Роспотребнадзор рк: НОВОСТИ — Официальный сайт Роспотребнадзора

Роспотребнадзор

Содержание

РОСПОТРЕБНАДЗОР КОНТРОЛИРУЕТ КАЧЕСТВО И БЕЗОПАСНОСТЬ ПИТАНИЯ В ДЕТСКИХ КОЛЛЕКТИВАХ

Питание школьников требует самого пристального внимания. Правильно организованное питание учащихся в общеобразовательных организациях повышает их работоспособность, способствует укреплению здоровья.

Наблюдения показали, что дети, получающие горячее питание в условиях школы, меньше устают, у них на более длительный срок сохраняется высокий уровень работоспособности и выше успеваемость. В связи с этим в задачу медицинского и педагогического персонала школы входит добиваться 100% охвата школьников горячими завтраками. Для этого необходима систематическая разъяснительная работа среди детей и их родителей о роли и значении питания для сохранения и укрепления здоровья, повышения работоспособности, успеваемости и физической выносливости.

Установлено, что во время пребывания в школе суточные энергозатраты школьников младших классов в среднем составляют 2092-2510 Дж (500-600 ккал), среднего и старшего школьного возраста 2510-2929 Дж (600-700 ккал), что равно примерно суточной потребности в энергии и основных пищевых веществах.

Эти энергозатраты необходимо восполнять горячими школьными завтраками. В школах, в группах продленного дня дети должны получать завтрак и обед, а при длительном пребывании в школе – полдник.

За качество детского питания в каждой конкретной школе ответственным лицом выступает администрация, а именно – директор школы. Именно он подписывает договор с юридическими лицами, индивидуальными предпринимателями  обеспечивающими процесс кормления детей или поставку пищевой продукции в общеобразовательные организации. Директор обеспечивает все условия для осуществления этого процесса на должном уровне.

Контроль за работой общеобразовательных учреждений осуществляется Федеральной службой по надзору в сфере защиты прав потребителей и благополучия человека (Роспотребнадзор).

В настоящее время специалистами Территориального отдела Межрегионального  управления Роспотребнадзора в Республике Крым и г.Севастополю, согласно Приказу Федеральной службы по надзору в сфере защиты прав потребителей и благополучия человека от 16.

10.2020г. №723 «О проведении внеплановых проверок образовательных организаций и их поставщиков пищевых продуктов» осуществляются внеплановые выездные проверки по организации горячего питания в общеобразовательных организациях с проведением лабораторно-инструментальных  исследований.

Основными нарушениями, которые ТО по Джанкойскому району МУ Роспотребнадзора в РК и г.Севастополе выявил в ходе проверок, стали отсутствие производственного контроля, не соблюдение санитарно-гигиенических правил по содержанию помещений, отсутствие в медицинских книжках работников отметок о проведении профилактических прививок, отсутствие  сопроводительных документов и необходимой информации об изготовителе на пищевые продукты, а также нарушения условий хранения пищевой продукции и ряд других несоответствий санитарным нормам.

По результатам проверок составлены протоколы об административных правонарушениях в виде  штрафных санкций на должностных лиц общеобразовательных организаций.

Как попасть в Крым из других стран? | Часто задаваемые вопросы

В соответствии с Распоряжением российского правительства от 16. 03.2020 и Указом главы РК от 22 июля, въезд иностранных граждан на территорию РФ и в том числе на Крымский полуостров временно ограничен.

Так, гости из-за рубежа и без гражданства при пересечении границы РФ должны предоставить должностным лицам, осуществляющим санитарно-эпидемиологический надзор, медицинский документ (на русском или английском языке), подтверждающий отрицательный результат лабораторного исследования на COVID-19 методом ПЦР.

Ажиотажный спрос на Крым: Аксёнов назвал курортный сезон состоявшимся >>

А в случае его отсутствия – пройти это обследование на месте, в специализированной лаборатории, в течение трёх календарных дней с момента прибытия на полуостров. Документ, подтверждающий отрицательный результат, необходимо отправить в Межрегиональное управление Роспотребнадзора по РК и Севастополю на электронный адрес [email protected] в течение суток с момента получения.

При положительном результате необходимо соблюдать самоизоляцию, исключающую любые контакты со здоровыми людьми, и выполнять все предписания врачей – вплоть до полного выздоровления и получения отрицательных результатов исследования методом ПЦР.

Кроме того, работодатели обязаны обеспечить изоляцию на 14 календарных дней иностранцев и лиц без гражданства, которые приезжают на полуостров для осуществления трудовой деятельности. Изоляция должна проходить в специально приспособленных помещениях, функционирующих по типу обсерваторов.

Вместе с тем, все путешественники, прибывшие на полуостров из стран с неблагополучной эпидобстановкой, должны незамедлительно сообщить информацию о своём фактическом месте проживания и о состоянии здоровья по телефонам горячей линии Минздрава РК – 8-800-733-33-34, 8-800-733-33-12, а также Роспотребнадзора – 8 978-919-11-23.

Обратите внимание, что граждане РФ, прибывшие с территории иностранного государства, также проходят обследование на COVID-19 методом ПЦР в местной лаборатории – опять же не позднее, чем через три дня после прибытия. Отрицательный результат отправляют в Роспотребнадзор на ту же почту – [email protected] Это же правило распространяется и на граждан, пересёкших границу Российской Федерации на территории других субъектов РФ и прибывших в Крым.

Всё больше туристов возвращается в Крым – Минкурортов >>

При этом, согласно Указу главы РК от 22 июля № 232-У, все лица, вернувшиеся на территорию Крыма «вывозными» международными рейсами, подлежат изоляции и медицинскому наблюдению в условиях обсерватора на срок 14 календарных дней.

По всем вопросам, связанным с отдыхом в Крыму, звоните на круглосуточную горячую линию министерства курортов и туризма РК по бесплатному номеру: 8(800)5118018.

Хотите быть в курсе самых интересных туристических новостей Крыма? Тогда напишите нам на [email protected] и мы включим вас в нашу рассылку

ГБУЗ РК «Городская поликлиника №3». Уважаемые граждане!

Уважаемые граждане!

 

С 7 по 11 сентября 2020 года будет проводиться Неделя приёмов граждан по теме «Организация системы здравоохранения в осенне-зимний период в условиях сложившейся эпидемиологической обстановки».

График приёмов:

07.09 (понедельник) с 15:00 до 17:00Билко Ольга Юрьевна, депутат Петрозаводского городского Совета, Главный врач Городской поликлиники № 4

08.09 (вторник) с 10:00 до 12:00Хейфец Алексей Ильич,

депутат Законодательного Собрания Республики Карелия, Председатель Комитета по здравоохранению и социальной политике ЗС РК

09.09 (среда)

c 10:00 до 12:00 – Гравов Андрей Михайлович, директор Территориального фонда обязательного медицинского страхования Республики Карелия

с 14:00 до 16:00 – Корид Екатерина Арсентьевна, врио руководителя Управления Федеральной службы по надзору в сфере защиты прав потребителей и благополучия человека по Республике Карелия (Роспотребнадзор по РК) (по адресу: г. Петрозаводск, ул. Володарского, д.26)

Приемы также пройдут в территориальных отделах Управления (г. Сегежа, ул. Мира, д. 38а; г. Костомукша, ул. Звездная, д. 23; г. Сортавала, ул. Комсомольская, д. 10; г. Кондопога, ул. Комсомольская, д. 6)

10.09 (четверг) с 15:00 до 17:00 – представители Министерства здравоохранения Республики Карелия (приём по личным вопросам – дистанционно)

11.09 (пятница)

с 14:00 до 16:00 – Репникова Яна Владимировна, заместитель руководителя Территориального органа Росздравнадзора по Республике Карелия (по адресу: г.Петрозаводск, ул.Анохина, д.29а, 4 этаж)

с 15:00 до 17:00Стоцкий Михаил Михайлович, депутат Законодательного Собрания Республики Карелия, Главный врач Городской поликлиники №1

 

Приёмы проводятся по адресу: г. Петрозаводск, ул. Энгельса, д.4 каб.61

Записаться на приём можно по телефону: 77-31-16

Организатор: Региональная общественная приемная Председателя Партии «ЕДИНАЯ РОССИЯ» Д.А.МЕДВЕДЕВА в Республике Карелия

Вышестоящие и контролирующие организации — ГАУЗ РК «Республиканский центр микрохирургии глаза»

Министерство здравоохранения Республики Коми

Адрес: 167000, Сыктывкар, ул. Ленина, 73

Телефон: (8212) 286-000, Факс: (8212) 301-680

Электронная почта: Адрес электронной почты защищен от спам-ботов. Для просмотра адреса в вашем браузере должен быть включен Javascript.

Официальный сайт: www.minzdrav.rkomi.ru

Отдел контроля качества медицинской помощи: (8212) 286-082


Управление Федеральной службы по надзору в сфере защиты прав потребителей и благополучия человека по Республике Коми

(Управление Роспотребнадзора по Республике Коми)

Адрес: 167610, г. Сыктывкар, ул. Орджоникидзе, д.71

Тел./факс: (8212) 21-93-38 — приемная

Эл. почта: Адрес электронной почты защищен от спам-ботов. Для просмотра адреса в вашем браузере должен быть включен Javascript.

Официальный сайт: www.11.rospotrebnadzor.ru

Горячая линия: (8212) 21-30-61 (режим работы:среда с 9 до 13 часов)


Территориальный орган Федеральной службы по надзору в сфере здравоохранения по Республике Коми

(Территориальный орган Росздравнадзора по Республике Коми)

Адрес: 167031, Республика Коми, г. Сыктывкар, ул. Куратова, д.18

Тел./факс: (8212) 24-08-96 – приемная; Факс. (8212)21-43-73

Эл. почта: Адрес электронной почты защищен от спам-ботов. Для просмотра адреса в вашем браузере должен быть включен Javascript.

Официальный сайт: www.11.rospotrebnadzor.ru


Территориальный отдел Управления Роспотребнадзора по Республике Коми по городу Ухте, городу Сосногорску, городу Вуктылу, Троицко-Печорском району

Адрес: 169300, Республика Коми г. Ухта, ул. Севастопольская, 1.

Телефон: (8216)75-09-84


Ухтинский межтерриториальный отдел организации здравоохранения ГКУ РК «Центр обеспечения деятельности Минздрава РК»

Адрес: 169300, Республика Коми, г. Ухта, ул. Чибьюская, 54.

Тел. /факс приемной: (8216) 74-10-20


 

 

Интинская городская больница.

Приказ Минздрава Республики Коми от 31.03.2020г. №491-р «О временном режиме функционировании государственных учреждений здравоохранения Республики Коми» 

В Интинской ЦГБ обратиться за консультацией по вопросам коронавирусной инфекции можно
в будни с 8:00 до 15:00 по телефону 6-06-09.

«Горячая линия» по вопросам профилактики новой коронавирусной инфекции (2019-nCoV) для граждан, вернувшихся с территорий, где зарегистрированы случаи коронавируса, в целях передачи сведений о месте, датах их пребывания и возвращения, контактной информации.
Обратиться на «горячую линию» можно круглосуточно
по телефону 8-800-55-00000. Звонок бесплатный.

Единая горячая линия по России по вопросам коронавируса:
8-800-2000-112


Уважаемые интинцы! Напоминаем Вам, что в связи с объявленными карантинными и предупредительными мероприятиями, оказание медицинской помощи населению, с признаками ОРВИ, осуществляется на дому.

Если у Вас появились признаки острого респираторного заболевания или гриппа — насморк, кашель, боль в груди, затрудненное дыхание, головная и мышечная боли, температура выше 37, НЕ ПРИХОДИТЕ В ПОЛИКЛИНИКУ, не подвергайте риску заражения окружающих, ВЫЗЫВАЙТЕ ВРАЧА НА ДОМ!

Вызов участкового врача-терапевта на дом в рабочие дни с 8. 00 до 12.00 по телефону 6-16-36 (многоканальный).

Неотложная помощь на дому с 8.00 до 14.00 по телефону 6-16-36 (многоканальный).

В остальное время скорая и неотложная помощь оказывается работниками отделения скорой помощи по телефонам 03, 112, 6-14-00.

Вызов врача-педиатра на дом в рабочие дни с 8.00 до 12.00 по телефону 6-10-70.


Рекомендации по обеспечению основных принципов самоизоляции

В целях недопущения распространения новой коронавирусной инфекции на территории Российской Федерации граждан, приезжающих из неблагополучных по COVID-19 стран, должна осуществляться изоляция (самоизоляция) в домашних условиях.

В категорию лиц, в отношении которых необходимо применение режима самоизоляции, попадают граждане Российской Федерации, а так же граждане, имеющие иное гражданство, но постоянно проживающие на территории России, прибывающие из неблагополучных по COVID-10 стран.

Под самоизоляцией подразумевается изоляция лиц, прибывших из неблагополучных по COVID-19 стран, в изолированной квартире с исключением контакта с членами своей семьи или другими лицами.  При этом, изолируемый должен находится в помещении, где проживает как собственник, так и наниматель или на других законных основаниях. Изолируемый, не ограничен в своих правах на территории своего жилья (контакт с людьми возможен посредством видео/аудио, интернет связи), однаком, покидать его не имеет права.

По прибытию в Россию необходимо сообщать о своем возвращении в /из стран, неблагополучных по COVID-19, месте, датах пребывания на указанных территориях, адрес места самоизоляции и другую контактную информацию по телефону линии территориального органа Роспотребнадзора или органа исполнительной власти субъекта Российской Федерации для дальнейшей передачи информации в территориальную медицинскую организацию, которой устанавливается медицинское наблюдение за прибывшим.

Режим самоизоляции устанавливается сроком на 14 дней, с момента пересечения границы Российской Федерации – для лиц, прибывающих из неблагополучных по COVID-19 стран.

При условии совместного путешествия нескольких лиц, проживающих в одной квартире, возможна совместная изоляция: нескольких лиц.  Не рекомендуется пребывание домашних животных в квартире, где осуществляется самоизоляция.

При невозможности обеспечения изоляция в домашних условиях, а так же для лиц, не имеющих постоянного места жительства на территории Российской Федерации, предусматривается изоляция в специально развернутых обсерваторах.

Лицам, находящимся в изоляции запрещается выходить из помещения, даже на непродолжительный срок  (покупка продуктов/предметов первой необходимости, вынос мусора, отправка/получение почты и др.) Для обеспечения изолируемого всем необходимым могут привлекаться родственники, службы доставки, волонтёры и др. лица без личного контакта с изолируемым (безналичный расчет: доставляемые продукты/предметы оставляются у входа в квартиру изолируемого). Бытовой мусор, образующийся в месте изоляции, упаковывается в двойные прочные мусорные пакеты, плотно закрывается и выставляется за пределы квартиры, по предварительному звонку лицам, которые будут его утилизировать (выносить).

В период самоизоляции необходимо соблюдать режим проветривания, правила гигиены (мыть руки водой с мылом или обрабатывать кожными антисептиками – перед приемом пищи, перед контактом со слизистыми оболочками глаз, рта, носа, после посещения туалета и др. ), регулярно проводить влажную уборку с применением средств бытовой химии с моющими или моюще-дезинфицирующими эффектом.

Изолируемый имеет право покидать место изоляции в следующих случаях:

  • При возникновении ЧС техногенного или природного характера (при вызове сотрудников спецслужб, обязательно указывать свой статус «изолированного»).
  • В случае возникновения угрозы жизни или здоровью изолированного лица (соматические заболевания и др.) (при вызове сотрудников медицинской службы, обязательно указывать свой статус «изолированного»
  • При появлениях первых симптомов заболевания COVID-19 (изолируемый ставит в известность медицинскую организацию, осуществляется медицинское наблюдение за изолируемым, по номеру телефона, который сообщается ему заблаговременно, после чего, изолируемого переводят в инфекционный госпиталь).

За изолируемым устанавливают медицинское наблюдение на дому с обязательной ежедневной

термометрией, осуществляемой медицинскими работниками обязательными соблюдением мер биологической безопасности при контакте с изолируемым (врачи поликлинической сети).  На 10 сутки изоляции, сотрудниками медицинской организации, производится отбор материала для исследования COVID-             На все время нахождения в режиме изоляции на дому, открывается двухнедельный лист нетрудоспособности (без посещения лечебного учреждения).

Контроль за соблюдением изолированным всех ограничений и запретов, которые были включены в понятие «самоизоляция», возлагается на участковых уполномоченных полиции (проведение инструктажа с изолируемым, контроль по телефону лиц, подлежащих изоляции). Участковые уполномоченных полиции осуществляют надлежащий надзор, разъясняют условия изоляции на жому и последствия нарушения режима.

Для контроля за нахождения надзор, разъясняют условия изоляции на дому и последствия нарушения режима.

Для контроля за нахождением изолируемого в месте его изоляции могут использоваться электронные и технические средства контроля.

При нарушении режима изоляции лицо, подлежащее изоляции, помещается в изолятор. Самоизоляция завершается после 14-дневного срока изоляции на дому, в случае отсутствия признаков заболевания, на основании отрицательного результата лабораторных исследований материала, взятого на 10 день изоляции.

 

 


 

Список официальных сайтов по коронавирусу:

1.Официальный сайт Стопкоронавирус.РФ

2.Информация о новой коронавирусной инфекции на сайте Министертсва здравоохранения Российской Федерации 

3.Информация о новой коронавирусной инфекции на сайте Роспотребнадзора Российской Федерации

 



Временно приостановлено проведение Всероссийской диспансеризации взрослого населения и профилактических осмотров!

Берегите себя, оставайтесь дома! #домалучше


Памятка: Работодателю (страхователю), с которым в трудовых отношениях состоят лица возраста 65 лет и старше

Памятка: Вниманию работающих (застрахованных) лиц возраста 65 лет и старше (дата рождения 06 апреля 1955 года и ранее)

Ресторан

В самом сердце города


Ресторан «Северный»

Часы работы ресторана: с 07:00 до 00:00

Уважаемые гости, информируем Вас о том, что ресторан «Северный» работает обычном режиме и в режиме доставки!

В ресторане соблюдены все рекомендации Роспотребнадзора по дезинфекции помещений и инвентаря, в том числе выполняется обработка рук антисептическими средствами, ионизирование воздуха и проветривание помещений.

Нами организована услуга по доставке еды. Вы сможете заказать блюда из основного, детского и банкетного меню домой или в офис!

Заказать столик или доставку еды можно по телефону 8(8142)630325

Доставка осуществляется ежедневно: будни с 9:00 до 21:00; выходные с 12:00 до 21:00

Меню ресторана можно посмотреть здесь.

Следите за обновлениями и нашими новостями в группе во «ВКонтакте» и Instagram


 Ресторан Северный — один из старейших ресторанов Петрозаводска, его история перешагнула уже за полвека. Последняя реконструкция проведена в 2012 году — полностью обновлен интерьер ресторана, построена собственная пивоварня. Ресторан расположен в самом центре города и давно стал популярным местом встреч горожан, туристов, артистических натур, бизнесменов и гостей города, имеет удобное транспортное сообщение со всеми районами города. В пределах 15 минут спокойной ходьбы от ресторана расположены железнодорожный и речной вокзалы, кассы аэровокзала, театры и кинотеатры, набережная Онежского озера, множество магазинов. Рядом с рестораном есть охраняемая автостоянка и стоянка такси.

Ресторан рассчитан на 350 посетителей. Гурманов привлекает сюда кухня (европейская, русская, карельская и фирменные блюда), ценителей музыки — живой звук, бизнесменов — комфорт и стиль, подходящий как для отдыха, так и для деловых встреч. Кроме того, большой зал ресторана оснащен мультимедийными экранами, где можно посмотреть музыкальные программы, новости, спортивные трансляции.

Кроме большого зала в ресторане Северный работают 6 банкетных залов. Один из которых оформлен в национальном карельском стиле, где в уютной и одновременно торжественной обстановке вы сможете провести деловую встречу, мини-банкет, семейное торжество. 

Сегодня ресторан — это широкий спектр услуг в сфере обслуживания: мероприятия высокого уровня, банкеты, корпоративы, фуршеты, кейтеринг, свадьбы и выездные регистрации, бизнес-ланчи, семейные ужины, детские праздники и кулинарные мастер-классы, благотворительные мероприятия, музыкальные программы, возрастные мероприятия выходного дня и кухня на любой вкус, которая не оставит равнодушным никого.  

Помимо банкетного, фуршетного и основного меню, которое включает в себя фирменные блюда, европейскую, русскую, карельскую и пивную кухню, а также специальное детское меню, шеф-поваром ресторана каждый сезон разрабатываются специальные предложения, которые придутся по вкусу даже самым избирательным гостям.

Меню ресторана






Copyright © 2016 Гостиница «Северная». All Rights Reserved.

На примере Республики Коми

и субарктического региона — систематический обзор. Glob Health

Экшен. 2014; 7: 24161.

[16] Токаревич Н., Тронин А., Блинова О. и др. Влияние изменения климата

на расширение среды обитания Ixodes persulcatus

и заболеваемость клещевым энцефалитом на

севере европейской части России. Glob Health Action.

2011a; 4: 8448.

[17] Глушкова Л., Галимов Р. Эколого-эпидемиологические

Аспекты клещевого энцефалита в Республике

Коми и профилактика заболеваний.ЭпиНорт. 2011; 12: 44–50.

[18] Гейгер Р. Классификация климатов нач. В. Кеппен

[Классификация климатов по В. Кеппену]. In:

Landolt-Börnstein –Zahlenwerte und Funktionen aus

Physik, Chemie, Astronomie, Geophysik und Technik,

alte Serie [Landolt-Börnstein — цифры и функции

Физика, химия и астрономия,

огы, старые серии. Часть III (Астрономия и геофизика)] Vol.

3.Берлин: Спрингер; 1954. с. 603–607.

[19] Филиппова Н.А. Иксодовые клещи подсемейства Ixodinae. Арахнида.

IV (4), Фауна СССР. Ленинград: Наука Пресс; 1977.

СССР. Русский.

[20] Такер CJ. Красная и фотографическая инфракрасная линейная комбинация

наций для мониторинга растительности. Remote Sens Environ.

1979; 8 (2): 127–150.

[21] Tucker CJ, Pinzon JE, Brown ME, et al. Расширенный набор данных

AVHRR 8 км NDVI, совместимый с данными MODIS и

SPOT растительности NDVI. Int J Remote Sens. 2005; 26

(20): 4485–5598.

[22] Соланти Р. Сумма дневных температур — новая тепловая переменная

, способная описывать характеристики вегетационного периода и объяснять —

эвапотранспирация. Boreal Environ Res. 2004. 4: 319–334.

[23] Балашов Ю.С. Иксодовые клещи-паразиты и переносчики болезней

. Санкт-Петербург: Наука; 1998. с. 287. Русский.

[24] Ельсаков В.В., Тельятников М.Ю. Влияние межгодовых климатических колебаний

последнего десятилетия на NDVI на северо-востоке

Европейской части России и Западной Сибири.Curr Problems

Remote Sen Earth Space. 2013. 10 (3): 260–271.

[25] Bonham CD. Измерения для наземной растительности.

2-е изд. Чичестер: Джон Уайли и сыновья; 2013. с. 246.

ISBN: 978-0-4709-7258-8.

[26] Koven CD. Потеря бореального углерода из-за сдвига полюсов в

низкоуглеродных экосистемах. Нат Геоши. 2013; 6: 452–456.

[27] Себальос Л. А., Пинторе М.Д., Томассоне Л. и др. Среда обитания и

встречаемости иксодовых клещей в регионе Лигурия,

Северо-запад Италии.ExpApplAcarol. 2014. 64 (1): 121–135.

Epub 2014 30 марта.

[28] Паркинсон А., Эвенгард Б., Семенца Дж. И др. Климат

Изменение климата и инфекционные болезни в Арктике: создание

циркумполярной рабочей группы. Int J Circumpolar

Здоровье. 2014; 73: 25163.

[29] Ревич Б, Токаревич Н, Паркинсон AJ. Изменение климата

и зоонозные инфекции в Российской Арктике. Int J

Циркумполярное здоровье. 2012; 71: 18792.

[30] Коренберг Э.И., Жуков В.И. и др.Распространение Ixodes

persulcatus в СССР. J Zoology (Russ). 1969. 48 (7): 1003–

1014. Русский. Доступно по адресу: http: //www.researchgate.

нетто / публикация / 263926549_Распространение_тайги

tick_ (Ixodes_persulcatus) _в_СССР_Российский

[31] Корабельников И.В. Распространение природно-очаговых инфекций

в условиях антропогенных воздействий в биосфере. Нац

Приоритеты Рус. 2009; 2: 77–78. Русский.

[32] Ясукевич В.В., Казакова Е.В., Попов И.О. и др.Распространение

Ixodes ricinus L., 1758 и Ixodes persulcatus Schulze,

1930 sitiformes ixodidae в России и сопредельных странах

и наблюдаемые изменения климата. Proc Acad Sci Geo.

2009; 427: 68892. Русский.

[33] Randolph SE. Экология клещей: процессы и закономерности

, лежащие в основе эпидемиологического риска, создаваемого иксодовыми клещами

как переносчиками. Паразитология. 2004. 129: 37–65.

[34] Rand PW, Holman MS, Lubelczyk C, et al.Тепловая аккумуляция

и раннее развитие Ixodes scapularis.

J Vector Ecol. 2004. 29: 164–176.

[35] Линдгрен Э., Таллеклинт Л., Полфельдт Т. Влияние климатических изменений

на границу северных широт и популяцию

плотность европейского клеща-переносчика болезней Ixodes

ricinus. Перспектива здоровья окружающей среды. 2000; 108: 119–123. [цитировано 29 декабря 1999 г.,

]. Доступно по адресу: http: // ehpnet: .niehs.nih.go /

docsd / 2 0018pl119-123indren / abstractml

[36] Jore S, Vanwambeke SO, Viljugrein H, et al.Климат

и изменение окружающей среды приводят к расширению Ixodes ricinus географического

на северной окраине ареала. Векторы паразитов.

2014; 7: 11.

[37] Земан П., Паздиора П., Бенеш С. Пространственно-временные вариации

заболеваемости клещевым энцефалитом (КЭ) в Чешской Республике

: является ли текущее объяснение роста заболеваемости

удовлетворительным? Клещи Tick Borne Dis. 2010. 1 (3): 129–140.

PMID: 21771520.

[38] Даниелова В., Клигрова С., Даниэль М. и др.Влияние потепления климата

на распространение клещевого энцефалита

за последнее десятилетие (1997–2006) на более высокие высоты в

высокогорном регионе (Чешская Республика). Cent Eur J Public

Health. 2008. 16 (1): 4–11. PMID: 18459472.

[39] Криз Б., Малый М., Бенес С. и др. Эпидемиология клещевого энцефалита

в Чешской Республике 1970–2008 гг. Вектор

Borne Zoonotic Dis. 2012; 12 (11): 994–999. Epub 2012

1 октября

[40] Сасс Дж.Клещевой энцефалит 2010: эпидемиологический риск

районов и штаммов вирусов в Европе и Азии — более

точек зрения. Клещи Tick Borne Dis. 2011; 2 (1): 2–15. Epub 2010

17 декабря.

[41] Огден Н.Х., Мааруф А., Баркер И.К. и др. Изменение климата

и потенциал расширения ареала распространения болезни Лайма

, переносчика болезни Ixodes scapularis в Канаде. Inter J Parasitol.

2006; 36: 63–70.

[42] Токаревич Н.К., Тронин А.А., Сельджук В.Н. и др.Экологическая и

эпидемиологическая характеристика

КЭ и клещевого

боррелиоза (болезнь Лайма) в Калининградской области.

Российский J Infect Immun (Russ). 2011б; 1 (4): 319–330.

Русский.

[43] Randolph SE. Достаточно ли экспертного мнения? Критическая оценка —

доказательств потенциального воздействия изменения климата

на клещевые болезни. Anim Health Res Rev.

2013; 14 (02): 1–5.

[44] Сумило Д., Асоклиене Л., Борман А. и др.Изменение климата

не может объяснить вспышку клещевого энцефалита в

странах Балтии. PLoS One. 2007; 2 (6): e500. Доступно по адресу:

http://journals.plos.org/plosone/article?id=10.1371/jour

nal.pone.0000500

[45] Стефанов П., Орликова Н., Приказский В. и др. Трансграничный

различия в эпиднадзоре: клещевой энцефалит и лайм

боррелиоз в Чешской Республике и Польше, 1999–2008 гг.

Cent Eur J Public Health.2014; 22 (1): 54–59.

12 Н. ТОКАРЕВИЧ И др.

Правительство рассматривает вопрос о коронавирусной инфекции и мерах по защите граждан Казахстана

Правительство рассматривает вопрос о коронавирусной инфекции и мерах по защите граждан Казахстана

На заседании правительства под председательством Премьер-министра Аскара Мамина рассмотрены меры по предотвращению распространения коронавирусной инфекции в Казахстане.

Министр здравоохранения Елжан Биртанов и министр иностранных дел Мухтар Тлеуберди доложили о текущей ситуации и проводимой работе.

В Казахстане случаев заражения коронавирусом не зарегистрировано. В Республике Казахстан госпитализированы 134 человека с повышенной температурой и симптомами ОРЗ, из них 106 выписаны с выздоровлением, 28 остаются в стационарах. Состояние больных удовлетворительное.

Медицинские организации продолжают наблюдение за здоровьем граждан, прибывающих из Китая по месту жительства, охвачено 24 167 человек, в том числе 1298 иностранных граждан.Сегодня 8851 человек, прибывший из Китая за последние 14 дней, остаются под медицинским наблюдением, наблюдение за оставшимися 15316 завершено в связи с окончанием инкубационного периода.

На базе Центральной справочной лаборатории Национальный центр высокоинфекционных заболеваний совместно с Национальным центром биотехнологии разработали систему для быстрой диагностики коронавируса. В рамках международного сотрудничества диагностические системы для 2 000 обследований были получены в Роспотребнадзоре и для 5 000 обследований закуплены в Китае.

В настоящее время на территории КНР находится 497 граждан Республики Казахстан, из которых 337 — студенты. С 10 по 11 февраля 2020 года 217 граждан Республики Казахстан чартерным самолетом авиакомпании «Эйр Астана» были доставлены из Пекина в Нур-Султан. 12 февраля 2020 года аналогичным рейсом планируется отправить 155 граждан Китайской Республики. По завершении эвакуации в КНР останутся 343 гражданина Республики Казахстан, изъявившие желание остаться в Китае.

Премьер-министр подчеркнул, что в соответствии с поручением Главы государства Касым-Жомарта Токаева Правительством принимаются все необходимые меры для предотвращения распространения коронавирусной инфекции в Казахстане.

«На сегодняшний день в Казахстане нет больных коронавирусом. Ситуация стабильная и находится под постоянным контролем со стороны правительства », — сказал Мамин.

Глава правительства поручил Министерству здравоохранения продолжить осуществление санитарно-эпидемиологического контроля, а Министерству иностранных дел поддерживать тесный контакт с казахстанцами в КНР и оказывать им необходимую помощь.

Премьер обратил внимание антимонопольных органов и Минздрава на некоторые факты искусственного завышения цен на медицинские маски и противовирусные препараты в аптечных сетях.

«Разберитесь с этим. В целом, Минздрав и акимы областей должны держать ситуацию под постоянным контролем », — резюмировал Мамин .


Международный цикл передового опыта, 2017

С 3 по 8 апреля 2017 года на кафедре эпидемиологии и гигиены Казахского национального университета.Аль-Фараби в рамках соглашения о сотрудничестве между КазНУ. Аль-Фараби и Российская медицинская академия непрерывного профессионального образования прошли международный цикл повышения квалификации по теме «Основные направления деятельности органов здравоохранения в области химической безопасности» (54 часа) с Хамидулиной Х. Х., д.м.н., Профессор, директор ФБУЗ «Российский регистр потенциально опасных химических и биологических веществ» Роспотребнадзора, кафедра гигиены ФГБУ ДПО «Российская медицинская академия непрерывного профессионального образования» Минздрава России, зам.Гл. редактор научно-практического журнала «Токсикологический вестник».

Слушателями цикла стали сотрудники отделов санитарно-гигиенического надзора и контроля за соблюдением требований технических регламентов ведомств и ведомств КОЗ РК, специалисты Национального центра экспертизы и сертификации РК. , профессорско-преподавательский состав кафедр гигиенического профиля.

Были рассмотрены следующие вопросы:

  • · Актуальные проблемы безопасного обращения с химическими веществами и их реализации на международном и национальном уровнях
  • · Основные принципы гигиенического нормирования
  • · Основные аспекты продовольственной безопасности
  • · Внедрение Согласованной на глобальном уровне системы классификации и маркировки химических веществ (СГС) в практику отечественной профилактической токсикологии и гигиены
  • · Информационная поддержка проблем химической безопасности
  • · Технический регламент Таможенного союза (непродовольственные товары)
  • · Роль и место санитарно-гигиенических лабораторий в деятельности службы здравоохранения

Frontiers | Делеция цитоплазматических и трансмембранных N-концевых доменов BST2 приводит к подавлению продукции вируса SARS-CoV, SARS-CoV-2 и вируса гриппа в клеточной линии Vero

Введение

Антиген 2 стромальных клеток костного мозга (BST2), также известный как тезерин, играет важную роль в клеточном противовирусном ответе во время заражения вирусами в оболочке, главным образом, предотвращая высвобождение вируса, как это было показано на вирусе иммунодефицита человека 1 (ВИЧ1) и вирусе Эбола ( Gupta et al. , 2009; Vande Burgt et al., 2015). Однако было показано, что антагонисты тезерина, кодируемые некоторыми вирусами, такими как белок Vpu ВИЧ-1 и гликопротеин Эбола, усиливают высвобождение вирусов ВИЧ-1 и Эбола в фибробластах и ​​Т-клетках, обработанных интерфероном-α (IFN-α) ( Neil et al., 2008). Кроме того, предыдущие исследования показали ингибирование BST2 белком шипа (S) SARS-CoV; а ORF7 SARS-CoV кодирует белок, который нейтрализует BST2, ингибируя его гликозилирование (Wang et al., 2019). Наконец, нокдаун BST2 в клеточной линии Vero увеличивал продукцию вирусов гриппа A / h2N1 и A / h4N2, а также вируса осповакцины и вируса эпидемической диареи свиней (PED) в тесте на бляшках (Yi et al., 2017).

Трансмембранный белок тезерин экспрессируется в B-клетках, стромальных клетках костного мозга, дендритных клетках и других типах клеток (Blasius et al., 2006; Erikson et al., 2011) и находится в основном в богатых холестерином доменах. (липидные рафты) плазматической мембраны (Neil et al. , 2008; Yi et al., 2017). Белок тетерин содержит четыре функциональных домена, включая цитоплазматический N-хвост (CT), трансмембранный домен (TM), внеклеточный домен (EC) и C-концевой домен (GPI). Домен EC отвечает за прямое связывание выпущенных вирусов (Arias et al., 2011; Hotter et al., 2013), в то время как TM-домен, как было показано, взаимодействует с белком Vpu ВИЧ-1, тем самым противодействуя продукции вируса (Iwabu et al., 2009). Важно отметить, что влияние доменов белка тетерина на продукцию вирусов SARS-CoV и SARS-CoV-2 остается без внимания.

В этой работе мы с помощью системы CRISPR / Cas9 создали мутантную клеточную линию Vero, содержащую делецию в доменах CT и TM, кодирующих последовательность гена BST2, и исследовали продукцию вирусов SARS-CoV, SARS-CoV-2 и птичьего гриппа. в этих клетках с использованием метода количественной ПЦР в реальном времени.

Материалы и методы

Производство трансгенной клеточной линии

Для создания конструкции для CRISPR / Cas9 две направляющие РНК (gRNA1: GGAGTCGGGCCTGAAGTTAG, gRNA2: GACACTCCATCACTGCCCGG) были субклонированы в плазмиду pSpCas9 (BB) -2A-GFP (Addgene, # 48138) с использованием сайтов X. Полученную плазмиду трансфицировали в клетки Vero (ГНЦ ВБ «Вектор» репозиторий клеток Роспотребнадзора) липофектамином 3000 (Thermo Fisher Scientific, США) согласно протоколу производителя.Мутантные клоны клеток идентифицировали секвенированием по Сэнгеру ампликонов ПЦР, полученных с использованием следующих праймеров: GGTCAGGACAGCTCCTATGCTA (прямой) и AGATTATTGTCCTCCCTACCCC (обратный).

Инфекция клеток SARS-CoV и SARS-CoV-2

Все эксперименты с участием живых организмов SARS-CoV (Урбани, Медицинский центр Университета Эразма, Роттердам) и SARS-CoV-2 (nCoV / Victoria / 1/2020) проводились в соответствии с утвержденными стандартными рабочими процедурами учреждения уровня биобезопасности-3. Клетки Vero высевали в 24-луночные планшеты (100000 клеток на лунку) и инфицировали либо SARS-CoV, либо SARS-CoV-2 при MOI 0.001 БОЕ / ячейка, как описано у Muth et al. (2018) и Hoffmann et al. (2020). В эксперименте с трипсином мы добавляли 4 мкг / мл трипсина, обработанного TPCK (Sigma-Aldrich, США). Через 1 час заражения несвязавшиеся вирусы удаляли промыванием бессывороточной средой Eagle MEM. Затем в чашки, предназначенные для культивирования в присутствии трипсина, добавляли 1 мл раствора трипсина, обработанного ТПКК, с концентрацией 2 мкг / мл в DMEM / F12 («Биолот», Россия). В чашки с последующим культивированием без трипсина добавляли только среду DMEM / F12.После 48 ч культивирования при 37 ° C в 5% CO 2 , суммарную РНК выделяли с помощью набора Riboprep (ILS, Россия) и измеряли количество копий вирусных геномов с помощью диагностического набора SARS (SRC VB «Вектор»). Роспотребнадзор; Патент RU2733665C1), который использует реакцию ПЦР в реальном времени TaqMan со следующими праймерами: 5′-GTTGCAACTGAGGGAGCCTTG-3 ′ (прямой), 5′-GAGAAGAGGCTTGACTGCCG-3 (обратный) и 5′-FAGAAGAGGCTTGACTGCCG-3 (обратный) и 5′-FGACQACQACCA-TAGAC ′ (Зонд). Плазмида pJet1.2_SARS, содержащая фрагмент SARS-CoV-2 MN997409.Геном 1 штамма (позиции 28670–28826) использовали в качестве эталона для нормализации кПЦР. Преобразование концентрации вирусной нуклеиновой кислоты в число копий вирусного генома выполняли с помощью калькулятора числа копий и разведения ДНК (Thermo Fisher). Каждый эксперимент включал три биологические повторы. Статистическая значимость рассчитывалась с помощью двухвыборочного теста t . Различия считались значимыми для значений p <0,50.

Инфекция клеток вирусом гриппа

Все эксперименты с вирусами гриппа проводились в соответствии с утвержденными стандартными рабочими процедурами учреждения уровня биобезопасности 2.Производство запасов вирусов птичьего гриппа H5N1 (A / Nghe An / 08VTC /, H5N1 / Chany /) и H5N8 (A / Astrakhan / 3111/2016), инфицирование клеточных линий и тесты ингибирования гемагглютинации (HAI) были выполнены, как описано ранее (Нечаева и др., 2019). Вкратце, вирусные запасы продуцировали в клетках MDCK, и монослои клеток Vero и Vero-BST2Δ221 инфицировали при MOI 0,01 БОЕ / клетку в 75 см колбе 2 . Для HAI исследуемые сыворотки предварительно обрабатывали ферментом, разрушающим рецепторы (RDE) (Denka, Япония). Реакцию гемагглютинации проводили в 96-луночных планшетах с 1% куриных эритроцитов (эритроцитов). Титр HAI определяли как обратное разведение последнего ряда, который содержал неагглютинированные эритроциты.

Результаты

После трансфекции клеток Vero плазмидной ДНК, кодирующей эффекторы CRISPR / Cas9 и соответствующих направляющих РНК, частичная гомозиготная делеция гена BST2 была подтверждена секвенированием по Сэнгеру в одном из клонов, полученных путем одноклеточного разведения после липофекции, и показал потерю области 73–294 нуклеотидов (см.след. XM_007995721.1). Отсутствие сдвига рамки было также подтверждено секвенированием по Сэнгеру. Удаленная часть гена BST2 кодирует домены CT и TM (рисунок 1A). Полученная линия клеток Vero была названа Vero-BST2Δ221.

Рисунок 1. (A) Делеция 221 нуклеотида из мРНК гена BST2 приводит к потере доменов CT и TM в кодируемом белке. КТ — цитоплазматический N-хвост; TM, трансмембранный домен; EC, внеклеточный домен; GPI, С-концевой домен. (B) Производство вируса, представленное в виде следующего Log 10 количеств геномных эквивалентных чисел: 1 — SARS-CoV, трипсин; 2 — SARS-CoV без трипсина; 3 — SARS-CoV-2, трипсин; 4 — SARS-CoV-2 без трипсина.

Затем мы стремились проанализировать продукцию SARS-CoV (Урбани, Медицинский центр Университета Эразма, Роттердам) и SARS-CoV-2 (nCoV / Victoria / 1/2020) в Vero-BST2Δ221 и контролировать клеточные линии Vero. Для этой цели равное количество клеток обоих типов было инфицировано SARS-CoV или SARS-CoV-2 в присутствии или в отсутствие трипсина, и количество эквивалентов вирусного генома определялось с использованием подхода кПЦР в реальном времени, как описано в разделе MMs. . Примечательно, что мы наблюдали примерно 10-кратное снижение продукции SARS-CoV в клетках Vero-BST2Δ221 (рис. 1B) по сравнению с контролем независимо от условий заражения.Для SARS-CoV-2 мы продемонстрировали 30- и 40-кратное снижение продукции вируса в присутствии и в отсутствие трипсина, соответственно (рис. 1B).

Наконец, чтобы продемонстрировать подавление продукции других вирусов в оболочке в клетках Vero-BST2Δ221, последние были инфицированы птичьим гриппом H5N1 (A / Nghe An / 08VTC /, H5N1 / Chany /) и H5N8 (A / Astrakhan / 3111 / 2016) вирусы. Последующие тесты на гемагглютинирование выявили 4-, 32- и 8-кратное снижение вирусных титров в культурах BST2Δ221 по сравнению с контрольными клетками, что указывает на резкое подавление продукции вируса в этих клетках (Таблица 1).

Таблица 1 . Анализ продукции вируса гриппа в клеточных линиях Vero и Vero-BST2Δ221 с помощью теста ингибирования гемагглютинации (HAI).

Обсуждение

Тетерин играет ключевую роль в клеточном противовирусном ответе, связываясь с выпущенными в оболочку вирусами, предотвращая, таким образом, последующие инфекции. Однако некоторые вирусы продуцируют антагонистические белки, чтобы противостоять действию тетерина, в основном за счет нацеливания на домен tetherin TM (Blasius et al. , 2006; Neil et al., 2008; Wang et al., 2019). Точные механизмы взаимодействия вирусов с белком BST2 через TM-домен и последующее ингибирование вирусной продукции остаются неясными, а трансмембранное расположение TM-домена было только предсказано (Roy et al., 2019). Кроме того, защитная делеция пяти аминокислот в цитоплазматическом домене BST2 / tetherin была обнаружена в ДНК человека и древних ДНК неандертальцев и денисовцев. Эта делеция предотвращает связывание BST2-антагонистического белка (Nef) вирусов иммунодефицита обезьян и, как предполагается, создает барьер для передачи вируса от нечеловеческих приматов человеку (Sauter et al., 2011). Таким образом, мы предположили, что отсутствие мотива-мишени для вирусных белков, антагонизирующих BST2, может привести к неспособности вирусов ингибировать противовирусное действие тезерина. Следовательно, мы продемонстрировали, что делеция последовательности, кодирующей домены CT и TM в гене BST2, приводит к существенному ухудшению продукции коронавируса и вируса птичьего гриппа в клетках Vero. Эти данные могут помочь в разработке противовирусных методов лечения, включая терапию против COVID-19, путем воздействия на CT- и TM-домены гена тетерина in vivo .Такое терапевтическое средство может быть на основе антител. Фактически, антитело против BST2 ранее было разработано в качестве мощного противоракового терапевтического средства. На основании наблюдения, что повышенная активность BST2 сопровождает рак эндометрия, было разработано mAb против BST2, и в экспериментах на мышиной модели было доказано, что оно оказывает значительный противораковый эффект (Hiramatsu et al., 2015). В частности, на основании вышеизложенного и наших результатов мы предполагаем, что агент, способный связываться с TM-доменом белка тетерина, потенциально может сделать его недоступным для действия вирусных BST2-антагонистических белков, тем самым облегчая клеточный противовирусный ответ в терапии противоболочечных вирусов. .

Заявление о доступности данных

Необработанные данные, подтверждающие выводы этой статьи, будут предоставлены авторами без излишних оговорок любому квалифицированному исследователю.

Авторские взносы

AD, SB и DY разработали и разработали исследование. EG, RM и DY контролировали исследование. AD и DY составили рукопись и проанализировали данные. IG, OVP, AR, EG и RM написали, просмотрели и отредактировали рукопись. RM получил финансирование. AD, AM, IG, TT и EG проводили молекулярные эксперименты.SB, AN, AS, OGP, OVP и AR проводили вирусологические эксперименты. AD создал фигуры. OVP, AR и RM предоставили ресурсы. Все авторы прочитали и одобрили окончательную рукопись.

Финансирование

Работа поддержана Министерством науки и высшего образования Российской Федерации (договор № 075-15-2019-1665).

Конфликт интересов

Авторы заявляют, что исследование проводилось в отсутствие каких-либо коммерческих или финансовых отношений, которые могут быть истолкованы как потенциальный конфликт интересов.

Список литературы

Ариас, Дж. Ф., Ивабу, Ю., и Токунага, К. (2011). Структурная основа противовирусной активности BST-2 / tetherin и его вирусный антагонизм. Перед. Microbiol. 2: 250. DOI: 10.3389 / fmicb.2011.00250

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Блазиус, А. Л., Джурисато, Э., Селла, М., Шрайбер, Р. Д., Шоу, А. С., и Колонна, М. (2006). Антиген 2 стромальных клеток костного мозга является специфическим маркером IFN-продуцирующих клеток I типа у наивных мышей, но является антигеном беспорядочной клеточной поверхности после стимуляции IFN. J. Immunol. 177, 3260–3265. DOI: 10.4049 / jimmunol.177.5.3260

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Эриксон, Э., Адам, Т., Шмидт, С., Леманн-Кох, Дж., Овер, Б., Гоффине, К. и др. (2011). In vivo Профиль экспрессии антивирусного фактора рестрикции и опухолевого антигена CD317 / BST-2 / HM1. 24 / tetherin у человека. Proc. Natl. Акад. Sci. США 108, 13688–13693. DOI: 10.1073 / pnas.1101684108

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Гупта, Р.K., Mlcochova, P. , Pelchen-Matthews, A., Petit, S.J., Mattiuzzo, G., Pillay, D., et al. (2009). Гликопротеин оболочки вируса обезьяньего иммунодефицита противодействует тетерину / BST-2 / CD317 за счет внутриклеточной секвестрации. Proc. Natl. Акад. Sci. США 106, 20889–20894. DOI: 10.1073 / pnas.05106

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Хирамацу, К., Серада, С., Кобияма, К., Накагава, С., Моримото, А., Мацудзаки, С., и др. (2015). Олигодезоксинуклеотиды CpG усиливают противоопухолевую активность антитела против BST2. Cancer Sci. 106, 1474–1478. DOI: 10.1111 / cas.12738

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Hoffmann, M., Kleine-Weber, H., Schroeder, S., Krüger, N., Herrler, T., Erichsen, S., et al. (2020). Вход в клетки SARS-CoV-2 зависит от ACE2 и TMPRSS2 и блокируется клинически доказанным ингибитором протеазы. Ячейка 181, 271–280.e8. DOI: 10.1016 / j.cell.2020.02.052

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Хоттер, Д. , Заутер, Д., и Кирхгоф, Ф. (2013). Возникающая роль рестрикционного фактора хозяина тезерин в вирусном иммунном зондировании. J. Mol. Биол. 425, 4956–4964. DOI: 10.1016 / j.jmb.2013.09.029

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Ивабу, Ю., Фудзита, Х., Киномото, М., Канеко, К., Ишизака, Ю., Танака, Ю., и др. (2009). Вспомогательный белок ВИЧ-1 Vpu интернализует BST-2 / тетерин на клеточной поверхности посредством трансмембранных взаимодействий, ведущих к лизосомам. Дж.Биол. Chem. 284, 35060–35072. DOI: 10.1074 / jbc.M109.058305

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Мут, Д., Корман, В. М., Рот, Х., Бингер, Т., Дейкман, Р., Готтула, Л. Т. и др. (2018). Ослабление репликации из-за делеции 29 нуклеотидов в коронавирусе SARS, приобретенном на ранних стадиях передачи от человека к человеку. Sci. Rep. 8: 15177. DOI: 10.1038 / s41598-018-33487-8

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Нечаева, Е. А., Рыжиков, А. Б., Пьянкова, О. Г., Радаева, И. Ф., Пьянков, О. В. (2019). Изучение иммуногенности и защитной эффективности живой вакцины против пандемического гриппа на основе MDCK. Glob. J. Infect. Dis. Clin. Res. 5, 10–15. DOI: 10.17352 / 2455-5363.000023

CrossRef Полный текст | Google Scholar

Заутер Д., Фогл М. и Кирхгоф Ф. (2011). Древнее происхождение делеции в человеческом BST2 / tetherin, обеспечивающей защиту от вирусных зоонозов. Hum. Мутат. 32, 1243–1245. DOI: 10.1002 / humu.21571

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Ван С. М., Хуанг К. Дж. И Ван К. Т. (2019). Спайк-белок коронавируса при тяжелом остром респираторном синдроме противодействует BST2-опосредованному ограничению высвобождения вирусоподобных частиц. J. Med. Virol. 91, 1743–1750. DOI: 10.1002 / jmv.25518

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Yi, E., Oh, J., Giao, N.Q., Oh, S., и Парк, С. Х. (2017). Повышенное производство вирусов в оболочке в BST-2-дефицитных клеточных линиях. Biotechnol. Bioeng. 114, 2289–2297. DOI: 10.1002 / бит. 26338

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Ежегодная книжная ярмарка в Москве привлекает толпы, несмотря на обуздание коронавируса

Сотни москвичей в субботу собрались на книжную ярмарку под открытым небом на Красной площади, хотя некоторые издательства предпочли держаться подальше, поскольку городские власти сохраняют большинство ограничений в отношении коронавируса.

Организаторы ежегодной книжной ярмарки, в которой в прошлом году приняло участие 300 000 человек, приняли ряд мер по сдерживанию распространения вируса — с помощью стульев, расположенных на расстоянии одного метра друг от друга, и контроля температуры у входа.

«Вы либо скорбите о кризисе отрасли, либо идете и принимаете участие в книжной ярмарке, соблюдая все меры предосторожности», — сказала Наталья Эйвальд из детского издательства «Компас-Гид», одного из примерно 180 издательств, имеющих киоски в справедливый. Ей и ее коллегам пришлось сдать тесты на коронавирус перед мероприятием, которое привлекло до 600 посетителей в течение нескольких часов после его открытия.

Однако некоторые независимые издатели отказались от участия, сославшись на возможный риск для здоровья.

«Мы не хотим подвергать риску наших сотрудников и авторов, а также наших читателей», — сказал Павел Подкосов, генеральный директор издательского дома Alpina Non-Fiction, потерявшего до 60% своих доходов из-за карантин по сравнению с тем же периодом прошлого года.

«(Принять участие) было бы похоже на постановку карнавала в больничной палате, что для нас не очень весело», — добавил он.

Большинство ограничений на изоляцию будет оставаться в силе в Москве как минимум до 14 июня, а крупные публичные мероприятия по-прежнему запрещены. Поскольку Красная площадь находится под контролем федерального правительства, организованная государством книжная ярмарка смогла состояться.

Наряду с мерами социального дистанцирования и проверками температуры, надзор за безопасностью потребителей Роспотребнадзора предписал частую санацию территории книжной ярмарки и обязательное использование масок и перчаток.

Организатор мероприятия, российское государственное агентство по печати и коммуникациям, Роспечят, сказал, что это важный способ поддержки издательской индустрии.

С 1 июня в Москве разрешили жителям возобновить активный отдых и краткосрочные прогулки. Некоторые магазины, в том числе книжные, также открылись вновь.

По состоянию на субботу в России зарегистрировано около 460 000 подтвержденных случаев коронавируса, что является третьим по величине числом в мире после США и Бразилии.

В этом месяце вы исчерпали лимит бесплатных статей.

Преимущества подписки
включают
Газета сегодня

Найдите удобные для мобильных устройств версии статей из ежедневной газеты в одном удобном для чтения списке.

Безлимитный доступ

Наслаждайтесь чтением любого количества статей без каких-либо ограничений.

Персональные рекомендации

Избранный список статей, соответствующих вашим интересам и вкусам.

Более быстрые страницы

Плавно перемещайтесь между статьями, поскольку наши страницы загружаются мгновенно.

Панель приборов

Универсальный магазин для просмотра последних обновлений и управления вашими предпочтениями.

Брифинг

Мы трижды в день информируем вас о последних и наиболее важных событиях.

Поддержите качественную журналистику.

* Наши планы цифровой подписки в настоящее время не включают электронную бумагу, кроссворды и распечатку.

Россия в обзоре | Белферский центр науки и международных отношений

Россия в обзоре: дайджест полезных новостей российско-американской инициативы по предотвращению ядерного терроризма за 23-3 августа

I. Приоритеты США и России в двусторонней повестке дня.

Повестка дня в области ядерной безопасности:

  • Заключительная отгрузка низкообогащенного урана (НОУ) с Электрохимического завода (ЭХЗ) ТВЭЛ знаменует собой выполнение Россией обязательств по программе «Мегатонны в мегаватты». Соглашение между США и Россией о понижении концентрации оружейного урана истекает в конце этого года. (WNN, 29.08.13).
  • Федеральный бюджет России должен получить в общей сложности 13 миллиардов долларов валютной выручки от американо-российского соглашения ВОУ-НОУ, согласно отчету, представленному Техснабэкспортом Росатома. Только в прошлом году выручка Техснабэкспорта от экспорта по данному соглашению составила 1,033 млрд долларов, что на 2,4% больше, чем в 2011 году (Росатом.ру/Interfax, 27.08.13).
  • Соединенные Штаты и Россия работают над заключением имплементационных соглашений в отношении нового Пакта о совместном уменьшении угрозы до конца года, по словам Энн Харрингтон, заместителя администратора NNSA по оборонному ядерному нераспространению.«Условия нового соглашения удовлетворяют нас с точки зрения такого рода вещей — с точки зрения нашего доступа и ответственности там, где нам это необходимо. Я думаю, что это важный элемент нового соглашения, и новый способ ведения бизнеса на основе пирингового взаимодействия заключается в том, что мы просим все, что необходимо », — сказала она (GSN, 23. 08.13).
  • Американское разведывательное сообщество по-прежнему тратит больше денег на борьбу с ОМУ, чем на кибербезопасность, согласно «черному бюджету» сообщества в размере 52 миллиардов долларов, полученному The Washington Post от бывшего разведчика Эдварда Сноудена.Из всего бюджета 8 процентов выделено на категорию под названием «кибербезопасность». Между тем 13 процентов — или 6,76 миллиарда — уходит на противодействие распространению. (Вашингтон пост, 29.08.13).
  • Военно-воздушные силы США уволили командира подразделения, занимающегося ядерным оружием, с базы в Монтане после неудавшейся проверки безопасности и защиты, которая стала второй крупной ошибкой в ​​этом году в одной из самых ответственных военных задач. (АП, 25.08.13).

Ядерные проблемы Ирана:

  • Зенитные ракетные комплексы С-300, которые Россия планировала экспортировать в Иран, уже демонтированы и частично утилизированы, сообщил генеральный директор российского производителя вооружений «Алмаз-Антей» Владислав Меньщиков. .(Интерфакс, 29.08.13).

Сотрудничество между НАТО и Россией, включая транзит в Афганистан и из Афганистана :

  • Министерство обороны США начало уголовное расследование в отношении подразделения армейской авиации, которое заключило контракты на десятки миллионов долларов с Россией и США. фирмы по обслуживанию и ремонту вертолетов российского производства. (Рейтер, 29.08.13).

Противоракетная оборона:

  • Никаких существенных изменений.

Контроль над ядерными вооружениями:

  • Нет значительных изменений.

Сотрудничество в области борьбы с терроризмом:

  • Россия присоединилась к Соединенным Штатам и Канаде в «антитеррористических» учениях, которые, как сообщается, направлены на укрепление сотрудничества и реагирование на угон коммерческих самолетов. Истребители Объединенного командования воздушно-космической обороны США и Канады (NORAD) и ВВС России приняли участие в начавшемся в понедельник маневре под кодовым названием «Vigilant Eagle 2013». «(РИА Новости, Пресс. ТВ, 28.08.13).
  • Второй раунд антитеррористических учений между спецназовцами из России и подразделением Сухопутных сил специальных операций США запланирован на последние 10 дней августа 2013 года в Пскове. , на территории 76-й гвардейской ударно-боевой дивизии. (RBTH, 29.08.13)
  • Робель Филиппос, друг подозреваемого во взрыве Бостонского марафона Джохар Царнаев, обвинен в том, что якобы дал ложные показания следователям (RFE / RL, 08.30 .13).

Кибербезопасность:

  • Президент Владимир Путин одобрил предложение Федеральной службы безопасности о создании интегрированной сети связи в целях обороны, безопасности и правоохранительных органов, по словам источника, близкого к одному. федеральных министерств. (Коммерсант, 28.08.13).

Экспорт энергии из СНГ:

  • Нет значительных изменений.

Двусторонние экономические связи:

  • Российский надзорный орган по защите прав потребителей Роспотребнадзор обнаружил партию из 24 экземпляров. 3 тонны куриных окорочков из США, зараженных сальмонеллезом, в порту Владивостока. (Интерфакс, 29.08.13).

Другие двусторонние вопросы:

  • Президент Барак Обама встретится с президентом России Владимиром Путиным на следующей неделе на саммите G20 в Санкт-Петербурге, заявил в понедельник официальный представитель Белого дома Джей Карни, но пока неясно, проведут ли они индивидуальную встречу. . (Рейтер, 26.08.13).
  • Операции контрразведки США «стратегически сосредоточены против [] приоритетных целей Китая, России, Ирана, Кубы и Израиля», согласно U.»Черный бюджет» разведывательного сообщества С. на 2013 финансовый год, полученный The Washington Post от бывшего разведчика Эдварда Сноудена. Согласно документу, в правительства Ирана, Китая и России трудно проникнуть. В 2011 году при оценке бюджета также упоминались так называемые белые пятна, которые включают в себя то, как руководители российского правительства могут отреагировать на «потенциально дестабилизирующие события в Москве, такие как крупные протесты и террористические атаки». (Вашингтон пост, 30.08.13).
  • Перед тем, как в июне в Москву прибыл американский беглец Эдвард Сноуден, он провел несколько дней в российском консульстве в Гонконге. Сноуден изменил свои планы полета из Москвы в одну из латиноамериканских стран после того, как узнал, что Куба решила отказать в посадке самолету Аэрофлота, на борту которого он находился. (Коммерсант, Washington Post, Интерфакс, 27.08.13).
  • По итогам летних совместных российско-американских штабных миротворческих учений Atlas Vision 2013, прошедших в июле в Ауэрбахе, Германия, два офицера разведывательного подразделения российского миротворческого подразделения получили медали от губернатора американского штата Грузия.(RBTH, 29.08.13).

II. Новости России.

Внутренняя политика, экономика и энергетика:

  • Ущерб от разрушительных наводнений на Дальнем Востоке России может превысить 30 миллиардов рублей (910 миллионов долларов), сообщил заместитель полпреда президента на Дальнем Востоке Владимир Пысин. Президент России Владимир Путин прибыл в столицу Еврейской автономной области Биробиджан, где продолжает свое путешествие по регионам, пострадавшим от наводнения.(RFE / RL, 30.08.13, Интерфакс, 27.08.13).
  • Минэкономразвития снизило прогноз роста ВВП России в 2013 году с 2,4 до 1,8 процента. Заместитель министра экономического развития Андрей Клепач заявил, что новые макроэкономические прогнозы на 2013-2016 годы «существенно не позволяют выполнить ориентиры в указах (Путина)». Кроме того, прогноз роста промышленного производства снижен с 2 процентов до 0,7 процента. Оценка оттока капитала также была понижена с 30 до 70 млрд долларов.(Лента.ру, Коммерсант, 29.08.13).
  • Рост валового внутреннего продукта России может ускориться до 1,9% в третьем и 2,2% в четвертом кварталах, сообщил прессе заместитель министра экономического развития Андрей Клепач. (Интерфакс, 27.08.13).
  • Золотые резервы России — седьмые по величине — увеличились на 6,3 тонны до 1 002 тонны в июле, увеличиваясь 10-й месяц подряд, свидетельствуют данные МВФ. (Рейтер, 28.08.13).
  • Инфляция в России за первые семь месяцев 2013 года в пятнадцать раз выше, чем в среднем по Европе, увеличиваясь до 4.4% по сравнению с 0,3% в почти дефляционном ЕС. (Russia Today, 26.08.13).
  • По состоянию на вторник около миллиона иностранцев официально зарегистрированы в миграционных органах Москвы и 1,5 миллиона — в пригородах. (РИА Новости, 28.08.13).

Оборона:

  • Министерство обороны России планирует выпустить Белую книгу по национальной обороне к концу 2013 года, которая будет охватывать период, заканчивающийся в 2020 году, сообщил представитель Минобороны.(Интерфакс, 26.08.13).
  • Зенитный ракетный комплекс С-500, который будет поражать баллистические и аэродинамические цели на дальности 500 км, будет поставлен в российскую армию не позднее 2018 года, сообщил главком ВВС России. (Интерфакс, 08.70.13).

Безопасность, правоохранительные органы и правосудие:

  • Глава Совета безопасности Ингушетии Ахмед Котиев был убит ранним утром 27 августа в результате засады на машину, в которой он ехал, возле села Нижние Ачалуки. .Погиб и водитель Котиева (RFE / RL, 27.08.13).
  • Волгоградский областной суд России приговорил гражданина Грузии к четырем годам лишения свободы за активное участие в «Аль-Каиде». (RFE / RL, 28.08.13).
  • Четыре предполагаемых региональных лидера запрещенной исламской организации «Хизб ут-Тахрир» были арестованы в российской Республике Башкортостан (RFE / RL, 27.08.13).
  • Российские силовики задержали 21 предполагаемого исламского экстремиста в городе Тобольске в Западной Сибири.(RFE / RL, 29.08.13).
  • Общественные протесты в зонах повышенной безопасности в Сочи будут запрещены во время Зимних Олимпийских и Паралимпийских игр в следующем году, согласно президентскому указу, опубликованному в пятницу. (Moscow Times, 26.08.13).

Министерство иностранных дел и торговли:

  • Во время своего визита в Москву в июле глава саудовской разведки принц Бандар бин Султан обсудил с президентом России Владимиром Путиным потенциальное сотрудничество между двумя странами, если будет достигнута договоренность по ряду вопросов. вопросы, особенно Сирия.Он сказал: «Давайте посмотрим, как составить единую российско-саудовскую стратегию по нефти. Цель состоит в том, чтобы согласовать цену на нефть и объемы добычи, которые позволят сохранить стабильность цен на мировых нефтяных рынках ». Бандар также сказал: «В качестве примера я могу дать вам гарантию защиты зимних Олимпийских игр в городе Сочи на берегу Черного моря в следующем году. Чеченские группировки, которые угрожают безопасности игр, находятся под нашим контролем, и они не будут двигаться в направлении сирийской территории без согласования с нами.Эти группы нас не пугают. Мы используем их перед сирийским режимом, но они не будут иметь никакого влияния или влияния на политическое будущее Сирии ». (Аль-Монитор, 22.08.13).
  • На брифинге в Кремле в пятницу главный помощник президента Владимира Путина по внешней политике Юрий Ушаков не будет вовлечен в обсуждение возможных реакций России на западный удар. «На данный момент Россия активно работает, чтобы избежать любого сценария с применением силы», — сказал он. Об этом г-н Путин рассказал в четверг в телефонном разговоре с канцлером Германии Ангелой Меркель.(WSJ, 30.08.13).
  • Военное нападение Запада на Сирию только создаст больше проблем в регионе, приведет к еще большему кровопролитию и приведет к той же «катастрофе», что и предыдущие подобные интервенции в Ираке и Ливии, заявил в понедельник министр иностранных дел России Сергей Лавров. (Вашингтон пост, 27.08.13).
  • Министр иностранных дел России Сергей Лавров и госсекретарь США Джон Керри в телефонном разговоре поздно вечером во вторник обсудили последнюю напряженность вокруг Сирии. (Интерфакс, 08.28.13).
  • Российские официальные лица в среду обвинили западные страны в ограничении работы инспекторов Организации Объединенных Наций по вооружениям в Сирии из-за их рвения совершить нападение на Дамаск. Резолюция Великобритании в Совете Безопасности ООН, осуждающая сирийское правительство за использование химического оружия, является преждевременным, учитывая, что инспекторы в Сирии еще не отчитались о своих выводах, заявил первый заместитель министра иностранных дел России Владимир Титов (Washington Post, 29. 08. 13).
  • Президент Башар аль-Асад оплачивает свои счета за российские заказы на оружие через российскую банковскую систему, чтобы попытаться укрепить связи со своим самым могущественным союзником, по словам источника в российской военной промышленности.Источник в российской оборонной промышленности на условиях анонимности сказал, что Асад начал в последние месяцы выплачивать почти 1 миллиард долларов по контракту на четыре зенитных ракетных комплекса С-300 и еще один заказ на 550 миллионов долларов на 36 учебных самолетов Як-130. истребители. (Рейтер, 29.08.13).
  • Нападение США и их союзников на Сирию может способствовать распространению оружия массового уничтожения на Среднем и Ближнем Востоке, заявил бывший секретарь Совета безопасности России Андрей Кокошин.(Интерфакс, 30.08.13).
  • В случае военной операции в Сирии страны Запада не смогут обеспечить легкую победу, поскольку сирийские войска вооружены российскими системами ПВО «Бук-М2Е» и другими средствами ПВО, сообщил военно-дипломатический источник. (Интерфакс, 28.08.13).
  • Недопустимо обвинять сирийское руководство в применении химического оружия до завершения расследования ООН, считает Совет безопасности России. (ИТАР-ТАСС, 29.08.13).
  • Президент Ирана Хасан Рухани заявил, что его страна будет прилагать все усилия, чтобы предотвратить военные действия против президента Сирии Башара Асада.В сообщении говорится, что это заявление было сделано поздно вечером в среду во время телефонного разговора между Рухани и его российским коллегой Владимиром Путиным (AP, 29.08.13).
  • Россия отправляет два военных корабля в восточную часть Средиземного моря, сообщило в четверг агентство «Интерфакс», но Москва отрицает, что это означает, что она наращивает там свои военно-морские силы, поскольку западные державы готовятся к военным действиям против Сирии. (Рейтер, 29.08.13).
  • По данным независимого социологического опроса Левада-центра, только 8 процентов россиян обратили пристальное внимание на недавние события в Сирии, 52 процента знают о них «немного», а 39 процентов вообще ничего не знают. (РИА Новости, 30.08.13).
  • Сотрудник МИД России раскритиковал Литву за экстрадицию гражданина России Дмитрия Устинова в США по обвинению в контрабанде оружия. (RFE / RL, 29.08.13).
  • Индия готова приобрести вторую атомную подводную лодку в лизинг у России. Обе стороны провели предварительные переговоры, и ожидается серьезный толчок, когда министр обороны Индии Р.К. Матур встретится со своими российскими коллегами во время своего визита в Москву на следующей неделе.(РИР, 27.08.13).

Соседи России:

  • Президент Виктор Янукович говорит, что на референдуме нужно будет решить, присоединится ли Украина к Европейскому союзу или к Таможенному союзу под руководством России. (RFE / RL, 30.08.13).
  • Премьер-министр Украины, стремясь отразить давление России, призвал Москву в среду признать стремление его страны к новым торговым отношениям с Европейским Союзом как «реальность». (Рейтер, 28.08.13).
  • Любое давление на Украину, связанное с ее желанием подписать Соглашение об ассоциации с Европейским Союзом, недопустимо. Об этом заявил комиссар ЕС по вопросам расширения и европейской политики соседства Штефан Фюле после встречи с секретарем Совета национальной безопасности и обороны Украины Андреем Клюевым в Брюсселе. Вторник.(Интерфакс, 28.08.13).
  • Москва призвала Европейский Союз не искажать реальность, отметив, что никогда не возражала против «европейского выбора» Украины, заявил официальный представитель МИД России Александр Лукашевич (ИТАР-ТАСС, 29.08.13).
  • Первый вице-премьер России Министр Игорь Шувалов заявил, что Украина не может одновременно входить в Европейский Союз и Таможенный союз под руководством России (RFE / RL, 26.08.13).
  • Сергей Глазьев, старший советник президента России Владимира Путина предупредил Украину, что она столкнется с «катастрофой», если будет реализовывать планы более тесной интеграции с Европейским Союзом.(Россия 24 ТВ / BBC, 27.08.13).
  • Белорусские власти планируют возбудить уголовное дело в отношении Сулеймана Керимова, крупного акционера российской калийной компании «Уралкалий». 26 августа белорусские следователи возбудили уголовное дело против генерального директора российской калийной компании «Уралкалий» Владислава Баумгертнера. После ареста Баумгертнера Россия приказала сократить поставки нефти в Беларусь и поставила под сомнение санитарные стандарты импорта молочных продуктов.В пятницу Россия запретила импорт свинины из Беларуси. (RFE / RL, 30.08.13, Wall Street Journal, 29.08.13, Reuters, 30.08.13).
  • Центральная избирательная комиссия Азербайджана отказала в регистрации единому кандидату в президенты от объединенной оппозиции Рустаму Ибрагимбекову. (RFE / RL, 27.08.13).
  • Центральная избирательная комиссия Азербайджана зарегистрировала Камиля Гасанлы в качестве альтернативного кандидата в президенты от объединенной оппозиции. (RFE / RL, 29.08.13).
  • Отколовшиеся от Грузии регионы Южная Осетия и Абхазия отмечают пятую годовщину признания Россией их независимости.Президент Владимир Путин встретился со своим абхазским коллегой Александром Анквабом (RFE / RL, РИА Новости, 26. 08.13).
  • уходящий президент Грузии Михаил Саакашвили заявил, что его российский коллега Владимир Путин хочет, чтобы его посадили в тюрьму или убили, и призвал США помочь обуздать то, что он называет растущим влиянием России в его стране. (Блумберг, 26.08.13).
  • Управление по снятию с эксплуатации ядерных установок (NDA) Великобритании и Министерство энергетики США планируют переместить отработавшие тепловыделяющие сборки с ВОУ, которые в настоящее время хранятся в Даунрее, Шотландия, на площадку Саванна Ривер в Эйкене, Южная Каролина.Топливные сборки, по всей видимости, являются отработавшим топливом реактора ИРТ-М, который работал в Институте физики в Тбилиси, Грузия. (Fissilematerials.org, 30.08.13).
  • Парламент Таджикистана назначил 6 ноября датой следующих президентских выборов в стране. (RFE / RL, 30.08.13).

Если вы хотите либо отказаться от подписки, либо подписаться на Russia in Review, отправьте электронное письмо Саймону Сараджяну по телефону [email protected] harvard.edu .

Дипика Падуконе все еще имеет татуировку «РК»; была отфотошоплена старая фотография?

Инициатива местной журналистики

«Гигантский шаг»: новые предлагаемые правила предоставят больше поддержки потребителям наркотиков в общественном жилье, хотя некоторые жители обеспокоены

Toronto Community Housing Corporation предложила новую политику, которая увидит больше поддержки в ее здания для людей, употребляющих наркотики, с целью снижения передозировок, поскольку смертность от токсического действия наркотиков резко возросла по всему городу.Политика, которая, как ожидается, будет представлена ​​на рассмотрение правления TCHC 26 февраля, позволит жителям общественного жилья оказывать равную поддержку тем, кто употребляет наркотики, и гласит, что агентство не будет выселять жильцов только за употребление запрещенных веществ. Контролируемое потребление не будет разрешено, а любые новые услуги потребуют предварительного собрания по зданию. Жилищное агентство столкнулось с сопротивлением некоторых жильцов, когда оно вводило поддержку для жильцов, употребляющих наркотики раньше, и надеется, что новые правила снимут любые потенциальные проблемы.Новая политика откроет путь для поставки чистых игл, жгутов, налоксона — лекарства, используемого для лечения передозировки опиоидов — или других услуг для потребителей психоактивных веществ в объектах TCHC, что руководитель одного медицинского центра в Паркдейле назвал «гигантским шагом». ” Согласно городским данным, в Торонто за период с 2019 по 2020 год число смертей от подозреваемых передозировок опиоидов увеличилось на 90 процентов. «Мы знаем, что некоторые из этих смертельных случаев происходят в зданиях TCHC», — сказала Анджела Робертсон, исполнительный директор общественного центра здоровья Parkdale Queen West.Подразделение общественной безопасности TCHC сообщило о том, что в период с июня 2020 года по январь 2021 года налоксон вводили 14 раз. Защитники говорят, что программы снижения вреда могут помочь избавиться от зависимости и снизить смертность, но некоторые жители отказываются от услуг внутри зданий, которые, по их мнению, поощряют употребление психоактивных веществ или увеличивают его. на виду у публики. Эта напряженность обнажилась в последние годы с помощью программы снижения вреда, апробированной на TCHC, 250 Davenport Rd. По словам Криса Кинга, проживающего с 2005 года, употребление наркотиков в здании всегда было проблемой.Больше всего жалоб касалось выброшенных игл на лестницах, холлах или в лифтах. В 2018 году стартовала программа дроп-ин, где арендаторы могли избавиться от старых игл, попросить принести чистые иглы в их квартиру, взять что-нибудь поесть и узнать о других видах поддержки. Кинг хорошо знаком с зависимостью. В течение многих лет он употреблял любые вещества, для которых не требовалась игла, и помнит, как чувствовал себя «диким», поскольку его зависимость вытеснила любую заботу о себе или окружающих. Без его семьи, которая заставляла его чувствовать себя любимым и поддерживаемым, «я бы не вылез из того места, где был», — сказал он.Он считает программы снижения вреда продолжением той помощи, которую он получил, — способом обеспечить жителей TCHC, страдающих от зависимости, поддержкой и пониманием, не ожидая от них трезвости. «Наличие людей, которые понимают, кто вы и что вы, независимо от того, чем вы занимаетесь, имеет большое значение для достижения любого успеха, которого наркоман сможет избавиться от своей зависимости», — сказал Кинг. Но Шерил Циммер, другая жительница, сказала, что была возмущена, когда узнала, что пилотная программа работает с иглами. Циммер обеспокоен тем, что такие внутренние услуги могут привлечь больше наркотиков извне (новая политика запретит тем, кто осуществляет программы поддержки, пытаться оказывать услуги людям, которые не живут в зданиях TCHC), и приведет к большему использованию в местах общего пользования. .«Это тоже мой дом», — сказал Циммер. «Да, есть несколько людей с проблемами наркомании, но в большинстве зданий нет». Циммер сказала, что она опасается, что все жители TCHC рискуют быть заклейменными как «наркоманы», если их употребление станет более заметным в зданиях. Она не единственная жительница, которая обеспокоена. Группа из менее чем 10 арендаторов категорически выступила против программы, сказал менеджер TCHC Скотт Киркхэм на недавнем заседании комитета. «Было просто много эмоций и страха, управляющих определенным количеством арендаторов, и я думаю, им просто нужно было, чтобы их опасения были услышаны», — сказал сотрудник службы поддержки Мон Мартинс.Она считает, что некоторых из этого гнева можно было бы избежать, если бы они сначала провели собрание в здании, прежде чем вводить службы, как того требуют новые правила. «Мы не пытались захватить их здание и вызвать хаос», — добавил Мартинс. Сюзанна Фиш, менеджер по восстановлению в TCHC, сказала, что служба поддержки в Давенпорте регулярно принимает от 25 до 30 арендаторов — фактически, на данный момент — и привела к более чем 120 направлениям в такие службы, как продовольственные банки, юридическая помощь, а также психическое здоровье. и зависимость поддерживает.Для безопасной утилизации было собрано более 80 000 игл. Но данные о передозировках в общественных домах не отслеживаются и не передаются, что затрудняет определение того, увеличилось или уменьшилось количество смертельных случаев или где находятся горячие точки. TCHC заявила, что не собирает медицинскую информацию об арендаторах, в том числе о причинах смерти. Служба здравоохранения Торонто сообщила, что данные недоступны, хотя она публикует тепловые карты звонков парамедикам о передозировках, показывая наиболее пострадавшие районы. В другом здании TCHC по адресу 100 High Park Ave.Айе Санне, жительница и работница медицинского центра Паркдейла, сказала, что за последний год она вводила налоксон в здание примерно 10 раз, что значительно больше, чем в прошлые годы. Санне вспомнила декабрьский вечер, когда ее разбудил сильный стук. Кто-то получил передозировку несколькими этажами ниже — по крайней мере, в пятый раз, по ее подсчетам. После введения налоксона Санне вспоминает, как ее соседка оплакивала их мать. «Вы видите кого-то наиболее уязвимого», — сказала она.«Я не думаю, что люди поймут это, пока они на самом деле не появятся». По словам Саннеха, люди будут употреблять наркотики независимо от того, есть ли у них поддержка или нет. По ее мнению, поддержка уменьшает чувство стыда, связанного с употреблением наркотиков, и создает среду, в которой люди могут чувствовать себя более непринужденно, прося о помощи, не опасаясь потери дома или других последствий.

Добавить комментарий

Ваш адрес email не будет опубликован. Обязательные поля помечены *