Международная Коллегия Адвокатов «Санкт-Петербург» 275-10-71


Городская станция скорой помощи — 03

http://www. 03spb.ru — Скорая помощь Санкт-Петербурга

Территориальный фонд ОМС Санкт-Петербурга: 703-7-301,


«Горячая линия»


Справочное о наличии лекарств в городе


Дежурная аптека


Наркологический телефон доверия


Телефон доверия для взрослых, детей и подростков



Городская справочная служба «Здоровье города» (многоканальный) 635-55-63
(Информация об адресах, телефонах лечебно-профилактических медицинских учреждений города Санкт-Петербурга и о медицинских услугах, предоставляемых этими учреждениями)

Горячая линия Комитета по здравоохранению СПб 635-55-77

Телефон претензий по работе городской скорой помощи 571-45-04

Санкт-Петербургское региональное отделение Фонда социального страхования Российской Федерации

197046 Санкт-Петербург Б. Посадская ул., д.10А

Телефон для справок: 677-87-17

Официальный сайт — http://rofss.spb.ru/

Инспекция труда в городе Санкт-Петербурге

Официальный сайт — http://git78.rostrud.ru

198095, Санкт-Петербург, ул Зои Космодемьянской, д. 28, лит. А
Контактный телефон: (812) 746-59-86
Факс: (812) 747-37-84
e-mail: [email protected]

Телефоны горячей линии: (812) 746-59-86, (812) 314-19-48, (812) 374-31-97.

Информационно-справочная телефонная служба социальной защиты населения

т. 334-41-44

Информационно-справочная телефонная служба работает ежедневно, кроме выходных и праздничных дней, с 8 часов 30 минут до 17 часов 20 минут. В пятницу с 8 часов 30 минут до 16 часов 00 минут.

Сайт Городского Центра по начислению и выплате пенсий и пособий http://iss. ktsz.spb.ru

Отделение Пенсионного фонда Роcсийской Федерации по Санкт-Петербургу и Ленинградской области

Официальный сайт — www.pfrf.ru

194214, г. Санкт-Петербург, пр. Энгельса, 73
Приемная Управляющего: тел. (812) 553-20-78, тел./факс (812) 554-08-22
Телефоны горячей линии:
для населения — (812) 292-85-92, 292-85-56;
для страхователей — (812) 292-81-62;

Управление Федеральной службы по надзору в сфере защиты прав потребителей и благополучия человека по городу Санкт-Петербургу (Управление Роспотребнадзора по городу Санкт-Петербургу)

Информационно-справочная линия: тел. (812) 712-29-81

Сайт: http://78.rospotrebnadzor.ru/

E-mail: [email protected]


Центральный территориальный отдел Управления Роспотребнадзора по городу Санкт-Петербургу (Адмиралтейский, Василеостровский, Центральный районы)

190005, Санкт-Петербург,

ул. 3-я Красноармейская, д.18

тел. (812) 316-68-66

Восточный территориальный отдел Управления Роспотребнадзора по городу Санкт-Петербургу  (Выборгский, Калининский, Красногвардейский, Невский районы)

194214, Санкт-Петербург,

Удельный пр., д. 20

тел. (812) 293-76-66

Южный территориальный отдел Управления Роспотребнадзора  по городу Санкт-Петербургу (Московский, Фрунзенский, Пушкинский, Колпинский районы)

196143, Санкт-Петербург,

пр. Юрия Гагарина, д. 55

тел. (812) 727-72-20

Северный территориальный отдел Управления Роспотребнадзора  по городу Санкт-Петербургу (Приморский, Петроградский, Курортный, Кронштадтский районы)

197198, Санкт-Петербург,

Большая Пушкарская, д. 18

тел. (812) 232-15-92

Западный территориальный отдел Управления Роспотребнадзора  по городу Санкт-Петербургу (Кировский, Красносельский, Петродворцовый районы)

198095, Санкт-Петербург,

ул. Оборонная, д. 37

тел. (812) 786-12 30


Права потребителя
Санкт-Петербургское государственное учреждение «Центр контроля качества товаров (продукции), работ и услуг»

Официальный сайт — http://www.quality.spb.ru/
Адрес Центра: 191124, Санкт-Петербург, Суворовский пр., д. 65 Б
Телефон: (812) 274-14-30
Факс: (812) 274-14-32
e-mail: [email protected]

Работа по обращениям потребителей:

Телефоны «горячей линии»:
8 (812) 233-55-45
8 (812) 232-83-03 

Проведение экспертиз качества продовольственных, парфюмерно-косметических товаров, обуви, технически сложных товаров бытового назначения:
(812) 274-14-30

Центр независимой экспертизы Союза потребителей Санкт-Петербурга

тел. : 327-80-32
факс: 272-33-48
191014, Саперный пер., 21

Адреса и телефоны информационно-консультационных пунктов для оказания услуг по проведению юридических консультаций для потребителей:

Бесплатная «горячая линия»: 716-96-31, 274-18-40, 993-73-99, 994-34-99, в выходные и праздничные 994-84-99
Таврическая ул., д. 2, пом. 17н, тел. 600-79-78; 655-50-10
Невский пр., д. 78, тел. 400-22-23;
Черноморский пр., д. 4 пом. 102, тел. 315-74-97;
пер. Лодыгина, д. 1/28, пом. 74, тел. 324-25-88, 324-25-80, 324-27-98, 324-27-96.

Пункты по проведению экспертиз качества обуви, одежды, непродовольственных товаров, работ (услуг)

Саперный пер., д. 21;
Суворовский пр., д. 65Б.

Правовая информации в Российской национальной библиотеке

Центр правовой информации

Пл. Островского, д. 1/3, пом. № 84
т. 718-86-91

Центр экономико-правовой информации

Московский пр., д. 165, корп. 2, пом. № 3018
т. 415-97-81

e-mail: [email protected]

Центр правовой информации РНБ предлагает для ознакомления (бесплатно)  полные тексты законов РФ, СПб, ЛО,  законопроекты, формы документов, ГОСТы, СНиПы и стандарты России, материалы судебной практики, комментарии к правовым актам и др.
Тексты документов можно распечатать, перенести на электронные носители.

В ЦПИ представлены базы данных (БД) справочно-правовых систем: «КонсультантПлюс», «Гарант», «Кодекс», официальная БД Спецсвязи ФСО России «Законодательство России» и специализированные БД  по правовой и экономической информации.
Обновление правовой информации ежедневное.


Требования к компаниям в Санкт-Петербурге для работы в условиях COVID-19

Все компании, работающие в Санкт-Петербурге до 1 ноября, должны:

  • Утвердить внутренние правила, обеспечивающие стандарты безопасности;
  • Уведомить Правительство Санкт-Петербурга;
  • Получить QR-код и показать его там, где его можно увидеть, а также на их веб-сайте;
  • Убедитесь, что у каждого подразделения, филиала, представительства и головного офиса есть свой QR-код.

Правила внутреннего распорядка, обеспечивающие стандарты безопасности

Стандарты безопасности требуются государственными органами для обеспечения минимальных условий, необходимых организациям и индивидуальным предпринимателям для работы в условиях COVID-19.Работодатели должны установить стандарты безопасности, соответствующие их сфере деятельности, составив внутренние правила, ознакомив всех сотрудников с этими правилами, которые должны быть подписаны сотрудниками, и обеспечить выполнение требований, изложенных в этих внутренних правилах.


Уведомления о возобновлении работы необходимо подавать через сайт Санкт-Петербургского центра развития и поддержки предпринимательства. Головные офисы должны предоставить информацию о своих представительствах, филиалах и обособленных подразделениях (при наличии).Для подачи сообщений об обособленных подразделениях (филиалах, представительствах) организациям необходимо отправить заполненную форму (форму для скачивания) на адрес [email protected] ru.

Организации и индивидуальные предприниматели Санкт-Петербурга должны были до 26 октября направить в Комитет по промышленной политике, инновациям и торговле Санкт-Петербурга список телефонов сотрудников старше 65 лет, не переведенных на удаленную работу (без личных данных). ) вместе с обоснованием причин отказа от перевода на удаленную работу.Организации и индивидуальные предприниматели должны были предоставить эту информацию через свой аккаунт на сайте Санкт-Петербургского центра развития и поддержки предпринимательства. О любых изменениях, касающихся перевода сотрудников старше 65 лет на удаленную работу, необходимо сообщать в течение трех календарных дней, отправив новый список телефонных номеров.


Что это? QR-код — это штрих-код с квадратной матрицей, который могут считывать мобильные устройства. Ссылка на официальный ресурс СПб.Петербургский комитет по промышленной политике, инновациям и торговле, через который можно в любой момент узнать, разрешено ли деятельность организации / индивидуального предпринимателя, будет закодирован в каждом конкретном QR-коде, выданном организациям / индивидуальным предпринимателям.

Назначение. QR-коды были введены, чтобы любой посетитель мог проверить, разрешено ли организации / индивидуальному предпринимателю работать в Санкт-Петербурге, и упростить сообщение о любых нарушениях, поскольку посетителям нужно только отсканировать код и отправить сообщение, чтобы сообщить о нарушениях.Если QR-код доступен, это означает, что отображающая его организация официально подтвердила, что она готова соблюдать стандарты безопасности. QR-коды уже использовались в Санкт-Петербурге для идентификации авторизованных нестационарных торговых точек.

Срок сдачи. Организации должны до 1 ноября 2020 года до получить новые или заменить старые QR-коды , и если организация работает в нескольких местах, коды должны быть получены для каждого места деятельности.

Как их получить? Все запросы QR-кодов обрабатываются St.Центр развития и поддержки предпринимательства Санкт-Петербурга в порядке, утвержденном приказом Комитета по промышленной политике, инновациям и торговле Санкт-Петербурга. После уведомления Центр развития и поддержки предпринимательства Санкт-Петербурга проверяет предоставленную информацию:

«После уведомления Санкт-Петербургский центр развития и поддержки предпринимательства проверяет следующую информацию:

  • Количество сотрудников в организации (индивидуальном предпринимателе)
    • работаю полный рабочий день;
    • работает удаленно;
    • старше 65 лет.
  • Реализованы ли меры по обеспечению безопасности деятельности в организации (индивидуальном предпринимателе), в том числе путем предоставления фотографий, подтверждающих выполнение мер безопасности в соответствии с критериями снятия ограничений с организации (индивидуального предпринимателя).
  • Правильность предоставленных данных и соблюдение организацией (индивидуальным предпринимателем) норм и требований техники безопасности.”

Проверка информации может занять до 3-х рабочих дней, а уникальный QR-код будет выдан в течение 1 рабочего дня после проверки организации (индивидуального предпринимателя). Если QR-код не выдается, то причины его отказа также сообщаются в течение 1 рабочего дня. QR-коды могут быть загружены из онлайн-аккаунтов, и их выдача уведомляется по электронной почте, с которой онлайн-аккаунт зарегистрирован. Санкт-Петербургский центр развития и поддержки предпринимательства должен также проинформировать организации о том, что они должны размещать свой QR-код «на видном месте, доступном для потребителей, , включая свой веб-сайт .«Материнским организациям разрешено с 26 октября, и теперь они могут централизованно предоставлять информацию о своих подразделениях и получать QR-коды для каждого из них. Если у вас есть вопросы по поводу подачи уведомлений о возобновлении работы и сотрудников старше 65 лет, обращайтесь в Центр развития и поддержки предпринимательства Санкт-Петербурга по адресу [email protected]

Когда можно отменить QR-код? QR-код может быть аннулирован в течение 1 рабочего дня, если организация не выполняет требования контрольного списка стандартов безопасности. Санкт-Петербургский Центр развития и поддержки предпринимательства должен уведомить о такой отмене. Со стандартами безопасности и чек-листами можно ознакомиться на сайте Санкт-Петербургского центра развития и поддержки предпринимательства. Проверки безопасности проводятся инкогнито, и по их результатам организации могут потерять разрешение на работу, а QR-коды могут быть аннулированы. В таком случае и подразделения, и головные офисы получат уведомление об аннулировании QR-кода.

Как их продлить? QR-коды обновляются так же, как выпускаются новые QR-коды.

С 1 по 20 октября было аннулировано 145 разрешений для компаний и продлено 67 разрешений.

Совещание по ситуации в системе образования • Президент России

Во встрече приняли участие руководитель аппарата. Администрации Президента РФ Антон Вайно Вайно Антон Руководитель Администрации Президента, Первый заместитель Руководителя Администрации Президента Администрации Президента Сергей Кириенко Кириенко Сергей Первый заместитель Руководителя Администрации Президента, Заместитель Председателя Правительства Татьяна Голикова Голикова Татьяна Заместитель Председателя Правительства, помощники Президента Максим Орешкин Орешкин Максим, помощник Президента и Андрей Фурсенко Фурсенко Андрей, помощник Президента, Министр труда и социальной защиты Антон Котяков, министр образования Сергей Кравцов Кравцов Сергей Министр образования, Министр науки и высшего образования Валерий Фальков, Киров Губернатор области и руководитель рабочей группы по подготовке Госсовета совещание по вопросам общего образования в регионах России Игорь Васильев Васильев Игорь Губернатор Кировской области, Мэр Москвы и руководитель рабочей группы Госсовета по противодействию распространению нового коронавирусная инфекция Сергей Собянин Собянин Сергей Мэр Москвы, руководитель Федеральной службы по надзору в сфере защиты прав потребителей и благополучия человека (Роспотребнадзор) — Главный государственный Санитарный врач Анна Попова Попова Анна Руководитель Федеральной службы по надзору в сфере защиты прав потребителей и благополучия потребителей (Роспотребнадзор), и. о. руководителя Федеральной службы по надзору кандидат педагогических наук Музаев Анзор, ректор МГУ Виктор Садовничий, ректор СПбГУ Николай Кропачев, директор Президентского физико-математического лицея №239 (Санкт-Петербург) Максим Пратусевич и руководитель фонда «Талант и успех» Елена Шмелева.

* * *

Президент России Владимир Путин : Добрый день коллеги,

По плану сегодня обсудим ситуацию в системе образования — задачи на будущее и актуальные вопросы, волнующие людей, в частности детей и родителей.

Очевидно, что конец этой академической год сложный. Однако прежде всего хочу сказать, что российские система образования и наши ученики, студенты и их учителя прошли этот тест очень хорошо.

Одна из первых мер, которые мы немедленно предприняли в борьбе с эпидемией коронавируса был перевод наших школ, колледжи и университеты на онлайн-классы. Это был непростой вариант, но я уверен, что это было абсолютно правильное решение. Мы сделали это, потому что мы верю, и я не раз говорил об этом, что нашей главной целью было защитить жизни, в данном случае — жизни наших детей, молодежи и их учителей.

Я прекрасно понимаю, что преподавать и учиться в таких необычных условиях сложно.Нагрузка учителей значительно увеличился и возникла необходимость быстро осваивать новые технологий, настроить оборудование и подготовиться к урокам в разных путь. Учителям приходилось постоянно общаться со студентами удаленно, а не просто во время уроков. Им приходилось предлагать помощь, совет и помощь и объяснять материал. Я считаю, что родители также переоценили важность работы учителей за последние несколько недель. Они смогли наблюдать за всем учебный процесс, потому что их дети остались дома.Родители, бабушки и дедушки могли видеть, сколько учителя вкладывают в своих учеников.

Школьники тоже увидели в этом серьезное испытание, которое оценили их чувство ответственности и независимости, когда желание учиться является главной мотивацией. Я уверен, что этот опыт безусловно окажутся ценными в будущем, тем более что сейчас необходимо продолжать получать новые знания в течение всей жизни.

Хочу поблагодарить всех учеников, учителей и родителей за терпение и взаимную поддержку.Хочу адресовать самые теплые слова старшеклассникам и студентам, которые помимо учебы, активно участвовали в волонтерских проектах, помогали соседям и пожилым людям.

Конечно, были проблемы в организации общенациональных онлайн-исследований. Это естественно, потому что Россия и весь мир не имел практического опыта в этой области. Это необходимо объективно оценить результаты и проверить знания, полученные во время этот период.При необходимости придется выделить дополнительное время на доработку, чтобы полностью усвоить материал. И надо будет поправить любое возникающие проблемы.

В то же время повторю еще раз: все мы приобрели уникальный опыт, который должен способствовать повышению качества, повышению качества образование более доступным и развитие передовых технологий онлайн-образования. Это позволит учащимся, где бы они ни жили, слушать лекции и уроки ведущих преподавателей. Кроме того, учителя смогут работать. индивидуально со студентами, нуждающимися в дополнительной поддержке.В этой связи, необходимо ускорить нашу работу по развитию современной ИТ-инфраструктуры в сфере образования, включая установку широкополосного Интернета в школах.

Цифровизация и телекоммуникации — источник невероятных возможностей, вы это хорошо знаете. Но конечно, они не заменят личное общение между учителем и учеником, творческую командную работу и товарищество в школе, колледже или университете. Я рассматриваю любые слухи и ложные утверждения о том, что онлайн-образование полностью заменить и вытеснить очные занятия и традиционные школы и университеты будут закрыты как вопиющая провокация.Особенно потому что цель системы образования не только научить, но и привить моральные ценности и, в значительной степени, формируют личность учащегося и передают основные ценности и традиции нашего общества. Я сказал об этом в Послании Федеральному Собранию в этом году, и тогда мы решили платить дополнительно 5000 рублей в месяц классным руководителям, которые особенно отвечает за воспитание и работу с детьми. Эта мера займет эффект в начале следующего учебного года.

Также я внес в Госдуму поправки в Закон «Об образовании». Цель этих поправок — усилить наставнический аспект национальной системы образования и сосредоточиться на нем.

Я предлагаю, чтобы эти и многие другие общесистемные вопросы будут подробно обсуждены на предстоящем заседании Госсовета в этом осень, которая будет посвящена образованию, как мы договорились.


Почти 692000 школьников в нашей стране должны закончить в этом году. Особо хотел бы остановиться на вопросе, волнующем выпускников и их родителей, что происходит. должно произойти с Национальным выпускным школьным экзаменом (EGE).

Откровенно говоря, предложений было много. что касается ЕГЭ, в том числе и вовсе отменить его в этом году ввиду сложной ситуации.

Следует подчеркнуть, что, несмотря на множество проблем, которые были и о которых мы знаем, за более чем десятилетие национальный выпускной экзамен в школе стал эффективным средством оценки. механизм. Правила экзамена ясны, справедливы и, на мой взгляд, удобный.

Учитывая неуклонное замедление эпидемии коронавируса, считаю необходимым проведение Национальной выпускной школы. Экзамен по всей стране.Он состоится 29 июня. Школы могут помочь Студенты готовятся к экзамену дистанционно.

Позвольте мне подчеркнуть, что Национальная выпускная школа Экзамен будут сдавать только абитуриенты, которые собираются поступать в вузы. этот год. Что касается аттестатов об окончании школы, то они будут выданы всем выпускники школы без экзаменов. Это временное решение — исключение.

Можно поступить в несколько вузов одновременно по результатам Национального выпускного школьного экзамена и без личное присутствие.Сейчас особенно важно, чтобы кандидаты быть зачисленным в августе. Более того, студенты, которые не смогут экзамены в формате National Final School Exam в июне будут иметь возможность сделать это в августе и занять оставшиеся места в университетах. Это будет позволить им приступить к учебе осенью, не теряя целого года.

Надеюсь, что с учетом эпидемиологического ситуация, все первокурсники начнут учиться, не теряя слишком много время.Мы уже договорились с Минобороны отложить призыв выпускников школ в этом году.

И еще один момент. Считаю необходимым предусмотреть дополнительные периоды для сдачи национального выпускного школьного экзамена или экзаменов. в этом формате не только летом, в июне и августе, но и в следующие академический год.

Конечно, для нас важно, чтобы доступ к бесплатному высшему образованию и поддержка молодых людей. Я предложил в Послании Федеральному Собранию с каждым годом увеличивать количество бюджетных вакансий в вузах по приоритетным социально-экономическим направлениям, начиная с 2021 г.Эти вакансии должны быть предоставлены в первую очередь региональным университетам. Я считаю, что мы должны сделать этот шаг уже в этом году и создать дополнительные финансируемых государством вакансий, чтобы не менее 60 процентов выпускников школ могли иметь право на бесплатное университетское образование.

Сегодня я хотел бы попросить вас подробно рассказать о том, как будет проводиться национальный выпускной школьный экзамен. Это прежде всего касается безопасности студентов и неукоснительного соблюдения всех санитарных норм. требования, которые полностью относятся к их летнему отдыху.

Этот вопрос очень важен для миллионов российских семей. Почему это особенно важно сегодня? Потому что компании и организации полностью возобновят свою деятельность в ближайшие несколько месяцев. и не все родители смогут взять отпуск и проводить достаточно времени с их дети. Вот почему необходимо продумать все аспекты летнего отдыха. подробно.

Предлагаю отдельно обсудить дополнительные меры по поддержке университетов и других федеральных учреждений, а также вопросы трудоустройства студентов.Это большой пакет проблем, который нам предстоит решить. вместе.

Перейдем к обсуждению всех этих тем.


Владимир Путин : Подведем итоги нашей беседы и обозначим области на которые я хотел бы обратить особое внимание.

Во-первых, об этом мы уже говорили много раз, но хочу еще раз подчеркнуть, жизнь и здоровье наших детей и молодежь, и все наши люди в целом, а также безопасность всех образовательные учреждения имеют первостепенное значение и являются высшим приоритетом для нас.В связи с этим необходимо ужесточить санитарные нормы и обеспечить соблюдение строгое соответствие на стандартизированных экзаменационных местах и ​​местах детских праздников. В дополнение к этому, я хочу, чтобы правительство предложило более строгие санитарные нормы организации очных занятий во всех образовательных учреждениях. Такие стандарты должны быть на месте к тому времени, когда школьники и студенты — мы рассмотрели это сегодня — вернуться в свои классы и лекционные залы.

Во-вторых, исходя из ситуации и мнения санитарных служб, регионы должны определить ориентировочные сроки открытия детских домов отдыха и развлечений.Также важно предусмотреть отдых, досуг и творческую деятельность детей в городской и сельской местности. Для этого необходимо использовать все учебные заведения. Городские летние детские лагеря нужно создавать не только при школах, но и также во внешкольных учреждениях, таких как Quantoriums и Youth Innovation Центры творчества и тому подобное, о которых только что упомянули наши коллеги. Решения должны быть сделаны быстро, но необходимо учитывать каждую мелочь. Есть Здесь нет ничего неважного, все необходимое.Надо на здоровье настроить мониторинг детей и персонала. Подача заявлений и необходимых бумаг должно быть беспроблемным и для родителей.

В-третьих, было решено, и г-жа Голикова только что об этом упомянула, чтобы прислать 41,4, даже чуть больше, думаю, почти 42 млрд рублей на поддержку федеральных учреждений образования, науки и культуры. Эти средства пойдут в основном на выплату заработной платы, в том числе университету. профессора. Такая мера поддержки поможет компенсировать сокращение внебюджетных поступлений таких организаций.

Я хочу университеты и все высшие учебные заведения, чтобы понять, что сегодняшние трудности не могут быть пересматривал, а тем более резко повышал плату за обучение. Это не вариант. Напротив, я хочу, чтобы вы внимательно рассмотрели каждый случай, когда студент изо всех сил пытаются платить за обучение и придумать эффективные механизмы их поддержки, включая помощь в заключении контрактов на спонсируемое работодателем обучение с компаниями в реальном секторе. Это поможет улучшить ситуацию с оплатой за обучение.

Четвертый пункт. Как я уже упоминал, мы будем делать бесплатное высшее образование более доступным, прежде всего в регионах, где не хватает высококвалифицированных специалистов.

Но молодые люди должны иметь и другие возможность получить образование, в том числе оплатив его образовательной ссудой на максимально легких условиях. В этом контексте прошу Правительство изучить совместно с Банком России способы снижения процентной ставки по образовательным кредитам с нынешней ставки более 8 процентов до 3 процентов, для продления срока возврата таких кредитов и увеличения налоговых отчислений при их погашении.Важно отметить, что вычеты должны быть сделаны как из ссуды, так и с процентов по ней.

Пятая точка. Необходимо существенно расширить возможности получения опыта работы студентами вузов и колледжей, и, что не менее важно, подзаработать. Мы договорились с участниками движения российских студенческих отрядов о проведении очных студентам предоставляется возможность приобрести профессию, не платя за нее. Я напоминаю вы об этом потому, что необходимо внести соответствующие поправки в закон без задержки.

Отдельно хочу обратиться к главному агрохолдинги. Да, везде будут работать студенческие отряды. Мы только что говорили о это при встрече. Но я предлагаю нашим коллегам из агрохолдингов и студенческих отрядов организовать дополнительную летнюю работу в сельском хозяйстве. Я уверен что ты приобретут надежных, хороших помощников, а молодежь не только сделает немного денег, но у вас также будет возможность отдохнуть на свежем воздухе.

Кроме того, необходимо принять закон. в июне, что позволит старшекурсникам педагогических и других университеты для работы в образовательных учреждениях как на временной, так и на постоянной основе. В качестве первого шага они могли принять участие в организации праздников. для детей этим летом. По большому счету, это уже осуществляется. Этот просто нужно делать в большем масштабе.

Еще одно направление, где могут учиться студенты пользы этой стране и нашему народу. Я имею в виду задачи цифровой экономики. Необходимо предложить удобные, высокооплачиваемые рабочие места для студентов IT- и инженерных специальностей.


Сегодня мы обсудили вопросы, которые волнуют миллионы русских семей.Все меры, которые мы сформулировали, должны быть выполнено в полном объеме. Речь идет о наших детях, молодежи и, без всякого преувеличения будущее этой страны. Мы должны следить за всем этим вопросы, и я собираюсь сделать это лично.

Я призываю вас принять участие в совместной позитивной работе, которая набирает обороты с прохождением коронавирусной инфекции в нашей стране. Я хочу пожелать всем успехов и благодарим вас за совместную работу на сегодняшней встрече.

Большое спасибо.

Доступ к потребителям в России

В России все больше становится обществом потребления. Основными факторами покупки являются бренд, качество и долговечность продукта. Российские потребители по-прежнему заботятся о ценах, они также ищут качественные, новые и полезные продукты. Согласно опросу GfK, в 2019 году 46% россиян заявили, что ищут способ сэкономить и использовать для этого специальные предложения, 54% россиян заявили, что ищут магазины с низкими ценами.Рекламные акции обычно привлекают российских потребителей, большинство населения которых посещает несколько торговых точек для заключения выгодных сделок. В традиционных магазинах (фирменные магазины, супермаркеты, дистрибьюторы, прямые торговые посредники и т. Д.) Совершается больше всего покупок. Около 49% потребителей отдают предпочтение зарубежной продукции, а не местной, однако товары, произведенные в России, привлекают все больше и больше людей. Российские потребители в целом лояльны к брендам. Кроме того, удобство становится одним из ключевых приоритетов для потребителей, что стимулировало развитие электронной коммерции (службы доставки) и отрицательно сказалось на продажах в крупных торговых объектах.На розничном продуктовом рынке формат дискаунтера получает все большее распространение.

Федерация находится в постоянном развитии в области онлайн-торговли. Имея 118 миллионов активных пользователей в Интернете, он занимает седьмое место среди стран с наибольшим числом пользователей в мире. По данным исследовательской компании Data Insight, в 2019 году на электронную коммерцию приходилось всего 1,4% экономики России. За первые четыре месяца 2020 года 65 миллионов россиян решили делать покупки в Интернете. Действительно, после пандемии COVID-19 проникновение электронной коммерции в России увеличилось с 7% от общего объема розничных продаж в 2019 году до примерно 11% в 2020 году.

Основной новой тенденцией является потребление более здоровых продуктов. Половина населения готова платить больше за продукты, улучшающие их здоровье и качество жизни, такие как свежие продукты, фрукты и овощи, образование, лекарства или путешествия. По данным Nielsen, более 84% заявили, что недавно изменили свои привычки в еде. Рынок органических продуктов также растет. Согласно исследованию GfK, каждый четвертый россиянин интересуется сельскохозяйственными продуктами, а каждый пятый — продуктами с пометкой «био», «эко» или «органический».По оценке Euromonitor, в 2019 году продажи такой продукции на российском рынке превысят 900 миллиардов рублей (12,5 миллиарда долларов). Рынок подержанных товаров не так развит, как в Европе, и используется только определенными слоями населения. Большинство обменов на совместных платформах касается товаров, которыми торгуют между людьми, и каршеринга (совместного использования автомобилей). Пандемия Covid-19 стимулировала спрос на обувь и одежду секонд-хенд в России, как показывают исследования, проведенные российским консалтинговым агентством Fashion Research Group.На этот сегмент приходится 6% продаж российского модного рынка.

Россия критикует New York Times и Financial Times из-за сообщений о смертях от коронавируса

Москва — Россия раскритиковала Financial Times и The New York Times за их недавние статьи, предполагающие, что уровень смертности от COVID-19 в стране может быть намного выше чем официально сообщается, защищая свою методологию за официальными цифрами смертности.

Публикации указали на открытые данные о повышении смертности в Москве и Санкт-Петербурге.-Петербург в прошлом месяце по сравнению с предыдущим апрелем.

В четверг МИД России атаковал газеты, обвинив их в «дезинформации» и потребовав опровержения. Российский депутат Василий Пискарёв также потребовал лишить издания аккредитации.

Официальный представитель МИД России Мария Захарова 17 января 2020 года в Москве, Россия. Александр Земляниченко / AP

Вице-президент по связям с общественностью The New York Times Даниэль Роудс Ха заявила в заявлении, полученном CBS News, что отчет газеты был точным, поскольку он основан на «общедоступных правительственных отчетах и ​​интервью с экспертами из государственных учреждений. .«

Россия занимает второе место по количеству подтвержденных случаев COVID-19 в мире после США: по состоянию на пятницу было зарегистрировано более 262000 подтвержденных случаев. Однако официальное число погибших в стране остается ниже по сравнению с другими сильно пострадавшими странами: официальные лица России сообщили о 2418 случаях смерти от COVID-19.

По данным правительства, в прошлом месяце в Москве зарегистрировано на 1700 смертей больше, чем в апреле, в среднем на человек за последние пять лет.The New York Times указала, что это число намного выше, чем официальное число смертей от коронавируса в России, составившее 642 человека в Москве за апрель.

The Financial Times сообщила о аналогичном всплеске общего числа смертей в Санкт-Петербурге в апреле, предполагая, что в стране может быть на 70% больше смертей от коронавируса, чем официально заявлено.

Актуальные новости
Актуальные новости Более

Ни одно из изданий не удовлетворило требование министерства иностранных дел об опровержении.

Департамент здравоохранения Москвы отреагировал на сообщения прессы в среду заявлением о том, что более 60% смертей среди городских пациентов с коронавирусом не включены в официальную статистику смертей от вируса, потому что их смерть произошла от основных причин. Официальные лица заявили, что вскрытия проводятся при подозрении на смерть от коронавируса, и защитили свою методологию как «исключительно точную».

Российские официальные лица также заявили, что большой объем тестирования способствует низкой смертности, что позволяет обнаруживать инфекции на ранних стадиях.По данным Росздравнадзора, Роспотребнадзора, по состоянию на пятницу было проведено 6,4 миллиона тестов на COVID-19.

Границы | «Солдаты системы»: охрана материнства в России между бюрократическими инструкциями и эпидемиологическими рисками COVID-19

Материнство в России: бюрократический контроль и институциональное недоверие

Реформы системы охраны материнства, проведенные в постсоветский период, неоднозначны и неоднозначны. противоречивые последствия. С одной стороны, реформы привели к коммерциализации родильных домов и появлению платных услуг и частных родильных домов.Всем гражданам России медицинская помощь оказывается бесплатно в соответствии с государственной программой медицинского страхования. Однако женщины из новой категории требовательных и информированных потребителей часто платят за «родовой договор», чтобы получить индивидуальный уход и более комфортные условия в больнице (Темкина, 2017). Правило информированного добровольного согласия позволяет женщинам отказываться от нежелательных медицинских манипуляций (Федеральный закон № 323, 2011 г.). Присутствие партнера по беременности и родам также гарантируется законом: отец ребенка или другие члены семьи могут сопровождать женщину в родильном зале (там же).Доулам также разрешено сопровождать женщин в некоторых родильных домах, хотя их статус остается неопределенным. В целом, родильные дома стали более открытыми и более ориентированными на потребности женщин и новорожденных, чем два десятилетия назад, по крайней мере, в больших городах: практика «мягких» или «естественных» родов становится все более распространенной, «золотой час» »После родов и поощряется грудное вскармливание (Ожиганова, 2020).

С другой стороны, с советских времен до наших дней логика бюрократического контроля продолжает играть решающую роль в российской системе здравоохранения и даже усилилась в последние годы (Litvina et al., 2020). Угроза преследования врачей усилилась, о чем свидетельствуют несколько громких судебных процессов над акушерами-гинекологами и неонатологами. Российские врачи не обладают такой же экспертной властью и автономией, как их коллеги в западных обществах, медицинские профессиональные организации не имеют большого влияния, а экономические и политические интересы врачей в значительной степени игнорируются (там же).

Домашние роды незаконны; тем не менее, он существует, по крайней мере, в больших городах, как выражение недоверия к акушерской практике (Ожиганова, 2019).Число внебольничных родов неизвестно, поскольку эта статистика не ведется.

Подтверждая характеристику России Фукуямой как «страну недоверия» (Fukuyama, 1996), российские граждане демонстрируют исключительно высокий уровень недоверия к медицине. Более половины россиян (57%) не обращаются к врачу в случае болезни, предпочитая самолечение; почти пятая часть граждан (19%) принципиально избегает врачей (Health Mail.ru, 2019). Только 11% согласны с утверждением, что врач заинтересован в их здоровье (FOM 2019).Высокая уязвимость врачей и высокие риски их работы способствуют тому, что они сами не склонны доверять системе, в которой работают (Litvina et al., 2020).

Во время пандемии коронавируса российские власти приняли меры инфекционного контроля, типичные для авторитарных режимов: искажение информации, манипуляции со статистикой и откровенная дезинформация; нарушения прав человека, в частности, принудительная «самоизоляция»; принудительная госпитализация людей с подозрением на COVID-19; и контроль людей с помощью электронных пропусков, содержащих штрих-коды, через программу социального мониторинга, которая отслеживает местонахождение и передвижения людей (Иноземцев, 2020).Кроме того, институциональные пробелы в управлении здравоохранением и отсутствие средств индивидуальной защиты (СИЗ) для врачей привели к наказанию медицинских работников за жалобы и репрессалиям в отношении независимых медицинских организаций (Васильева, 2020).

Борьба с пандемией в России происходит в ситуации новой «правовой пустоты» или «подделки законности», созданной правительством Путина (Карасева 2020: 294). Власти России не используют ни одну из двух версий чрезвычайных режимов («чрезвычайная ситуация» и «чрезвычайное положение»), предусмотренных российским законодательством, а объявляют предаварийную «чрезвычайную тревогу», а в поправки к этим указу вводят «Режим самоизоляции», «удаленная работа» и «карантин» — все это отсутствует в законе.В сфере здравоохранения этот правовой пробел проявился в массовом диагнозе «внебольничная пневмония» вместо коронавирусной инфекции (см., Например, журналистские расследования Яппаровой и др., 2020).

Методы и материалы, доверие и недоверие

В недавних работах Мюльфрид призывает к пересмотру существующего подхода социальных наук к феномену недоверия «как оборотной стороне доверия, как досадному отсутствию, социальной неудаче или препятствие, которое необходимо преодолеть »(Mühlfried, 2018: 7). Он предполагает, что доверие и недоверие нельзя понимать как противоположности: те отношения, которые часто приписывают недоверию, на самом деле являются примерами сосуществования доверия и недоверия, возникающих в ситуациях неопределенности. В случае доверия люди инвестируют в укрепление своих отношений; в случае недоверия — в ослаблении этих отношений и переносе доверия в новые сети доверия. Чтобы определить «недоверие» как эмпирическое явление, нам необходимо задать вопросы: «Как работает недоверие?» и можно ли разделять недоверие и создавать связи (там же: 19).По словам Мюльфрида, недоверие — это разумная реакция на всевозможные разоблачения, а также может быть первым шагом к критическому политическому участию.

Эпидемия COVID-19 в России спровоцировала множество скрытых конфликтов, в которых важную роль сыграло недоверие. В этой статье я спрашиваю, как охрана материнства отреагировала на вызовы эпидемии COVID-19? Учитывая общее недоверие к «системе», как акушеры реагируют на изменившуюся ситуацию: новые инструкции, противоэпидемические ограничения и изменившиеся условия труда? Какие новые отношения и практики доверия и недоверия возникли между перинатальными специалистами и женщинами?

Эта статья основана на интервью, которое я провел с 11 акушерами-гинекологами, двумя акушерками, двумя перинатальными психологами, работающими в родильных домах, 6 домашними акушерками, 12 доулами и 14 женщинами, родившими во время пандемии 1 . Первые интервью были записаны в марте, когда эпидемия COVID-19 в России только начиналась; последний в августе, когда уже были отменены некоторые профилактические меры инфекционного контроля. Таким образом, стало возможным увидеть, что в системе охраны материнства изменилось изначально, а какие изменения продолжались. Большинство этих записанных интервью было с перинатальными специалистами и женщинами из Москвы и Московской области; семь были с представителями других регионов: Центра, Санкт-Петербурга, Урала и Сибири.Я также следил за публикациями акушера / гинеколога, который писал о своей работе в московском родильном доме COVID-19 в социальной сети Instagram (очень редкая практика среди российских врачей), а также на официальных страницах родильных домов в Facebook и Instagram.

Мои собеседования с врачами и акушерками включали следующие вопросы: Как изменился график работы вашей больницы? Изменилась ли ваша акушерская практика? Как вы оцениваете меры профилактики COVID-19 в вашей больнице? Мои интервью с женщинами включали вопросы о том, повлияла ли эпидемия на то, где, как и с кем были роды, и какие факторы оказали наибольшее влияние. Поскольку доулы обычно очень хорошо знают, что происходит в родильных домах города, где они работают, они стали ценными собеседниками; однако в центре моего исследования были врачи и их восприятие ситуации с пандемией. У меня было несколько точек входа в эту область: я использовала старые контакты с врачами и акушерками, но также нашла новых собеседников через Ассоциацию профессиональных доулов и Центр традиционной акушерства, который проводит учебные курсы для акушеров-гинекологов и акушерок.Следует отметить, что многие врачи отказались от интервью. Для согласившихся было крайне важно, чтобы интервью не было «официальным», то есть им была гарантирована полная анонимность. Я проанализировал эти интервью тематически.

В целях анонимности все личные имена и названия родильных домов не указываются. В интервью с врачами и акушерками из провинции по их запросу указывается только регион, а не город, так как это может сделать источник данных потенциально идентифицируемым.Учитывая уровень недоверия к российской системе здравоохранения в целом, который выражали мои собеседники-врачи, читатели могут задаться вопросом, почему они были достаточно открыты со мной как исследователем, чтобы ответить на мои вопросы так же откровенно, как и они (см. Ниже). Возможно, эта открытость была связана не только с обещанной мной анонимностью, но и с моей позицией, которую я озвучивал перед каждым собеседованием: моя цель не в выявлении возможных нарушений правил и протоколов в их работе, а в том, чтобы лучше понять, как и в каких условиях им приходится работать в этой сложной ситуации пандемии коронавируса.Также важно отметить, что и в позднесоветской, и в постсоветской традициях существует большая дистанция между частным разговором, в котором люди говорят свободно, и публичными выступлениями, в которых люди обычно очень осторожны в том, что они говорят. Мои собеседники восприняли интервью как частную беседу.

Экстренное реагирование материнства на пандемию Covid-19: мнения врачей

Меры профилактики COVID-19: переоборудование родильных домов, новые клинические рекомендации и планы маршрутизации

В середине марта национальное министерство здравоохранения и Областные управления здравоохранения приняли ряд профилактических мер в ответ на пандемию COVID-19. Все родильные дома были разделены на три группы: «чистые», «инфекционные» и «буферные» (промежуточная зона, в которой находятся пациенты с неподтвержденным диагнозом) или соответственно «зеленые», «красные» и «желтые». зоны. Потоки беременных, рожениц и новорожденных следует разделять на основании их тестов на COVID-19, симптомов ОРВИ и данных о контактах с COVID-19 и направлять в соответствующие больницы в соответствии с новые планы маршрутизации.Во всех больницах был объявлен карантинный режим, а это означает, что посещения пациентов и партнеров при родах были запрещены. Для женщин с подтвержденным или подозреваемым COVID-19 были введены дополнительные профилактические меры: отделение от новорожденных, запрет кормления грудью и длительный карантин в больнице до получения отрицательных результатов анализов (Рекомендации 2020). Младенцы с неонатальными заболеваниями и подозрением на COVID-19 должны быть отправлены для получения высокотехнологичной медицинской помощи в специализированные больницы, где должны быть открыты специальные «боксы Мельцера» — полностью изолированные палаты для инфекционных пациентов с проходом для персонала.

Преобразование родильных домов в больницы с COVID-19

В начале эпидемии некоторые родильные дома были преобразованы в больницы с COVID-19, где акушеры и гинекологи не принимают родов, а работают врачами общей практики. Врачи объяснили, что такое решение было удобным, так как в России родильные дома — это обычно отдельно стоящие здания, с системой «боксов», построенные как инфекционные больницы, где всегда соблюдается строгий санитарно-эпидемиологический режим.В связи с преобразованием этих родильных домов в оставшиеся «чистые» больницы резко увеличился поток пациентов. По некоторым данным, количество пациентов в таких больницах увеличилось более чем вдвое: то же количество врачей и акушерок стало принимать более 40 родов в день вместо прежних 20 (интервью 1b). Также были закрыты некоторые родильные дома, специализирующиеся на лечении беременных с хроническими заболеваниями; в результате беременные женщины с проблемами сердца или почек не могли получить всю необходимую медицинскую помощь (интервью 5).

Один из крупнейших московских роддомов на 210 коек 12 марта был преобразован в больницу для больных COVID-19. Эта новость была передана в СМИ по инициативе врачей:

Коллектив родильного дома обратились в Департамент здравоохранения Москвы с предложением перепрофилировать свои койки под инфекционную больницу. Врачи объясняют это так: «Защищать граждан — наш профессиональный долг». (Проценко 2020).

Доктор Н., акушер-гинеколог этого роддома, сказал, что решение о переводе было принято этим отделением, и иначе и быть не могло: такие решения принимаются не руководителями больниц, и тем более персонал:

В чем инициатива? Это нелепо.Конечно, это инициатива ведомства. У нас ведь все так — «по многочисленным просьбам трудящихся». Мы все мгновенно отключились. Вставай и уходи (интервью 1а).

В результате доктор Н. и ее коллеги около трех месяцев работали терапевтами с пациентами с COVID-19; В конце июля родильный дом вернулся к своей обычной работе. Многие из ее коллег заболели COVID, и многие из них попали в реанимацию. Однако Dr.Н. не пожаловалась, отметив, что их буквально «засыпали всякими льготами»: обеспечивали СИЗ, выплачивали пособия, приносили хорошую еду и даже предлагали номера в пятизвездочных отелях. Однако ей было очень сложно не выполнять свою работу, и она сомневается в правильности такого решения: «Нас лишают работы, это ужасно! Мне кажется, это просто какое-то неэффективное использование человеческих ресурсов »(Интервью 1а). Однако она считает, что ничего не поделаешь; они могли только подчиняться.Только два врача из большого штата больницы покинули службу.

Официальная отмена партнерской поддержки и неформальные способы ее обойти

Роды с партнером стали довольно популярными, особенно в крупных городах: 30% в Москве и до 70% в некоторых родильных домах в Москве и Санкт-Петербурге. Отмена партнерских родов была болезненной для женщин, которые часто искали способы обойти это; некоторые даже решили рожать дома. Однако, по словам опрошенных мной акушерок, родивших на дому, пандемия существенно не повлияла на количество внебольничных родов: это были запланированные домашние роды с акушеркой.

Некоторые родильные дома начали принимать партнеров в июле, но почти исключительно по контракту (что фактически означало, что пара должна была платить за присутствие партнера) и, за редким исключением, только отцов, а не доул. К концу августа большинство родильных домов, особенно в провинции, не вернулись к этому варианту.

Запрет на рождение ребенка от партнера стал еще одним проявлением «правовой пустоты», поскольку не имеет под собой законного основания. Согласно рекомендациям Министерства здравоохранения, «партнерские роды должны быть запрещены в вероятных или подтвержденных случаях COVID-19, чтобы снизить риск заражения» (Рекомендации 2020: 23), но на практике это было отменено для всех.

Большинство врачей отнеслись к этому запрету очень спокойно, считая его обычной профилактической мерой. Доктор А., акушер-гинеколог одного из московских роддомов, считает, что это, несомненно, правильная и «совершенно обычная карантинная мера», которая проводится регулярно, ежегодно, во время сезона гриппа и ОРВИ. Она подчеркивает, что ограничения коснулись только женщин, и для нее как для врача ничего кардинально не изменилось: «Это просто наша работа. Это рекомендации Министерства здравоохранения.Мы обязаны подчиняться »(Интервью 3).

Доктор Э., акушер-гинеколог родильного дома Санкт-Петербурга, где роды с партнерами составляли 50% всех родов, также однозначно поддерживает их отмену: «Это адекватная мера: чем меньше контактов, тем меньше шанс заражения. » В подтверждение она рассказала историю о событии, которое произошло в ее роддоме во время эпидемии свиного гриппа в 2009 году: муж навестил жену, в результате она заболела и умерла. Э. убеждена, что женщины понимают этот запрет: «Я не видела, чтобы кто-то возмущался, потому что все понимают, что так живет вся страна, и никто не виноват.Собственно, претензий не к кому »(Интервью 4).

Однако другие врачи признают, что женщины не согласны с запретом на рождение партнера, и выражают протест. Доктор В., заведующая роддомом в Уральском регионе, сказала, что она постоянно сталкивается с требованиями женщин разрешить сопровождающих партнеров:

Совсем недавно была женщина, которая была крайне негативна, и я ей сказал: связаться с Минздравом и Роспотребнадзором (Федеральная служба по надзору в сфере защиты прав потребителей и благополучия человека), поскольку это не требование родильного дома, это требование этих органов. После этого ее муж позвонил мне и сказал: «Да, мы обратились [к ним], и нам сказали, пожалуйста, на усмотрение родильного дома, они могут допускать партнеров (интервью 6).

Однако доктор В. не разрешал ему присутствовать на родах или родах его жены; по ее мнению, чиновники только пытались переложить на нее ответственность: «Эти люди (сотрудники Росотребнадзора) вели себя недобросовестно, потому что если что-то случится, какая-то вспышка в больнице, то начальник ответит, то есть я отвечу »(Интервью 6).

Партнерские роды превратились в редкую и соответственно ценную услугу и очень быстро стали предметом всевозможных неформальных соглашений и неформальных платежей. Некоторые родильные дома в регионах Москвы и Санкт-Петербурга неофициально разрешили партнерам сопровождать женщин. В частном московском роддоме вопреки распоряжению Департамента здравоохранения продолжалась практика партнерских родов (в некоторых случаях на одного партнера, а в некоторых случаях на двоих) на протяжении всего периода эпидемии в России. Врач из этой больницы признается, что все осталось по-прежнему, но «неофициально» (Интервью 2). При этом цена контракта резко выросла, что стало поводом для шутки: «Чтобы коронавирус стал безопасным, нужно заплатить 350 тысяч рублей; если контракт составляет 200 тысяч или 150 тысяч, то вирус все равно очень опасен! » (Интервью 8).

Некоторые женщины решили воспользоваться услугой некоторых родильных домов: сопровождением перинатального психолога, сотрудника больницы.Перинатальные психологи подтвердили, что во время эпидемии количество обращений за их услугами увеличилось. Однако оказалось, что не всех женщин устраивает такой вариант, так как они опасаются, что такой партнер действует не в их интересах: «Она будет подыгрывать врачам, чтобы уговорить меня что-то сделать, может быть, не то, что лучше». для меня, а что для врача удобнее, потому что тогда она и дальше будет с ним работать, а я уйду »(Интервью 8). Вместо этого женщины склонны доверять доулам, потому что они не из системы здравоохранения. В таких случаях женщины предпочитают поддержку доулы в Интернете поддержке психолога из больницы.

Доулы протестовали против отмены партнерских родов: они подготовили петицию и призвали женщин бороться за свои права. В середине марта 2020 года доула и юрист М. опубликовали в соцсетях предложение написать в Роспотребнадзор запросы о разъяснении этой меры. М. считает это незаконным: поскольку чрезвычайное положение не объявлено, установленные законом гарантии прав граждан не могут быть отменены.Однако ни одна из инициатив доул не получила заметной поддержки. В некоторых случаях партнеры допускались, когда по совету этой доулы они требовали письменный отказ со ссылкой на закон. Такие неформальные переговоры оказались очень ограниченными, но были единственным способом решить проблему достижения партнерских родов.

Родильные дома для женщин с COVID-19: эпидемическая целесообразность или дополнительные риски для здоровья женщин и новорожденных?

Поступление в родильный дом с COVID-19 означает, что к женщине и ее новорожденному будут применены очень жесткие меры: разделение сразу после родов и очень часто усиление медикализации и даже использование лекарств, запрещенных для беременных и кормящих женщин: Калетра (который используется при лечении ВИЧ), азитромицин и другие антибиотики. Мои собеседники отметили рост перинатальных потерь из-за самопроизвольных абортов и внутриутробной гибели плода (Интервью седьмое; Благотворительный фонд «Свет в руках»).

По словам моих собеседников, с появлением COVID-19 акушерская практика кардинально изменилась, и количество хирургических вмешательств в таких больницах увеличилось. Акушерка из Сибирского региона рассказала, что в ее роддоме, предназначенном для женщин с COVID-19, количество родов через кесарево сечение увеличилось с 25% до примерно 60-70%, потому что многие врачи даже не дают женщинам возможности вступить в роды. , но немедленно отправьте их на операцию (интервью 7).Следует отметить, что это произошло даже в роддоме, известном своей поддержкой естественных родов; например, в этой больнице ранее разрешались роды через естественные родовые пути после кесарева сечения (VBAC), даже если мать перенесла два предыдущих кесарева сечения.

Первый родильный дом, который в соответствии с рекомендациями Минздрава был назначен «для приема беременных с ОРВИ, внебольничной пневмонией и пациентов, помещенных на карантин из-за контакта с коронавирусной инфекцией» (Рекомендации 2020) начал работать в Москве 31 марта. Это большой родильный дом на 170 коек, в котором ежегодно рождается более 7000 человек. В апреле он принимал довольно большое количество пациентов: от трех до четырех в день, некоторые с тяжелыми симптомами COVID-19. Однако в июле акушер-гинеколог этой больницы написал в своем блоге в Instagram, что в то время у них было очень мало пациентов: «Честно говоря, лечить практически некому. В огромном здании роддома всего 15 пациентов! » (Пост в Instagram Doctor_yakunin 3).

Родильный дом на 60 коек в большом сибирском городе 27 апреля назначен для работы с женщинами с COVID-19.Он принимает женщин со всего города с подозрением на коронавирусную инфекцию, и, по словам акушерки Т., в среднем во всех трех отделениях было около 10–12 женщин. Женщин проходят обследование в приемном отделении и помещают в «желтую» буферную зону, затем по результатам обследования через 3–4 дня переводят в «зеленую» или «красную» зону.

Таким образом, те родильные дома, которые сохраняют статус инфекционных больниц, заполнены лишь частично. Мои собеседники говорят, что очень часто к ним привозят женщин без симптомов и с неподтвержденным диагнозом:

«Скорая» привезла женщину с кричащим семидневным малышом.Женщину беспокоит боль в шве (рубце) после кесарева сечения, которое неделю назад сделали в обычном «чистом» роддоме. После выписки она пошла к свекрови забрать старшего ребенка. Оказывается, у этой бабушки есть антитела IgG к коронавирусу (наличие этих антител указывает на наличие иммунного ответа, то есть устойчивости к болезням) (пост 3 в Instagram от Doctor_yakunin).

Таким образом, мы видим, что скорая помощь по приказу Департамента здравоохранения доставила женщин в эту больницу с COVID без достаточных на то причин (якобы именно эта женщина контактировала с инфицированным человеком), чтобы там не было пустых .

Похожая ситуация сложилась в сибирском роддоме. По распоряжению областного управления здравоохранения в него должны приниматься женщины с температурой выше 37 по Цельсию (98,6 по Фаренгейту), либо с признаками ОРВИ (ОРВИ), а также с акушерской патологией. Однако многие врачи принимают беременных только с легкими признаками простуды (интервью 7). Врачи часто оценивают приказ отделения отправлять женщин с насморком в инфекционный родильный дом как «абсолютный абсурд» и советуют своим пациентам накапать сосудосуживающее средство перед госпитализацией (пост 1 в Instagram doctor_yakunin).

Врачи также понимают, что во время родов температура тела может повыситься из-за психоэмоционального фактора, или просто из-за летней жары, или из-за проблем с почками, но часто врачи в машине скорой помощи не учитывают это и принимают во внимание пациенты прямо в инфекционную больницу (интервью 7).

Женщина, оказавшаяся в буферном («желтом») родильном доме (или отделении), также должна ожидать быстрого перерезания пуповины и отделения от ребенка.На официальной странице одного из этих родильных домов в Facebook женщинам сообщают, что в инкубационный период коронавирусной инфекции им придется оставаться в больнице не менее двух недель: «Мы не уволим вас, если через пару дней вы чувствую себя прекрасно, потому что ты можешь переносить легкую болезнь и передавать ее другим »[сообщение в Facebook, 36roddom (роддом 36)].

Женщины, обращающиеся за медицинской помощью из-за симптомов ОРВИ на любом сроке беременности, подвергаются риску принудительной госпитализации в такую ​​больницу.Неудивительно, что некоторые женщины при плохом самочувствии занимаются самолечением и думают только о том, чтобы скрыть свои симптомы от врачей. Одна из моих собеседников сказала, что у нее и ее семьи, скорее всего, в апреле был COVID-19: две недели у нее был жар, сильная слабость и кашель. Лечилась гомеопатическими препаратами, к врачам не ходила, а в августе, на месяц раньше срока, родила здорового ребенка (интервью 9).

Врачи неоднозначно относятся к разлучению матерей с новорожденными.Некоторые считают эту меру рациональной, поскольку считают, что в настоящее время «слишком мало данных» о передаче болезни от матери к ребенку и «на всякий случай лучше перестраховаться». (Интервью 3, 4). Другие признают, что эта мера слишком суровая (интервью 5), что не считают ее разумной ни с эпидемиологической, ни с психологической точки зрения: «Здесь в больнице проходят лечение матери, либо у них коронавирус, либо это ошибка. в анализе.Следующий анализ мы берем через 10 дней, и они все это время лежат, полоскают горло, капают из носа и плачут за своих младенцев »(интервью 7).

На вопрос, как можно получить согласие женщины на такое лечение, Т. отвечает, что у врачей всегда есть возможность запугать, сказать, что ребенку опасно находиться с матерью, что он заболеет и может умереть. Одна из моих собеседников, гинеколог, которая сама является будущей матерью, подтвердила, что она не только поддерживает разлучение матери и ребенка, но и готова, в случае необходимости, разлучиться со своим ребенком сразу после рождения: « Я бы предпочел, чтобы у моего ребенка было меньше возможностей заразиться от меня.Я бы предпочел отказаться от совместной жизни, если бы только понимал, что о моем ребенке заботятся, что он накормлен и в безопасности »(Интервью 4).

Российская ассоциация консультантов по естественному вскармливанию (ANFC) выступила против практики разделения матери и ребенка в родильных домах. В открытом письме министру здравоохранения от 31 июля 2020 года члены Ассоциации заявили, что «реальные риски для здоровья матерей и новорожденных из-за отсутствия контакта и запрета грудного вскармливания выше, чем потенциальный риск COVID. -19 инфекция »и потребовал, чтобы больницы не отделяли COVID-инфицированных матерей от их новорожденных, если состояние матери не является серьезным, и во всех случаях обеспечивали право новорожденных на грудное вскармливание, соблюдая антисептические методы, предложенные рекомендациями ВОЗ (ношение маски , мытье рук и дезинфекция поверхностей) (ANFC 2020).Однако врачи не поддержали инициативу, и министерство ответило формальным отказом.

Во время эпидемии многие врачи оказались в тяжелом положении, особенно в провинции. По неофициальным данным, смертность врачей от COVID-19 в России намного выше, чем в других странах (Медвестник 2020). Мои собеседники из областных роддомов подтверждают дефицит одноразовых СИЗ, поэтому стирают и сушат их в больнице.Многие врачи, акушерки и медсестры, работающие с пациентами с COVID-19, не получили поощрительных выплат, обещанных им Указом президента от 6 мая. Акушерка Т. говорит, что она заболела COVID-19 в мае, но не получила никаких страховых выплат. Она сказала, что некоторые ее коллеги уже планируют бросить курить после эпидемии: «Работать просто невозможно; вышли все проблемы, на которые мы раньше не обращали внимания только потому, что были очень заняты большим потоком пациентов »(интервью 7).Она признает, что заведующий больницей всегда очень грубо вел себя с персоналом и не стремился обеспечить больницу всем необходимым (в частности, долгое время не производился необходимый ремонт).

Врачи могут по-разному оценивать введенные меры профилактики, но если они считают некоторые из них бесполезными или даже вредными и абсурдными, они не заявляют о своем несогласии публично, а просто подчиняются бюрократическим требованиям и протоколам. Врачи могут предупредить своих пациентов и посоветовать им, как обойти ограничительные меры в рамках личных доверительных отношений.Они могут выразить свое несогласие, уволившись с работы, но в целом они не могут повлиять на функционирование системы.

Пациенты и медицинские работники: практика разделения, запрета и недоверия

Это исследование проводилось во время «первой волны» пандемии коронавируса (с марта по август 2020 г. ) и не охватывает изменений, которые произошли позже. Различия между центральными городами и периферией, а также разнообразие учреждений по уходу за матерями, которые существуют в такой большой и неоднородной стране, как Россия, не могут быть отражены в таком «быстром» исследовании.В результате картина получается довольно мозаичной, однако с учетом этих ограничений можно сделать некоторые предварительные выводы.

Как показано в статьях этого специального выпуска, меры реагирования различных национальных систем здравоохранения на вызовы пандемии COVID-19 часто имеют много общего, например, запрещение или строгое ограничение посетителей, доул, партнеров по беременности и послеродовой контакт матери с новорожденным и кормление грудью. Тем не менее, некоторые меры, принимаемые в России, сильно отличаются от мер в других странах, например, разделение родильных домов на красную, зеленую и желтую зоны и принудительный длительный госпитальный карантин для женщин и новорожденных «на всякий случай». «Общественные обсуждения рисков, связанных с этими запретами, проводились во многих странах, а в некоторых случаях, например, в Нью-Йорке, они были отменены из-за общественного протеста, в основном со стороны женщин, акушерок и доул (Дэвис-Флойд, Гучева , и Шварц, 2020: 7). Однако в России дискуссия, вдохновленная доулами в электронных социальных сетях, прошла почти незамеченной, поскольку недовольство женщин и доул и их предложения по гуманистическим улучшениям не были поддержаны медицинским сообществом и чиновниками здравоохранения.

В отличие от американских женщин, которые боятся больниц из-за возможности заражения (там же: 8), российские женщины опасаются COVID-19 гораздо меньше, чем ограничительных мер, введенных в родильных домах. Появилась грустная шутка: «В России коронавирус не так страшен, как борьба с ним». Женщины боятся идти в больницу без партнера, опасаясь необоснованного медицинского вмешательства, а еще больше боятся инфекционных родильных домов, где их разлучат со своими младенцами сразу после родов и на ближайшие недели.

Основная стратегия многих беременных в ситуации пандемии — мобилизация всех ресурсов «на страхование» от возможных рисков: поиск достоверной информации о врачах и родильных домах; заключать неформальные договоренности с врачами; подписывать дорогие контракты на рождение ребенка и заключить соглашения с доулами для удаленной поддержки (через видео или аудио связь). Таким образом, ситуация с пандемией способствует росту неформальных отношений и неформальных платежей в родильных домах и, соответственно, росту неравенства между разными социальными слоями, а также между крупными городами Москвы и Санкт-Петербурга.Петербург и провинция.

Указания Минздрава и приказы региональных управлений, заявленные как направленные именно на «минимизацию рисков» распространения коронавирусной инфекции, противоречат данным доказательной медицины и международным рекомендациям, а некоторые из них, например такие как отделение матерей от новорожденных и длительный карантин в больнице, не могут рассматриваться как рациональная медицинская этика, а права пациентов считаются несущественными и незначительными, а принципы отделения и запрета имеют авторитет. Принцип запрета, применяемый в России, оправдывает «системные» запреты, описанные выше (см. Benaglia, этот выпуск). И, согласно Дэвис-Флойд (2003, 2018), технократическая модель акушерства основана на принципе разделения, в котором разум отделен от тела, практикующий отделен от пациента, т.е. не связан с ней эмоционально. и, помимо других форм разлуки, мать разлучена как с ее поддерживающими людьми, так и с ребенком. При такой идеологии такое разделение легко оправдать без сожаления.Напротив, гуманистическая модель, как определено Дэвис-Флойдом (там же), основана на принципе связи: соединение разума и тела, практикующего врача и пациента, матери и ее поддерживающих лиц, а также матери и ребенка. До COVID этот принцип связи характеризовал родильное отделение в некоторых наиболее прогрессивных российских больницах.

Почему российская система охраны материнства так резко отреагировала, отменив многие прогрессивные нововведения последних лет, отвергнув рекомендации ВОЗ и научно обоснованные медицинские данные? Мои собеседники из старшего поколения врачей считают, что эта реакция вызвана «исторической памятью»: в ситуации эпидемической опасности работники здравоохранения сразу же вернулись к старой советской практике, основанной на принципах запрета и разделения, засилья бюрократии. логика, патернализм и пренебрежение правами пациентов, когда родильные дома были полностью закрытыми учреждениями со строгими и запретительными правилами, разделением матерей и новорожденных, строгими санитарными и инфекционными мерами.Один акушер прокомментировал:

Я до сих пор помню старое акушерство. Вы все время в состоянии войны. Родильный дом — поле боевых действий. Поэтому были такие строгие акушерки и няни, потому что на самом деле ни женщина, ни ребенок не воспринимались (предметом) ухода. Не учитывался эмоциональный фон. Это была очень тяжелая психологическая нагрузка, и на персонал тоже, потому что они были чем-то вроде винтиков этой машины (Интервью 5). Как показывают мои интервью, врачи и акушерки могут не соглашаться с этими радикальными изменениями, выражать свое несогласие с бюрократическими директивами и сочувствовать женщинам, но они не могут заявить об этом противодействии. публично.В то же время очевидно, что медицинские работники все больше беспокоятся о своей профессиональной автономии. В режиме чрезвычайной ситуации, который официально не был объявлен, зависимость врачей от бюрократии на разных уровнях — от начальника больницы до Министерства здравоохранения — стала даже более заметной, чем в обычное время. Российские врачи как «солдаты системы» обязаны подчиняться приказам органов здравоохранения, и их профессиональная позиция рассматривается только как частное мнение.Они не могут быть уверены в том, что получат необходимую защиту от инфекции и денежную компенсацию, а также не имеют рычагов влияния на администрацию больниц и работников здравоохранения. Ситуация с пандемией свидетельствует о том, что сами врачи не доверяют учреждениям, в которых они работают, как показали результаты исследования, проведенного группой социологов в больницах Санкт-Петербурга (Бороздина, Новкунская, 2020). Врачи, как и пациенты, не доверяют официальной информации, что вызывает критику действий властей по борьбе с эпидемией:

Если честно, я до сих пор не очень понимаю, что происходит. Я все еще в каком-то непонятном состоянии от всего этого, великая ли это ложь или великая зараза? (Интервью 1б).

Сегодня у меня сложилось мнение, что мы как-то очень системно готовимся к тому, что коронавирус плотно войдет в нашу жизнь, и мы будем бороться с ним еще много-много лет. Они хотят запугать нас, чтобы мы могли бесконечно бороться с коронавирусом (пост 2 в Instagram doctor_yakunin).

Эти врачи, которые сами работают в больницах COVID, не отрицают существования вируса; их недоверие — вариант ковидианского диссидентства — термин, широко используемый в российском дискурсе, как в СМИ, так и в электронных социальных сетях, — который следует рассматривать как особый способ выражения недоверия властям.Такие врачи действительно могут быть «солдатами системы», принудительно работать внутри нее и подчиняться ее правилам, как это должны делать военные, но это не означает некритическое принятие системы такой, какая она есть, ни ее правил. Новая «правовая пустота», созданная правительством, отсутствие прозрачности в действиях властей и недоверие к официальной информации о реальной ситуации с этой пандемией становятся причинами нежелания и несогласия — для колебаний с оттенком недоверия — придерживаться меры системы здравоохранения (Somparé and Somparé 2018: 130). Таким образом, я утверждаю, что пандемия как ситуация с высокими рисками и неопределенностью выявляет и высвечивает многочисленные скрытые конфликты, в которых недоверие уже давно играет важную роль в российском контексте. Этот плотный клубок проблем можно было бы распутать, если бы и врачи, и женщины отказались бы от обычной стратегии неформального решения своих конкретных проблем и перешли к систематической стратегии решения проблем, которая включала бы публичные выступления, укрепление профессиональных, пациентских и женских организаций и создание новые практики солидарности и доверия между практикующими врачами и пациентами.Таким образом, врачи с помощью женщин-активисток могут превратиться в преобразователей системы, а не в ее «солдат».

Список собеседников

1. Интервью 1а. Н., врач акушер-гинеколог государственного родильного дома. Москва, 24 марта.

2. Интервью 1б. Н., врач акушер-гинеколог государственного родильного дома. Москва, 5 августа.

3. Интервью 2. В., врач акушер-гинеколог, частный родильный дом. Москва, 26 марта.

4.Интервью 3. А, врач акушер-гинеколог, государственный родильный дом. Москва, 30 марта.

5. Интервью 4. Э., врач акушер-гинеколог, государственный родильный дом. Санкт-Петербург, 10 июля.

6. Интервью 5. О., врач акушер-гинеколог, медцентр. Москва, 13 июля.

7. Интервью 6. С., врач акушер-гинеколог, заведующий государственным роддомом. Уральский регион, 9 августа.

8. Интервью 7. Т., акушерка, государственный родильный дом. Сибирский край, 17 августа.

9. Интервью 8a. М., доула. Москва, 20 марта.

10. Интервью 8б. М., доула. Москва, 8 мая.

11. Интервью 9. К., роды во время пандемии COVID-19. Санкт-Петербургская область. 11 июля, 14 августа.


1. 36 роддом [роддом 36]. Коронавирус и беременность. Facebook, 1 апреля. Https://www.facebook.com/36roddom/posts/290


2. доктор Якунин. Как сейчас родить здорового малыша? Пост в Instagram 1, 20 апреля. https://www.instagram.com/p/B_M5KsUAgyJ/.

3. доктор Якунин. Сообщение в Instagram 2, 21 июля. Https://www.instagram.com/p/CC57ul5gNhh/.

4. доктор Якунин. Пост в Instagram 3, 24 июля. Https://www.instagram.com/p/CDA3BpJAAqX/.

Заявление о доступности данных

Наборы данных, представленные в этой статье, недоступны, потому что эта статья основана на интервью, которое я провел с 11 акушерами-гинекологами, двумя акушерками, двумя перинатальными психологами, работающими в родильных домах, 6 акушерками на дому, 12 доулами, и 14 женщин, родивших во время пандемии.В целях анонимности все личные имена и названия родильных домов не приводятся. Все материалы хранятся в моем личном архиве. Запросы на доступ к наборам данных следует направлять Анне Ожигановой, [email protected]

Заявление об этике

Этическая экспертиза и одобрение не требовалось для исследования на людях в соответствии с местным законодательством и институциональными требованиями. Письменное информированное согласие на участие не требовалось для этого исследования в соответствии с национальным законодательством и институциональными требованиями.Устное информированное согласие на участие в исследовании и публикацию результатов было получено от всех участников.

Вклад авторов

Автор подтверждает, что является единственным соавтором этой работы, и одобрил ее для публикации.

Конфликт интересов

Автор заявляет, что исследование проводилось в отсутствие каких-либо коммерческих или финансовых отношений, которые могут быть истолкованы как потенциальный конфликт интересов.


1 Этическое одобрение и письменное информированное согласие на участие не требовалось для исследования участников-людей в соответствии с законодательством Российской Федерации и требованиями учреждений.Устное информированное согласие на участие в исследовании и на публикацию результатов было получено от всех участников.


Дэвис-Флойд, Р. (2003). Рождение как американский обряд . Беркли, Калифорния: Калифорнийский университет Press.

Дэвис-Флойд, Р., Гатшоу, К., и Шварц, Д. А. (2020). Беременность, роды и пандемия COVID-19 в США. Med. Антрополь. 39 (5), 413–427. doi: 10.1080 / 01459740.2020.1761804

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Дэвис-Флойд, Р.(2018). «Технократическая, гуманистическая и целостная парадигмы родовспоможения и здравоохранения», в «Способы узнать о рождении: матери, акушерки, медицина и активизм в сфере родовспоможения», Дэвис-Флойд R . Лонг-Гроув, Иллинойс: Waveland Press, 3–44.

Google Scholar

FOM (2019). О врачах и качестве медицинской помощи. Как доступность медицинской помощи, квалификация врачей и оборудование медицинских учреждений? Доступно по ссылке: https://fom.ru/Zdorove-isport/12346 [на русском языке].

Google Scholar

Фукуяма, Ф. (1996). Доверие: социальные добродетели и создание процветания . Нью-Йорк, Нью-Йорк: Свободная пресса.

Карасева А. (2020). Юридическая пустота и управление COVID ‐ 19. Soc. Антрополь. 28 (2), 294–295. doi: 10.1111 / 1469-8676.12825

CrossRef Полный текст | Google Scholar

Литвина Д., Новкунская А., Темкина А. (2020). Множественные уязвимости в медицинских учреждениях: невидимые страдания врачей. Общества 10 (5), 5. doi: 10.3390 / soc10010005

CrossRef Полный текст | Google Scholar

Mühlfried, F. (2018). «Вступление. приблизительное недоверие », В Недоверие: этнографические приближения . Редактор Ф. Мюльфрид. (Бейлефельд, Германия: Transcript Verlag), 7–22.

Google Scholar

Ожиганова А. (2020). Авторитетные знания о родах и акушерстве: анализ дискурсивных практик российских перинатальных специалистов. Popu. Эко. 4 (4), 84–99. doi: 10.3897 / popecon.4.e57267

CrossRef Полный текст | Google Scholar

Ожиганова А. (2019). «Чего хотят женщины»: мотивы отказа от роддома в пользу домашних родов. Монит. Общественное мнение .: Эко. и Soc. Чан. 2, 263–281. doi: 10.14515 / monitoring.2019.2.12

CrossRef Полный текст | Google Scholar

Somparé, A. W., and Somparé, E. B. (2018). «Недоверие во время эпидемии Эболы в Гвинее», в г. Недоверие: этнографические приближения .Редактор Ф. Мюльфрид (Бейлефельд, Германия: Transcript Verlag), 129–145.

Google Scholar

Темкина, А. (2017). «Экономика доверия» в коммерческой акушерской помощи: образованные городские женщины как потребители и пациенты. Журнал экономической социологии 18 (3), 14–53. doi: 10.17323 / 1726-3247-2017-3-14-53

CrossRef Полный текст | Google Scholar

IJERPH | Бесплатный полнотекстовый | Летальный исход лептоспироза на юге России: характеристика допросов лептоспир, выделенных от умершего подростка


Лептоспироз — острое зоонозное заболевание, вызываемое патогенными спирохетами рода Leptospira [1]. Это широко распространенная инфекция, поражающая домашних и диких животных, а также человека [2]. По оценкам, лептоспирозом заражается более миллиона человек, а ежегодная смертность составляет 60 000 случаев [3,4]. Такая высокая заболеваемость и высокая смертность делают его одним из ведущих зоонозных инфекционных заболеваний. Исследователи из разных стран отметили значительную заниженную диагностику лептоспироза.Коста и др. В 2015 году утверждали, что реальная частота лептоспироза в шесть раз выше, чем официально сообщается [4]. По оценкам одного исследования, лептоспироз составляет от 20 до 50% лихорадок неизвестной этиологии [5]. Существенная заниженная диагностика лептоспироза и недооценка его заболеваемости приводит к недостаточной бдительности врачей и неправильной диагностике с трагическими последствиями. Глобальное изменение климата может создать новые угрозы для здоровья человека и привести к серьезным проблемам со здоровьем [6].Он уже вызвал заметное потепление в высокоширотных регионах России с отчетливым восходящим трендом между 60 и 80 градусами широты [7]. Интенсивность этих изменений в России превышает мировые тенденции, особенно в российской Арктике, где этот эффект даже более значительный, чем в любой другой части страны [8]. Изменение климата в северной части европейской части России приводит к смещению границы леса на север, так что тайга может заменить тундру, что приводит к расширению ареала и увеличению популяции мелких диких млекопитающих, которые служат основными резервуарами. зоонозных инфекций, на долю которых приходится более 70% инфекций человека [9], включая лептоспироз.Недавние исследования продемонстрировали прогрессирование на север как эпизоотических, так и эпидемических проявлений зоонозных инфекций по всей России [10]. Примеры этих изменений включают вспышки зоонозных инфекций, включая лептоспироз, у северных оленей на севере европейской части России [11]. Страны Северной Европы, обеспокоенные потеплением климата, разработали свои планы действий, направленные на снижение рисков, связанных с изменением климата, которые представляют угрозу для здоровья населения [12]. Помимо экстремальных погодных и климатических условий, антропогенных воздействий, таких как военные действия и резкие социально-экономические изменения, оказывающие значительное влияние на эпидемические проявления лептоспироза [13]. Заболеваемость лептоспирозом в Европе составила 0,2 случая на 100 000 человек; однако в последние годы в Нидерландах он резко увеличился, в основном из-за завозных случаев [14]. Согласно отчету Федеральной службы по надзору в сфере защиты прав потребителей и благополучия человека (http://rospotrebnadzor.ru/), в России средний показатель заболеваемости за пять лет (с 2007 по 2017 год) составил 0,2 случая на 100000 человек. [15]. Самая высокая заболеваемость лептоспирозом стабильно регистрируется в Южном, Центральном, Приволжском и Северо-Западном федеральных округах, расположенных в европейской части России, при этом показатель долгосрочной заболеваемости равен 1.7; 1,0; 0,8; 0,64 случая на 100 тыс. Населения в год. В целом около 97% случаев лептоспироза в России регистрируется на этих территориях [16,17].

В данной статье мы сообщаем о случае тяжелого лептоспироза со смертельным исходом, произошедшем в Ростовской области Южного федерального округа России, и об исследовании биологического профиля штамма лептоспир, выделенного от пациента, с использованием молекулярной генетики и масс. спектрометрия.

2. Изложение клинического случая

В августе 2018 г. у ранее здорового 14-летнего подростка мужского пола появились лихорадка, кашель и насморк, которые проявились после возвращения из летнего лагеря, расположенного недалеко от города Таганрог в Ростовской области России (рис. 1).Пациент проходил симптоматическое лечение лихорадки парацетамолом. Однако его симптомы не исчезли. К пятому дню у пациента продолжалась лихорадка и появились другие симптомы, включая боль в животе, головные боли, изжогу, рвоту, диарею, желтуху, приливание конъюнктивы и темную мочу. Он был госпитализирован в областную больницу с предварительным диагнозом вирусный или токсический гепатит. При осмотре пациент выглядел фебрильным, тахипноэ, бледным, гемодинамически стабильным. В этот момент брюшная полость и неврологические исследования были нормальными, хотя было отмечено умеренное увеличение размера печени.Несмотря на клинические проявления лептоспироза, он не был диагностирован, и было начато симптоматическое лечение (внутривенное введение физиологического раствора с дротаверином 2,0% и парацетамолом). На шестой день от начала у пациента развилось желудочно-кишечное кровотечение с гематемезисом (рвота кровью; до 1 л), и была обнаружена тяжелая диссеминированная внутрисосудистая коагуляция. Вскоре после этого он умер от недостаточности кровообращения.

Данные патологоанатомических исследований выявили острый гепатит неизвестной этиологии (вирусный или токсический), осложненный желудочно-кишечным кровотечением, острую постгеморрагическую анемию, геморрагический шок, тяжелую диссеминированную внутрисосудистую коагуляцию и недостаточность кровообращения.Были взяты образцы тканей (кишечника, селезенки, печени, легких и головного мозга) и отправлены в вирусологическую лабораторию Центра гигиены и эпидемиологии в Ростове на ПЦР-анализ для выявления патогенов бактериальной и вирусной этиологии.

Ткани кишечника были отрицательными в отношении Shigella spp., Энтероинвазивной Escherichia coli (EIEC), Salmonella spp., Термофильных Campylobacter spp., Аденовирусов группы F и ротавирусов группы A, норовируса генотипа 2 и астровирусов с использованием набора All-screen-Fl (B -45, AmpliSens, Москва, Россия), а также для энтеровирусов с использованием набора Enterovirus-Fl (R-V16-F, AmpliSens, Москва, Россия). Ткань легких была отрицательной на респираторно-синцитиальный вирус человека (HRSV), метапневмовирус человека (HMPV), вирус парагриппа-1-4 (HPIV), OC43, E229, NL63 и HKUI, коронавирусы человека (HCoV), риновирус человека (HRV), человеческий Аденовирусы B, C и E (HAdV) и бокавирус человека (HBoV) с использованием набора ARVI-screen-FRT (R-V57-100, AmpliSens, Москва, Россия). Ткань мозга была отрицательной на энтеровирусы с использованием набора Enterovirus-Fl (R-V16-F, AmpliSens, Москва, Россия). Ткань печени оказалась отрицательной на вирус гепатита С (ВГС), вирус гепатита В (ВГВ) и вирус гепатита А (ВГА) с использованием набора HCV / HBV / HIV-FRT и набора HAV-FRT (RV-50-CE и R- V4-CE, AmpliSens, Москва, Россия).Все диагностические тесты проводились в соответствии с инструкциями производителей. Образцы ткани легкого были отправлены в Санкт-Петербургский институт Пастера (Санкт-Петербург, Россия) для дальнейшей лабораторной диагностики.

Исследование было оценено и одобрено местным этическим комитетом Института Пастера, Санкт-Петербург, Россия.

Представители умершего дали информированное согласие на публикацию результатов исследования.

3. Материалы и методы

3.1. Выделение лептоспир

Leptospira из легочной ткани размножали при 28 ° C в жидкой среде, содержащей 80% H 2 O, 10% PBS и 10% инактивированной кроличьей сыворотки (R4505-500ML, Sigma-Aldrich, США) в условиях контроль темнопольной микроскопии. Второе пассирование проводили на восьмой день, и конечная плотность клеток 107 клеток на миллилитр была достигнута на тринадцатый день культивирования. Полученная плотность клеток подходила для серологического исследования, масс-спектрометрии и высокопроизводительного секвенирования.

3.2. Микроскопический тест агглютинации (MAT)

MAT использовали для определения серогруппы изолята с использованием агглютинирующих сывороток (Армавирская биофабрика, Армавир, Россия), содержащих антитела против лептоспир следующих серологических групп: Icterohaemorrhagiae, Javanica, Canicola, Fallomonais, , Grippotyphosa, Sejroe, Bataviae и Tarassovi.

3.3. Молекулярное определение Leptospira
. Общую ДНК экстрагировали из легочной ткани с использованием мини-набора QiaAmp DNA (Qiagen, Германия) в соответствии с инструкциями производителя.Leptospira была обнаружена с использованием фрагментов главного гена липопротеинов внешней мембраны (LipL32). ПЦР была проведена для амплификации конкретной области LipL32 с использованием праймеров LipL32F (ACTCTTTGCAAGCATTACCGC) и LipL32R (AGCAGACCAACAGATGCAACG) [18]. В качестве положительного контроля использовали ДНК штамма L. interrogans RGA (коллекция Санкт-Петербургского института Пастера), а в качестве отрицательного контроля — деионизированную воду.

ПЦР-реакций проводили на термоциклере Veriti (ThermoFisher Scientific, США), а ампликоны контролировали с помощью гель-электрофореза.Конечный продукт ПЦР очищали с помощью набора для экстракции гелей MiniElute (Qiagen, Германия), секвенировали методом Сенгера на секвенаторе ABI-Prism 3500 XL (Applied Biosystems, США) и анализировали с помощью BLAST NCBI.

3.4. Матричная лазерная десорбционная ионизация — времяпролетная масс-спектрометрия (MALDI-TOF MS)
Образцы клеток исследуемого изолята получали экстракцией этанолом и муравьиной кислотой. Спектры получены в линейном режиме на масс-спектрометре Microflex LRF (Bruker Daltonics GmbH, Германия) в диапазоне m / z = 2–20 кДа с использованием α-циано-4-гидроксикоричной кислоты в качестве матрицы.Идентификацию изолята проводили путем сравнения полученного масс-спектра с основными спектральными профилями (MSP) десяти референсных штаммов Leptospira для MAT (из коллекции Санкт-Петербургского института Пастера). Собственная база данных MSP была создана ранее [19] и экспортирована в основную таксономическую библиотеку эталонных спектров программного обеспечения «Биотипер 3.1» (Bruker Daltonics GmbH, Германия). Идентификация проводилась по коэффициентам совпадения спектральных пиков изолята и эталонных штаммов (логарифм от общего значения совпадающих пиков).Ранее мы предложили значение коэффициента> 2,1 в качестве критерия для идентификации штаммов Leptospira на уровне сероваров [19].
3.5. Подготовка библиотеки и секвенирование

Библиотека для высокопроизводительного секвенирования была приготовлена ​​из 1 мкг геномной ДНК с использованием набора для подготовки образцов ДНК Nextera (Illumina; Сан-Диего, Калифорния, США) и секвенирована на платформе MiSeq с использованием набора реагентов версии 2 (Illumina ; Сан-Диего, Калифорния, США).

3.6. Анализ данных высокопроизводительного секвенирования.
Необработанные чтения, которые не отображались в сборке человеческого генома hg38, были обрезаны с помощью Trimmomatic [20] с использованием параметров HEADCROP: 20, SLIDINGWINDOW: 4: 25, MINLEN: 40 и CROP: 127.Сборка генома была выполнена с помощью SPAdes [21] с использованием k-мер размером 21 и 33 нуклеотидов. Для филогенетического анализа мы аннотировали все доступные готовые сборки L. interrogans с помощью Prokka [22], идентифицировали основные гены с помощью Roary [23], и построили филогенетическое дерево с Fasttree, используя полученное выравнивание [24]. Отображение чтения и вызов вариантов выполнялись с помощью Samtools [25] и Bcftools [26] с использованием параметров по умолчанию. Мы подтвердили все варианты звонков вручную.

4. Результаты

Патоген был выделен, размножен и идентифицирован как L.interrogans серогруппы Icterohaemorrhagiae с помощью МАТ и назван Таганрог-2018.

Спектр белков Таганрога-2018, полученный с помощью MALDI-TOF MS, сравнивали с MSP эталонных штаммов Leptospira spp. (Таблица 1). Наивысший балл совпадения (2,152) был получен для MSP L. interrogans serovar Copenhageni st. M20, что указывает на то, что изолят можно отнести к серогруппе Icterohaemorrhagiae и, возможно, к серовару Copenhageni. Однако оценка MSP непатогенных L.biflexa серовар Patoc (2,149) был очень близок. Как показано на рисунке 2, разница между двумя спектрами MALDI была в основном из-за разницы в интенсивности идентичных пиков (рисунок 2A). Спектры образцов сформировали кластеры пиков в диапазоне молекулярных масс m / z = 3000–3500 Да (Рисунок 2B). Молекулярные массы кластерных максимумов составляли m / z = 3209,5 Да для изолята и m / z = 3301,7 Да для серовара Patoc, т.е. сравниваемые образцы имели относительный сдвиг кластерного пика на 92 Да.

Результат генотипирования с использованием последовательности LipL32 показал, что изолят принадлежал к патогенным лептоспирам.

Этот проект «Полностью геномный дробовик» депонирован в DDBJ / ENA / GenBank под регистрационным номером SJDW00000000. В этом документе описывается версия SJDW01000000. Бактериальный геном был собран в контиги общей длиной 4,5 Мбит / с, значением N50 21911 п.н. и содержанием GC 35%.

Филогенетический анализ (рисунок 3) показал, что штамм L. interrogans Таганрог-2018 находится в той же кладе, что и штамм L. interrogans serovar Copenhageni Fiocruz L1-130 (GCF_000007685.1) и L.interrogans серовар Copenhageni штамм FDAARGOS_203 (GCF_002073495.2), две независимые сборки одного и того же штамма Fiocruz L1-130. Мы выбрали последнюю сборку для вызова варианта, потому что она имела немного более высокую среднюю нуклеотидную идентичность по сравнению с нашим штаммом. Контрольные последовательности имели длину 4,63 Мбит / с, что означало, что наша сборка покрывала приблизительно 97% контрольного генома. Обращение к варианту выявило, что штамм L. interrogans Таганрог-2018 имел 18 SNP и 8 инделей с высоким качеством (QUAL> 35) по сравнению с референсным геномом.Генетические вариации, обнаруженные у штамма Таганрог-2018 относительно эталона, представлены в таблице S1 (формат файла vcf).

5. Обсуждение

Проблемы диагностики лептоспироза широко известны. Стандартные лабораторные методы диагностики, включая культивирование Leptospira и микроскопические тесты агглютинации (MAT), — это трудоемкие процедуры, требующие квалифицированного персонала с достаточным опытом [27]. Правильное лабораторное тестирование на лептоспироз не проводится почти в 50% подозреваемых случаев [4] из-за сложности обычных диагностических тестов [5], а необходимость в быстрых, дешевых и точных диагностических инструментах подчеркивается во многих исследованиях [28, 29,30,31,32,33,34,35]. Эти проблемы присутствуют и в южных регионах России, где географические и климатические особенности создают благоприятные условия для циркуляции лептоспироза и создают проблемную эпидемиологическую ситуацию [36]. Тем не менее, тема лептоспироза в России серьезно недооценивается в научной литературе по двум основным причинам. Во-первых, большинство статей по этой теме написано на русском языке, а иногда они недоступны в Интернете. Во-вторых, почти все авторы используют классические микробиологические методы, редко используют какую-либо технологию секвенирования.Единственное исключение — статья Ворониной и др. [37], где авторы использовали схему MLST для определения наиболее частых типов последовательностей Leptospira в России и применили пиросеквенирование 454 для выполнения полногеномного секвенирования. Однако большинство штаммов из исследуемой коллекции были изолированы в других странах, и авторы не сообщают о какой-либо полногеномной сборке штаммов Leptospira, выделенных в России. В данном исследовании мы использовали различные методы типирования для идентификации штамма L. interrogans Таганрог. -2018, включая MAT, MALDI-TOF MS, генотипирование (с использованием последовательности LipL32) и полногеномное секвенирование.Все использованные методы дали согласованные результаты. Методы молекулярного типирования показали самое высокое разрешение, с аналогичными результатами при использовании фрагментного анализа и высокопроизводительного секвенирования. Установлено, что штамм Таганрог-2018 относится к серовару Copenhageni серогруппы Icterohaemorrhagiae L. interrogans. Мы предполагаем, что ПЦР, нацеленная на LipL32, может использоваться в качестве альтернативы классическим микробиологическим методам обнаружения патогенных Leptospira spp. Наши результаты демонстрируют возможность обнаружения лептоспир с помощью ПЦР, о которой ранее сообщали Barocchi et al.и Jose et al. [38,39].

Мы применили масс-спектрометрию MALDI-TOF с использованием собственной библиотеки эталонных спектров штаммов Leptospira для идентификации изолята Taganrog-2018 и классифицировали его серовар как Copenhageni. Однако мы наблюдали высокий балл совпадения спектров нашего изолята и серовара Patoc. Это можно объяснить наличием в их спектрах идентичных пиков консервативных рибосомных белков. В то же время анализ спектрального диапазона молекулярных масс m / z = 3000–3500 Да выявил наличие колоколообразного кластера пиков, что характерно для линейных полисахаридов при отщеплении их моносахаридных звеньев.Разница, равная m / z = 92 Да, между кластерными максимумами изолята и св. Паток можно отнести к молекулярным массам трех атомов углерода, трех атомов водорода и их гидроксилов в молекулах моносахаридов. Таким образом, использование одной только оценки совпадения не позволило однозначно идентифицировать серовар изолята. Тем не менее, ручной анализ пиков полисахаридных кластеров, которые образовались в масс-спектрах лептоспир в низкомолекулярном диапазоне, позволил различить серовары лептоспир, которые имеют эпидемиологическое значение, поскольку они в основном связаны с определенным типом хозяина. и, таким образом, может использоваться для выявления возможных резервуаров инфекции.Мы показываем, что масс-спектрометрия MALDI-TOF потенциально может быть использована для этой цели.

Филогенетический анализ выявил тесную связь между штаммом L. interrogans Taganrog-2018 и L. interrogans Fiocruz L1-130, которые представлены в GenBank как две независимые законченные сборки генома (GCF_000007685.1 и GCF_002073495.2). Последний штамм, выделенный от пациента во время вспышки лептоспироза в 1996 г. [38], широко распространен в Бразилии. В недавней работе Jaeger et al. [40] провели молекулярную идентификацию нескольких L.interrogans, выделенные более десяти лет назад от крыс и собак, путем секвенирования гена домашнего хозяйства secY, ранее предложенного для типирования лептоспир из-за его вариабельности [41], и обнаружили, что все последовательности были на 100% идентичны между собой и штаммом L. interrogans Fiocruz L1-130. Штамм L. interrogans Таганрог-2018 имеет один SNP в гене secY (Таблица S1), что позволяет отличить его от штаммов, выделенных от бразильских крыс и собак, но ограничения нашего исследования не позволяют сделать какие-либо существенные выводы о возникновении Виды Leptospira: насколько нам известно, мы представляем первую полногеномную сборку Leptospira interrogans, изолированную в России. Дальнейшие исследования с использованием новейших технологий NGS позволят нам получить представление о филогенетике и определить основные клональные популяции Leptospira, циркулирующие в России.

6. Выводы

Лептоспироз — один из самых распространенных зоонозов в мире. Заболеваемость лептоспирозом в России носит единичный характер, и врачи должны учитывать эту инфекцию при дифференциальной диагностике пациентов с лихорадкой, особенно в теплое время года. В описанном случае диагностическая ошибка была фатальной.Мы выделили патогенный штамм L. interrogans serovar Copenhageni и использовали несколько диагностических и исследовательских методов для его изучения. Обычные классические методы сложны и требуют выращивания большого количества сероваров Leptospira и квалифицированного персонала с достаточным опытом. Мы предлагаем реакцию ПЦР, направленную на LipL32, в качестве метода, который повысит скорость и качество лабораторной диагностики лептоспироза и масс-спектрометрического анализа, основанного на определении олигосахаридных субъединиц лептоспиральных О-антигенов, как метод, который позволит идентифицировать бактериальные серовар и, следовательно, вероятный источник инфекции.

Мы также выполнили полногеномное секвенирование полученного штамма, что позволило нам сообщить о первой полногеномной сборке L. interrogans, выделенных в России.

Дополнительные материалы

Следующая информация доступна в Интернете по адресу https://www.mdpi.com/1660-4601/17/12/4238/s1, Таблица S1: Генетические вариации, обнаруженные в штамме Таганрог-2018 относительно геномной сборки GCA_002073495.2 (Leptospira interrogans серовар Copenhageni штамм FDAARGOS_203).

Вклад авторов

Концептуализация, Н.К. и A.V.S .; методология, N.K.T. и E.V.Z .; валидация, E.V.Z. и Ю.В.О .; формальный анализ, A.E.S. и Ю.В.О .; расследование, N.A.S., Y.A.P., E.B.Z., Y.V.O. и D.E.V .; ресурсы, E.V.K., A.R.L. и A.U.G .; курирование данных, A.E.S. и E.V.Z .; письменная — подготовка оригинального проекта, В.Г.Д .; написание — просмотр и редактирование, A.E.S. и N.A.S .; надзор, V.G.D., K.K., A.V.S. и B.E .; администрация проекта, V.G.D. и быть. Все авторы прочитали и согласились с опубликованной версией рукописи.


Исследование финансировалось за счет грантов Института Пастера (Париж, Франция): PTR 2017-сессия 20-PTR 30-2017.


Авторы выражают огромную благодарность Софье Григорьевне Некрасовой за помощь в выделении штамма Leptospira. Авторы выражают признательность за сотрудничество и поддержку Центру передового опыта северных стран Clinf, финансируемому Nordforsk.

Конфликт интересов

Авторы заявляют, что у них нет конкурирующих интересов.


  1. De Brito, T .; Да Силва, A.M.G .; Абреу П. Патология и патогенез лептоспироза человека: обзор с комментариями.Revista do Instituto de Medicina Tropical de São Paulo 2018 , 60. [Google Scholar] [CrossRef] [PubMed]
  2. Adler, B .; Moctezuma, A.D.L.P. Лептоспира и лептоспироз. Veter- Microbiol. 2010 , 140, 287–296. [Google Scholar] [CrossRef] [PubMed]
  3. Пикардо, М. Лептоспироз: обновление глобальной картины зарождающейся забытой болезни. PLOS Заброшенная тропа. Dis. 2015 , 9, e0004039. [Google Scholar] [CrossRef] [PubMed]
  4. Costa, F.; Hagan, J.E .; Calcagno, J .; Кейн, М .; Torgerson, P .; Мартинес-Сильвейра, M.S .; Stein, C .; Abela-Ridder, B .; Ко, А. Глобальная заболеваемость и смертность от лептоспироза: систематический обзор. PLOS Заброшенная тропа. Dis. 2015 , 9, e0003898. [Google Scholar] [CrossRef]
  5. Crump, J.A .; Morrissey, A.B .; Nicholson, W.L .; Massung, R.F .; Stoddard, R.A .; Galloway, R.L .; Ooi, E.E .; Маро, В.П .; Saganda, W .; Kinabo, G.D .; и другие. Этиология тяжелой немалярийной фебрильной болезни в Северной Танзании: проспективное когортное исследование.PLOS Заброшенная тропа. Dis. 2013 , 7, e2324. [Google Scholar] [CrossRef]
  6. Wu, X .; Lu, Y .; Чжоу, S .; Chen, L .; Сюй Б. Воздействие изменения климата на инфекционные заболевания человека: эмпирические данные и адаптация человека. Environ. Int. 2016 , 86, 14–23. [Google Scholar] [CrossRef]
  7. Kerschengoltz, B.M .; Чернявский, В.Ф .; Репин, В.Е .; Никифоров, О.И.; Софронова, О. Обзор влияния глобальных климатических изменений на реализацию инфекционного потенциала населения в арктических регионах России (на примере Якутии).Ekol. Человека / Хум. Ecol. 2009 , 6, 34–39. [Google Scholar]
  8. Revich, B.A .; Токаревич, Н .; Паркинсон, А.Дж. Изменение климата и зоонозные инфекции в Российской Арктике. Int. J. Циркумполярное лечение. 2012 , 71, 147. [Google Scholar] [CrossRef]
  9. Jones, G .; Patel, N .; Леви, М .; Сторигард, А .; Балк, Д .; Gittleman, J.L .; Дашак П. Глобальные тенденции возникновения инфекционных заболеваний. Nat. 2008 , 451, 990–993. [Google Scholar] [CrossRef]
  10. Токаревич Н.; Стоянова, Н .; Гнатив, Б .; Казаковцев, С .; Блинова, О .; Ревич Б.В. Серораспространенность клещевых заболеваний среди населения Европейского Севера России. Med. Saf. Glob. Здоровье. 2017 . [Google Scholar] [CrossRef]
  11. Казановский, Е.С .; Карабанов, В.П .; Клебенсон, К. Ветеринарные проблемы оленеводства Европейского Севера России. Русь. J. Parasitol. 2016 , 37, 332–336. [Google Scholar]
  12. Parkinson, A.J .; Evengård, B .; Semenza, J.C .; Огден, Н.; Børresen, M.L .; Berner, J .; Brubaker, M .; Sjöstedt, A .; Evander, M .; Hondula, D.M .; и другие. Изменение климата и инфекционные болезни в Арктике: создание циркумполярной рабочей группы. Int. J. Циркумполярное лечение. 2014 , 73, 863. [Google Scholar] [CrossRef]
  13. Токаревич, Н.К .; Стоянова Н.А.Эпидемиологические аспекты антропогенного влияния на развитие лептоспироза. Русь. J. Infect. Иммун. 2014 , 1, 67. [Google Scholar] [CrossRef]
  14. De Vries, S.ГРАММ.; Bekedam, M.M .; Visser, B.J .; Stijnis, C .; Van Thiel, P.P .; Van Vugt, M .; Goorhuis, A .; Wagenaar, J. F.P .; Grobusch, M.P .; Горис, М.Г.А. Лептоспироз, связанный с путешествиями, в Нидерландах, 2009–2016 гг .: эпидемиологический отчет и серия случаев. Travel Med. Заразить. Dis. 2018 , 24, 44–50. [Google Scholar] [CrossRef] [PubMed]
  15. Официальный сайт Федеральной службы по надзору в сфере защиты прав потребителей и благополучия человека, Государственный отчет «О состоянии санитарно-эпидемиологического благополучия населения в Российской Федерации в 2017 году» ».Доступно на сайте: http://rospotrebnadzor.ru/upload/iblock/d9d/gd_2017_seb.pdf (дата обращения 13 июня 2020 г.).
  16. Топорков В.П .; Величко, Л. Динамика заболеваемости лептоспирозами в федеральных округах Российской Федерации. Пробл. Часть. Опасность. Заразить. 2008 , 22–25. [Google Scholar] [CrossRef]
  17. Бренева, Н.В .; Балахонов, С.В. Эндемичность и энзоотичность лептоспироза. Журнал Микробиол. Эпидемиол. I Immunobiol. 2019 , 118–125. [Google Scholar] [CrossRef]
  18. Ахмед, С.А .; Sandai, D.A .; Musa, S .; Hoe, C.H .; Риадзи, М .; Lau, K.L .; Тан, Т. Быстрая диагностика лептоспироза с помощью мультиплексной ПЦР. Малайский. J. Med. Sci. 2012 , 19, 9–16. [Google Scholar] [PubMed]
  19. Zyeva, E.V .; Стоянова, Н.А .; Токаревич, Н.К .; Тотолян, А.А. Идентификация сероваров Leptospira с помощью масс-спектрометрии MALDI-TOF. Журнал Микробиол. Эпидемиол. I Immunobiol. 2017 , 42–49. [Google Scholar] [CrossRef]
  20. Bolger, A.M .; Lohse, M .; Usadel, B. Trimmomatic: гибкий триммер для данных последовательности Illumina.Биоинформатика 2014 , 30, 2114–2120. [Google Scholar] [CrossRef] [PubMed]
  21. Банкевич, А .; Нурк, С .; Антипов, Д .; Гуревич, А .; Дворкин, М .; Куликов, А .; Лесин, В.М .; Николенко, С.И .; Pham, S .; Prjibelski, A.D .; и другие. SPAdes: новый алгоритм сборки генома и его приложения для секвенирования отдельных клеток. J. Comput. Кипятить. 2012 , 19, 455–477. [Google Scholar] [CrossRef] [PubMed]
  22. Seemann, T. Prokka: Быстрая аннотация прокариотического генома. Биоинформатика 2014 , 30, 2068–2069.[Google Scholar] [CrossRef] [PubMed]
  23. Page, A.J .; Cummins, C .; Хант, М .; Вонг, В.К .; Reuter, S .; Holden, M.T.G .; Fookes, M .; Falush, D .; Keane, J.A .; Parkhill, J. Roary: Быстрый крупномасштабный анализ генома прокариот. Биоинформатика 2015 , 31, 3691–3693. [Google Scholar] [CrossRef] [PubMed]
  24. Price, M.N .; Dehal, P.S .; Аркин, А.П. FastTree: Вычисление больших деревьев минимальной эволюции с профилями вместо матрицы расстояний. Мол. Кипятить. Evol. 2009 , 26, 1641–1650.[Google Scholar] [CrossRef] [PubMed]
  25. Li, H .; Handsaker, B .; Wysoker, A .; Fennell, T .; Ruan, J .; Гомер, Н .; Marth, G .; Abecasis, G.R .; Durbin, R .; Подгруппа по обработке данных проекта «1000 Genome». Формат Sequence Alignment / Map и SAMtools. Биоинформатика 2009 , 25, 2078–2079. [Google Scholar] [CrossRef] [PubMed]
  26. Danecek, P .; McCarthy, S.A. BCFtools / csq: последствия вариантов с учетом гаплотипов. Биоинформ. 2017 , 33, 2037–2039. [Google Scholar] [CrossRef]
  27. Chappel, R.J .; Горис, М .; Palmer, M.F .; Хартскерл, Р.А. Влияние квалификационного тестирования на результаты микроскопического теста агглютинации для диагностики лептоспироза. J. Clin. Microbiol. 2004 , 42, 5484–5488. [Google Scholar] [CrossRef] [PubMed]
  28. Ismail, T.F .; Hatem, M.E .; Мюррей, К.К .; Pimentel, G .; Wasfy, M.O .; El-Sayed, N .; Самир, А .; Абдул-Рахман, Б .; Абдель-Максуд, М .; Klena, J .; и другие. Ретроспективное серологическое исследование лептоспироза среди пациентов с острым фебрильным заболеванием и гепатитом в Египте.Являюсь. J. Trop. Med. Hyg. 2006 , 75, 1085–1089. [Google Scholar] [CrossRef]
  29. Reller, M.E .; Wunder, E.A .; Майлз, Дж. Дж .; Flom, J.E .; Майорга, О .; Woods, C.W .; Ko, A.I .; Dumler, J.S .; Матуте, А.Дж. Лептоспироз, не вызывающий подозрений, является причиной острого лихорадочного заболевания в Никарагуа. PLOS Заброшенная тропа. Dis. 2014 , 8, e2941. [Google Scholar] [CrossRef]
  30. Mayxay, M .; Castonguay-Vanier, J .; Chansamouth, V .; Dubot-Pérès, A .; Paris, D.H .; Phetsouvanh, R .; Тангхабуанбутра, Дж.; Douangdala, P .; Inthalath, S .; Souvannasing, P .; и другие. Причины немалярийной лихорадки в Лаосе: проспективное исследование. Ланцет Глоб. Лечить. 2013 , 1, e46 – e54. [Google Scholar] [CrossRef]
  31. Mueller, T.C .; Siv, S .; Хим, Н .; Kim, S .; Fleischmann, E .; Ariey, F .; Buchy, P .; Guillard, B .; González, I.J .; Christophel, E.-M .; и другие. Острая недифференцированная лихорадочная болезнь в сельских районах Камбоджи: 3-летнее проспективное обсервационное исследование. PLOS ONE 2014 , 9, e95868. [Google Scholar] [CrossRef]
  32. Гасем, М.ЧАС.; Wagenaar, J.F.P .; Горис, М.Г .; Adi, M.S .; Isbandrio, B.B .; Hartskeerl, R.A .; Rolain, J.-M .; Raoult, D .; Ван Горп, E.C. Мышиный тиф и лептоспироз как причины острой недифференцированной лихорадки, Индонезия. Emerg. Заразить. Dis. 2009 , 15, 975–977. [Google Scholar] [CrossRef] [PubMed]
  33. Kendall, E.A .; Galloway, R .; Breiman, R.F .; Bui, D.M .; Brooks, W.A .; Госвами, Д .; Larocque, R.C .; Ари, доктор медицины; Луби, С.П. Лептоспироз как причина лихорадки в городских районах Бангладеш. Являюсь. J. Trop. Med.Hyg. 2010 , 82, 1127–1130. [Google Scholar] [CrossRef] [PubMed]
  34. Suttinont, C .; Losuwanaluk, K .; Niwatayakul, K .; Hoontrakul, S .; Intaranongpai, W .; Silpasakorn, S .; Suwancharoen, D .; Panlar, P .; Saisongkorh, W .; Rolain, J.M .; и другие. Причины острого недифференцированного лихорадочного заболевания в сельской местности Таиланда: результаты проспективного обсервационного исследования. Анна. Троп. Med. Паразитол. 2006 , 100, 363–370. [Google Scholar] [CrossRef] [PubMed]
  35. Vincent, A.T .; Schiettekatte, О.; Goarant, C .; Neela, V.K .; Bernet, E .; Thibeaux, R .; Исмаил, Н .; Халид, M.K.N.M .; Amran, F .; Masuzawa, T .; и другие. Пересмотр таксономии и эволюции патогенности рода Leptospira через призму геномики. PLOS Заброшенная тропа. Dis. 2019 , 13, e0007270. [Google Scholar] [CrossRef] [PubMed]
  36. Василенко, Н.Ф .; Малецкая, О.В .; Manin, E.A .; Прислегина, Д.А .; Дубянский, В.М .; Шапошникова, Л.И .; Волынкина, А.С .; Лисицкая, Ю.В .; Котенев, Э.С.; Куличенко, А.Н. Эпизоотологический мониторинг природно-очаговых инфекций на Юге России в 2015 году. Журнал микробиол. Эпидемиол. I Immunobiol. 2017 . [Google Scholar] [CrossRef]
  37. Воронина, О.Л .; Kunda, M.S .; Аксенова Э.И.; Рыжова, Н.Н .; Семенов, А.Н .; Петров, Э.М.; Диденко, Л.В .; Лунин, В.Г .; Ананьина Ю.В.; Гинцбург А.Л. Характеристика вездесущих и уникальных штаммов лептоспир из коллекции Российского центра лептоспироза. BioMed Res. Int. 2014 , 1–15.[Google Scholar] [CrossRef]
  38. Barocchi, M.A .; Ko, A.I .; Ferrer, S.R .; Faria, M.T .; Reis, M.G .; Райли, Л. Идентификация нового повторяющегося элемента у Leptospira interrogans Serovar Copenhageni и его применение для дифференцировки серогрупп лептоспир на основе ПЦР. J. Clin. Microbiol. 2001 , 39, 191–195. [Google Scholar] [CrossRef]
  39. Mahadeviah, S.N .; Jose, L.R .; Баламуруган, В .; Кини, К. Оценка собственной полимеразной цепной реакции LipL32 для диагностики лептоспироза и ее корреляции с различными серологическими диагностическими методами.Indian J. Med. Microbiol. 2018 , 36, 385. [Google Scholar] [CrossRef]
  40. Jaeger, L.H .; Pestana, C.P .; Карвалью-Коста, Ф.А.; Medeiros, M.A .; Lilenbaum, W. Характеристика клональной субпопуляции Fiocruz L1-130 Leptospira interrogans у крыс и собак из Бразилии. J. Med. Microbiol. 2018 , 67, 1361–1367. [Google Scholar] [CrossRef]
  41. Ahmed, N .; Manjulata Devi, S .; de los Á Valverde, M .; Vijayachari, P .; Machang’u, R.S .; Ellis, W.A .; Хартскерл, Р.A. Метод мультилокусного типирования последовательностей для идентификации и генотипической классификации патогенных видов Leptospira. Анна. Clin. Microbiol. Антимикробный. 2006 . [Google Scholar] [CrossRef]

Рисунок 1. Местоположение города Таганрог в России (47 ° 14′10 ″ с.ш., 38 ° 53′48 ″ в.д.).

Рисунок 1. Местоположение города Таганрог в России (47 ° 14′10 ″ с.ш., 38 ° 53′48 ″ в.д.).

Рисунок 2. MALDI-TOF-спектры исследуемого изолята Таганрог-2018 и эталонного штамма L.biflexa Patoc I серовар Patoc. ( A ) Пики масс в диапазоне молекулярных масс m / z = 2000-20000 Да; ( B ) Кластер пиков в диапазоне m / z = 3000-3500 Да.

Рисунок 2. MALDI-TOF-спектры исследуемого изолята Таганрог-2018 и эталонного штамма L. biflexa Patoc I серовара Patoc. ( A ) Пики масс в диапазоне молекулярных масс m / z = 2000-20000 Да; ( B ) Кластер пиков в диапазоне m / z = 3000-3500 Да.

Рисунок 3. Филогенетическое дерево с центральными корнями всех доступных готовых геномов L. interrogans и нашей сборки. Названия сероваров и штаммов указаны на концах этикеток.

Рисунок 3. Филогенетическое дерево с центральными корнями всех доступных готовых геномов L. interrogans и нашей сборки. Названия сероваров и штаммов указаны на концах этикеток.

Таблица 1. Спектральное совпадение исследуемого штамма Leptospira со спектральными профилями 10 референсных штаммов Leptospira spp.представлена ​​в базе данных проекта MALDI Biotyper 3.1.

Таблица 1. Спектральное совпадение исследуемого штамма Leptospira со спектральными профилями 10 референсных штаммов Leptospira spp. представлена ​​в базе данных проекта MALDI Biotyper 3.1.

N Виды Оценка Сходство
1 L. interrogans sv. Копенгагени, ул. М 20 2.152 высокая
2 L.biflexa sv. Паток, ул. Patoc I L. bifl 2.149 высокий
3 L. interrogans sv. Icterohaemorrhagiae, ул. РГА 2.123 высокий
4 L. interrogans sv. Моздок ул. 5621 2.080 высокий
5 L. interrogans sv. Помона, ул. Помона 1.972 средний
6 L. interrogans sv. Seiroe st.M84 1.885 средний
7 L. interrogans sv. Гриппотифоза, ул. Москва В 1.850 средний
8 L. interrogans sv. Saxkoebing st. Mus24 1.817 средний
9 L. interrogans sv. Canicola st. Hond Utrecht IV 1.628 низкий
10 L.

Добавить комментарий

Ваш адрес email не будет опубликован. Обязательные поля помечены *