Нанобактерии сведения за 2019 2018 годы: Бактерии из мéла

Разное

Содержание

Студенту / Новости — Казанский ГМУ

Контактный телефон —  5152685, электронный адрес — Этот адрес электронной почты защищен от спам-ботов. У вас должен быть включен JavaScript для просмотра..

Кафедра является многопрофильной и живет активной жизнью – ведет научно-исследовательскую и лечебно-профилактическую работу по очень прогрессивным направлениям современной стоматологии детского возраста – кариесологии и детской эндодонтии, детской хирургии и детской пародонтологии, ортодонтии и детскому протезированию.C 2016 года куратором студенческого научного кружка является доктор медицинских наук,  доцент Ширяк Татьяна Юрьевна. 

Староста студенческого научного кружка Садыкова Алсу Мансуровна (гр. 4403) e-mail: Этот адрес электронной почты защищен от спам-ботов. У вас должен быть включен JavaScript для просмотра., тел.: 89631259618

 

ПЛАН РАБОТЫ СНО НА 2020-2021 уч. год.docx

ПЛАН РАБОТЫ СНО НА 2019-2020 уч. год .docx

ПЛАН РАБОТЫ СНО НА 2018-2019 уч. год.docx

 

Список членов СНО 2020-2021.docx

Список членов СНО 2019-2020.docx

Список членов СНО 2018-2019.docx

Список членов СНО_2017-2018.docx

Список членов СНО 2016-2017..docx

 

Протокол заседаний СНК стоматологии детского возраста КГМУ 

Протокол заседаний СНОстоматологии детского возраста №7 от 18.12. 2020

Протокол заседаний СНОстоматологии детского возраста №6 от 17.11. 2020.docx

Протокол заседаний СНОстоматологии детского возраста №5 от 20. 10. 2020.docx

Протокол заседаний СНОстоматологии детского возраста №1 от 10 02 2020.pdf

Протокол заседаний СНО стоматологии детского возраста №4 от 26 12 2019 .docx

Протокол заседаний СНО стоматологии детского возраста №3 от 26.11.2019.pdf 

Протокол заседаний СНО стоматологии детского возраста №2 от 29.10.2019.docx

Протокол заседаний СНО стоматологии детского возраста №1 от 9.09.2019.jpeg

Протокол заседания СНО стоматологии детского возраста №6 от 24.04.2019.docx

Протокол заседания СНО стоматологии детского возраста №5 от25.03.2019.docx

Протокол заседания СНО стоматологии детского возраста №4 от  25_02_2019.docx

Протокол заседания СНО стоматологии детского возраста №3 от  19.11..2018.docx

Протокол заседания СНО стоматологии детского возраста №2 от  05.10..2018.docx

Протокол заседания СНО стоматологии детского возраста №1 от  28.09.2018.docx

Протокол заседания СНО стоматологии детского возраста №7 от  11_05_18.docx

Протокол заседания СНК стоматологии детского возраста КГМУ №6 _от 7_05_18.docx

Протокол заседания СНО стоматологии детского возраста №5  от 14_03_18.docx

Протокол заседания СНК стоматологии детского возраста КГМУ №4 от 26_12_17.docx

Протокол заседания СНК стоматологии детского возраста КГМУ №3 от 30_11_17.docx

Протокол заседания СНК стоматологии детского возраста КГМУ №2 от _31_10_17.docx

Протокол заседания СНК стоматологии детского возраста КГМУ №1 от 19.09.17.docx

Протокол заседания СНК стоматологии детского возраста КГМУ №2 от 19.12.2018.docx

 

 

Отчет СНК стоматологии детского возраста за 2018-2019.docx

Отчет СНК стоматологии детского возраста за 2017 -18.docx

Отчет СНК стоматологии детского возраста за 2016-17.docx

 

Подведены итоги работы студенческих научных кружков СНО им Студенцовой за 2019 год. СНК нашей кафедры попал в десятку лучших и получил грант за 1 место 

 

ПРИМЕР ОФОРМЛЕНИЯ СТЕНДОВОЕ ДОКЛАДА НА ФОРУМ «БЕЛЫЕ ЦВЕТЫ» 

10.02.02  прошло очередное заседание СНК кафедры стоматологии детского возраста.

 

3 Всероссийская научно-практическая конференция по стоматологии детского возраста 07.02.20. Декан стоматологического факультета ФГБОУ ВО Кировского ГМИ доцент к.м.н. Громова С.Н. со своими учениками- студентами.

 

26 декабря прошло очередное заседание научного кружка

 

ПОЗДРАВЛЯЕМ ПОБЕДИТЕЛЕЙ!!!!

23 декабря состоялась студенческая олимпиада для студентов стоматологического факультета «Детская стоматология», организованная сотрудниками кафедры стоматологии детского возраста.

Студенты продемонстрировали высокий уровень теоретических и практических знаний в вопросах стоматологии детского возраста и выразили готовность к дальнейшему изучению основ стоматологии.

Состав жюри по оценке результатов олимпиады проходившей в три этапа состоял из преподавателей кафедры: заведующего, к.м.н., доцента Сафиной Р.М., д.м.н., профессора Е.В. Мамаевой, д.м.н., доцента Т.Ю. Ширяк, к.м.н., З.Х. Яхиной и к.м.н. М.Г. Габдрахмановой.

Первое место получил студент гр. 4502 М.К. Хайруллин, второе — студент гр. 4502 И.Р. Шайхутдинов третье — А.А. Загреева  гр. 4507 и Р.Р. Сафиуллина гр 4504.

КАК ПРОХОДИЛА ОЛИМПИАДА МОЖНО ПОМОТРЕТЬ ПРОЙДЯ ПО ССЫЛКЕ В ОБЛАКЕ https://cloud.mail.ru/public/2Gjt/3Drftmyky

        

     

 

Список студентов, прошедших 1 отборочный (тестовый) тур для участия в олимпиаде по стоматологии детского возраста:

1. Арсенина Ксения  (4506)

2. Киткаева Диана (4506)

3. Загреева Айгуль (4507)

4. Ильина Кристина (4507)

5. Селезнев Данил (4503)

6. Ермакова Валерия (4503)

7. Шайхутдинов Ирек (4502)

8. Галиева Гузель (4501)

9. Шафикова Айгуль (4505)

10.Сафиуллина Резеда (4504)

11.Нгуен Тхань Тунг (4509)

12. Хайруллин Марат (4502)

 

26  ноября 2019 года прошло очередное заседание СНО кафедры в услолвиях симуляционной поликлиники

22 ноября 2019 года состоялась защита кандидатской диссертации аспиранта кафедры стоматологии детского возраста Абдрахманова Айрата Камилевича

Автореферат.pdf

Руководитель — д.м.н., профессор Мамаева Е.В.

 

Официальные оппоненты:

Николаев Александр Иванович — доктор медицинских наук, профессор, заведующий кафедрой терапевтической стоматологии федерального государственного бюджетного образовательного учреждения высшего образования «Смоленский государственный медицинский университет» Министерства здравоохранения Российской Федерации

Мандра Юлия Владимировна – доктор медицинских наук, профессор кафедры терапевтической стоматологии и пропедевтики стоматологических заболеваний федерального государственного бюджетного образовательного учреждения высшего образования «Уральский государственный медицинский университет» Министерства здравоохранения Российской Федерации

 

 

29.10.2019 состоялось очередное заседанеи СНО

 

5-6 октября 2019 года в Казанском КМУ в рамках Всероссийского фестиваля «NAUKA0+» состоялось ежегодное мотивационно-ознакомительное мероприятие «Ярмарка науки» для первокурсников и школьников медицинских классов. 65 студенческих научных кружков (СНК) знакомили студентов со своей работой и работой кафедр. Каждый СНК хотел быть лучшим и в борьбе за голос первокурсника придумывал невероятное: учил принимать роды, делать операцию на сердце, проводить лапороскопическую операцию, оказывать первую неотложную помощь, оценивать остроту зрения, шить, пломбировать, демонстрировал красивые колонии на питательных срезах, живых мышей, разные инструменты, учебные муляжи и т.д и т.п.  Посетив «Ярмарку», каждый первокурсник и школьник получил представление о том, какие научные исследования ведутся на кафедрах Казанского ГМУ, как включиться в работу студенческих научных кружков, а кураторы и старосты уникальную возможность познакомиться и пообщаться друг с другом. В жестокой конкурентной борьбе СНК нашей кафедры занял 19 место.

Ярмарка науки 2019. Рейтинг.files/detstom/14102019.pdf

 

21-22 сентября в Москве прошел VIIРоссийско-Европейский конгресс по детской стоматологии, в рамках которого представлены были постерные доклады молодых ученых (26 работ) и студентов (14 работ).

         Свои работы представили студенты и молодые ученые КГМУ: аспирант Саматова Р. З., ординатор Гамберова Ю. Р., молодые врачи: Колесникова Ю. Н., Камаева Д. Р.; студенты Загреева А. А., Ильина К. А., Латыпова З. З., Давыдова А. Д., Сафронова Д. В., Паук М. С.

Поздравляем призеров: Гамберову Ю. Р., Колесникову Ю. Н., Паук М. С. с 3 местом!!!

24 апреля состоялось очередное заседание СНО

Завершился VIМеждународный молодежный научный медицинский форум «Белые цветы» 10-12.04.2019 на котором наша кафедра представила 2 устных и 10 стендовых докладов

Фото отчет: Режим доступа: https://cloud.mail.ru/public/4bn4/2Lyf6MgBH.

ПОЗДРАВЛЯЕМ ПОБЕДИТЕЛЕЙ!

Имамиева Р.Д., Исмагилова Р.Р. Элайнеры как метод лечения ЗЧА. Клинический случай. Научный руководитель – к.м.н., асс. Яхина З.Х. (3 место)

Набиуллин Ф.З.  Сравнительный анализ стоматологич. И микробного статуса пациентов при проведении проф.гигиены современными аппаратами. Научный руководитель – к.м.н., доц. Абдрашитова А.Б. (3 место). 

Акишева А.Р., Имамиева Р.Д. ВЗАИМОСВЯЗЬ ПОЛИМОРФИЗМА ГЕНОВ IL1А И IL1B С РАЗВИТИЕМ РЕЦЕССИИ ДЕСНЫ У ДЕТЕЙ. Научный руководитель – д.м.н., проф. Мамаева Е.В. (2 место)

 

С докладом  Эффективность гроприносина при лечении острого герпетического стоматита выступила ординатор кафедры Камаева Д. Р.

 

25.04.18 прошло очередное заседание СНК кафедры.

 

 

25.02.2019 г. прошло очередное заседание СНК кафедры стоматологии детского возраста. 

 

19.12.2018 г. прошло очередное заседание СНК кафедры стоматологии детского возраста. 

 

 

19.11.2018 г. прошло очередное заседание СНК кафедры стоматологии детского возраста. 

Презентация «ПОИСК ЛИТЕРАТУРЫ ДЛЯ НАУЧНОГО ИССЛЕДОВАНИЯ»

д.м.н., доцент Ширяк Т. Ю. Режим доступа: https://cloud.mail.ru/public/FAsY/KdXfxZryt

Презентация «КАК НАПИСАТЬ НАУЧНУЮ СТАТЬЮ»
д.м.н., доцент Ширяк Т. Ю. Режим доступа: https://cloud.mail.ru/public/9rqA/eGqBfWyDL

 

11-13 октября прошла олимпиада  IX Всероссийских студенческих игр «Стоматология Юга 2018» в котором приняли участие студенты нашего университета. В номинации «детская стоматология» были даны задания: «Инвазивная герметизация фиссур»,   «Восстановление временного моляра стандартной металлической коронкой», которые достойно представили Сабирова Илюза, гр.4401 и  Фаррахова Карина, гр.4508!  Команда нашего ВУЗа стала победителем в номинации «Самая сплоченная команда».

 

 

05.10.2018 прошло второе заседание СНК, были показаны интересные мастер-классы.

 

 

 

29-30 сентября в Казанском ГМУ прошло традиционное мероприятие для студентов первого курса «Ярмарка науки — 2018». где каждый кружок имел возможность презентовать свою работу, сферы научных интересов как студентам, так и будущим абитуриентам Казанского ГМУ.  Помогли им в этом яркие стенды, макеты, мастер-классы, импровизированные костюмы, мини-лекции старост СНК и их руководителей. Наша кафедра приняла самое активное участие, предлагая студентам всех факультетов почувствовать себя на минутку стоматологом, оценить свою микрокристаллизацию и рН слюны, узнать новое для себя о профилактике кариеса зубов!

 

 

 

28.09. 18 состоялось первое заседание СНК кафедры стоматологии детского возраста.

 

 

 

План работы студенческого научного кружка кафедры стоматологии детского возраста на 2017/2018

Дата

Названиедокладов, докладчики, группа

Руководитель научной работы

1.

19.09.17

1.     Художественное моделирование первых и вторых премоляров нижней челюсти. Мастер-класс. (Калинникова Е. А., гр. 4409).

2.     Разбор клинического случая черепно-ключичного дизостоза. (ст.Камальдинова А. 4506)

3.     Обсуждение работы СНК в новом учебном году.

Ответственный д.м.н., доцент Ширяк Т. Ю.

 д.м.н, доц. Ширяк Т.Ю.

   к.м.н., Яхина З. Х

2.

31.10.16

1.     Аномалии развития твердых тканей зубов: микродентия, макродентия, сращение, слияние зубов. Клинические случаи, врачебная тактика.  1 часть (ст. Ильина К., Загреева А. гр. 4307)

2.     Возможные генетические аспекты формирования рецессии десны у детей (ст. Имамиева Р. 4403)

3.     Художественное моделирование из пластилина первого верхнего резца. Мастер-класс. (ст. Фомичева Р. Р., гр. 4506).

Ответственный д.м.н., доцент Ширяк Т. Ю.

д.м.н, проф. Мамаева Е.В.

д.м.н. Ширяк Т. Ю.

3.

11.17

Ортодонтия. Итоги и подготовка к российскому конкурсу по ортодонтии «Лучший ординатор-ортодонт РФ».  Разборы клинических случаев (Викторова Н.).

Ответственный д.м.н., профессор Хамитова Н. Х.

д.м.н., проф. Хамитова Н.Х

 

4.

30.11.17

1.       Аномалии развития твердых тканей зубов: удвоение зубов, тауродонтизм. Клинические случаи, врачебная тактика.  2 часть (ст. Ильина К., Загреева А. А. 4307)

2.       Коффердам. Мастер-класс (Татимова Н. Ю.  ордин 1 года,)

3.        Гидроксиапатит в профилактике кариеса зубов (рук. Саматова Р. З., ст.Халикова К., 4502)

4.       Лечение пациентов с дистальной окклюзией. Клинический случай (Викторова Н., молодой ученый)

Ответственный д.м.н., доцент Ширяк Т. Ю.

д.м.н Хамитова Н. Х.,

д.м.н, доц. Ширяк Т. Ю.

рук. к.м.н. Цинеккер Д. А.

асс. Саматова Р. З.

5

26.12.17

1.       Стоматологический статус детей г. Йошкар-Ола (ст. Громова О. С. гр. 4505рук. к.м.н. Габдрахманова М. Г.)

2.       Использование микроимплантов в ортодонтии (рук. к.м.н. Яхина З.Х., ст. Камальтдинова А. гр. 4506)

3.       Художественное моделирование клыка из пластилина. Мастер-класс. (ст. Колесникова Юлия, 4407)

4.       Галитоз у детей (рук. д.м.н. Ширяк Т.Ю., ст. Газизова Р., 5 курс).

Ответственный д.м.н., доцент Ширяк Т. Ю.

к.м.н., асс. Яхина З.Х.

к.м.н, доц. Ширяк Т.Ю.

к.м.н. Габдрахманова М. Г.

6.

02.18

1.       Эффективность препаратов для местного обезболивания (Калинникова Е., гр. 4409)

2.       Лечение дистальной окклюзии брекет-системой DamonQ(ст. Попов М., 4403)

3.       Матрицы и матричные системы. Мастер-класс. Гимадеева А., 4502, рук. д.м.н. Ширяк Т.Ю.)

4.    Фотодинамическая лазерная стерилизация в пародонтологии (Галимова В. ордин 1 года).

5.       Оценка эффективности консервативного лечения кариеса временных зубов с глубокими поражениями (Сергеева Ю. С., ордин. 1 года, рук. д.м.н. Ширяк Т.Ю.).

Ответственный д.м.н., доцент Ширяк Т. Ю.

д.м.н, доц. Ширяк Т. Ю.

к.м.н. Яхина З. Х.,

к.м.н. Цинеккер Д. А.)

7

03. 18

1.Оценка рецидивированияпосле лечения острого герпетического стоматита у детей (ст. Фомичева Р. Р., 4506, Камаева Д. Р. ордин. 1 года,рук. д.м.н. Ширяк Т.Ю.)

2. Трансплантация зубов (рук. к.м.н. Абдрашитова А. Б.)

3. Протезирование зубов в детском возрасте (рук. к.м.н.  Яхина З. Х., ст. Билалов Б., 4406).

4. Эффективность обезболивания пульпита временных зубов в стадии обострения. (Цветкова Анна, 4508).

5..Оценка антропогенной нагрузки тяжелыми металлами по временным зубам детей г. Сарапул. (Колесникова Юлия Николаевна, Гамберова Юлия 4407, рук. д.м.н. Ширяк Т.Ю., Саматова Р.З.)

6. Основные эссенциальныемикроэлементы в твердых тканях зубов (цинк, железо). Роль в патогенезе кариеса зубов. Содержание во временных зубах детей г. Йошкар-Олы. (Охотникова Ольга 4402, рук. д.м.н. Ширяк Т.Ю., Саматова Р. З.)

7. Тяжелые металлы в тканях зубов. Роль в патогенезе кариеса.Лепилина Арина 5 курс.

8. История развития профилактики кариеса зубов. (Самирханова Резеда 4401, рук. Саматова Р. З.)

9. Эффективность обезболивания пульпита временных зубов вне обострения (Яндиева 4406, Урманова 4405).

10. Оценка факторов риска развития патологии твердых тканей зубов детей г. Нижнекамск (Гимадиева А., 4502, рук. Саматова Р. З.)

11. Телерентгенография в ортодонтии. Мастер-класс.

Ответственный д.м.н., доцент Ширяк Т. Ю.

к.м.н, доцент Абдрашитова А.Б.

 к.м.н., асс. Яхина З.Х.

 д.м.н. Ширяк Т. Ю.,

8

05.18

Совместное заседание с кафедрой госпитальной педиатрии.

1.       Оказание первой неотложной помощи ребенку (на фантоме) (Усова Н. В., гр. 2610).

2.       Врожденные заболевания, сопровождающиеся ранней потерей зубов: гипофосфатазия, гипофосфатемический прогрессирующий рахит и др. (Охотникова О., гр. 4402)

3.     Грудное вскармливание. Взгляд педиатра и стоматолога. (Усова Н. В., гр. 2610, Гамбарова Ю., 4407).

4.     История развития зубной щетки. (Латыпова З. З. гр. 4202, рук. Габдрахманова М. Г.)

Ответственный д.м.н., доцент Ширяк Т. Ю.

д.м.н., проф. Рылова Н. В.

д.м.н. Ширяк Т. Ю.

 

11 мая 2018 прошло заключительное заседание СНО совместно с кафедрой госпитальной педиатрии.

Прошло очередное заседание СНО кафедры, с интересными докладами выступили студенты 2 и 5 курсов

20 апреля 2018 г. Калинникова Елена (гр. 4409) приняла участие в XIV Всероссийской Бурденковской научной конференции (г. Воронеж)

Кафедра стоматологии детского возраста благодарит пятикурсников, активных членов СНО, докладчиков, победителей!

         Старосту СНО Камальдинову Аделю, Гимадееву Альфию, Халикову Ксению, Попова Михаила, Фомичеву Рузану, Фомичева Константина, Махмутову Алию, Громову Ольгу, Газизову Розу, Юсупову Алину, Галиуллину Изэль, Чугунову Ольгу, Тойбердину Жанну, Богомазову Екатерину, Шарафиеву Инзилю, Абдрахманова Айдара, Савельеву Оксану,  Фатехову Рамилю, Имамиеву Резеду, Долонина Олега, Агакову Тамилу, Малаеву Айну, Адгамова Данияра и др.

Желаем найти свое место в жизни, посвятить себя любимому делу, достигать всех намеченных целей и покорить любые вершины!

 

Вечером 6 апреля 2018 состоялось торжественное награждение победителей 5 всероссийского научного медицинского форума студентов и молодых ученых с муждународным участием «Белые цветы»

Первое место в номинации «Устный доклад» заняла Махмутова Алия, представившая доклад на тему «Онкологическая настороженность на приеме врача стоматолога». Руководитель к.м.н., доцент Абдрашитова А.Б.

 

Активное участие в форуме приняла и наша кафедра, с докладами выступили и члены СНО 

Имамиева Резеда, «Определение полиморфизма гена Цитокина IL-1b у детей с рецессией десны» (руководитель д.м.н., проф. Мамаева Е.В.)

 Махмутова Алия  «Онкологическая настороженность на приеме врача стоматолога» (руководитель к.м.н., доцент Абдрашитова А.Б.)

Загреева Айгуль и Ильина Кристина «Распространенность аномалий размеров и формы зубов в г. Казань» (руководитель д.м.н., доцент Ширяк Т.Ю.)

Участники СНО кафедры представили стендовые доклады:

Стендовому докладу Абдрахманова Айдара и Рафиновой Виктории присуждено 2 место.

 

 

 

 

 

 

14.03.18 состоялось заседание студенческого научного кружка

С докладами выступили:

1.Калинникова ЕА. «Оценка эффективности аппликационных анестетиков»

2.Гимадиева А.Р. 4502 » Оценка влияния контролируемой чистки зубов на распространенность кариеса и гигиена рта детей»

4.Камальдинова А.Р. 4506 Клинический случай ретенции резца

5.Гамберова Ю.Р., Колесникова Ю.Н. «Оценка содержания тяжелых металлов во временных зубах жителей г.Нижнекамск»

 

26.12.2017 состоялось четвертое предновогоднее заседание СНО. Были представлены интересные доклады и мастер класс

30 ноября 2017 прошло третье заседание СНО кафедры стоматологии детского возраста. Были представлены научные доклады и проведен мастер-класс:

 

31 октября 2017 г. прошло второе заседание СНО кафедры стоматологии детского возраста. Были представлены научные доклады и проведен мастер-класс:

1. Загреева Айгуль, Ильина Кристина (группа 4307) «Аномалии развития твёрдых тканей зубов»

2.Имамиева Резеда (группа 4403) «Возможные генетические маркёры формирования рецессии десны»

Фомичева Рузана ((группа 4506) «Моделирование первого верхнего резца»

В заседании приняли участие студенты и ученики медицинского класса школы 179.

.

 

7-8 октября 2017 года в Казанском КМУ в рамках Всероссийского фестиваля «NAUKA0+» состоялось ежегодное мотивационно-ознакомительное мероприятие «Ярмарка науки» для первокурсников и школьников медицинских классов. С приветствием к участникам Фестиваля обратился проректор по научной инновационной работе И.Г. Мустафин. Посетив «Ярмарку», каждый первокурсник и школьник получил представление о том, какие научные исследования ведутся на кафедрах Казанского ГМУ, как включиться в работу студенческих научных кружков, а кураторы и старосты уникальную возможность познакомиться и пообщаться друг с другом.

Куратор д.м.н., доцент Ширяк Т.Ю., староста Камалетдинова А.Р., заместитель старосты Загреева А. А.

с кафедрой микробиологии

с кафедрой госпитальной педиатрии

 

Моделирование зубов

 

19 сентября состоялось первое в этом учебном году заседание СНО. 

Разбор клинического случая Калинникова Е.А. 

Мастер-класс. Художественное моделирование премоляров.

 

22 мая 2017 прошло заключительное заседание СНО в этом учебном году.

С докладами выступили:

Калинникова Е. А. (группа 4309) — Особенности оказания стоматологической помощи детям с геморрагическими васкулитами.

Попов М. (группа 4403) — Моделирование верхнего первого моляра. Мастер-класс

Кадырова Э.И. (группа 4502) — Распространенность ЗЧА среди детей в период сменного прикуса и причины его возникновения.

Камалетдинова А.Р. (группа 4406) — Обзор клинического случая черепно-ключичного дизостоза.

 

 

 

13 апреля 2017 г. состоялся IV научный медицинский форум студентов и молодых ученых с международным участием «БЕЛЫЕ ЦВЕТЫ»

Фото отчет проведение столь грандиозного мероприятия на стоматологическом факультете можно посмотреть по ссылке https://drive.google.com/drive/mobile/folders/0Bzbl0qPGncUbbTJBZkVyQ2hQYUU?usp=drive_web

Первое место было присвоено Камальдиновой Аделе — доклад «Влияние ранней потери зубов на формирование зубочелюстных аномалий» (руководитель к.м.н. Яхина З.Х.)

 

Первое место за стендовый доклад было присвоено студентке 3 курса Калинниковой Елене (руководитель к.м.н., доцент Ширяк Т.Ю.)

Второе место за стендовый доклад было присвоено студентке 4 курса Фомичевой Рузане  (руководитель к.м.н., ассистент Ахметова Г.М.)

Третье место за стендовый доклад было присвоено студентке 5 курса Кадыровой Эльвине  (руководитель к.м.н., ассистент Яхина З.Х.)

Другие стендовые доклады были не менее интересны и познавательны…

 

Процесс награждения участников и победителей был приятным…

 

 

91-я Всероссийская научно-практическая конференция студентов и молодых ученых. Стендовые доклады

План работы студенческого научного кружка кафедры стоматологии детского возраста на 2016/2017

 

Название докладов, докладчики

Руководитель научной работы

1.

31.10.16

1.      «Элайнеры» Галиуллина Изэль Рафаэлевна, 4407; Чугунова Ольга 4408.

2.      «Анализ зубных паст системы Президент» Тойбердина Жанна Геннадьевна, 4406; Богомазова Екатерина Игоревна, 4406.

3.      «Ретроспективная оценка эффективности социально-оздоровительной программы у детей младшего школьного возраста» Егорова Ангелина Владимировна, 4505.

1.      д.м.н, проф. Хамитова Н.Х.

2.      д.м.н, проф. Мамаева Е.В.

3.      к.м.н., асс. Габдрахманова М.Г.

2.

30.11.16

1.      «Применение метода фотодинамической лазерной стерилизации в практике детского врача-стоматолога» Шарафиева Инзиля Фанисовна, 4407.

2.      «Использование метагеномики в стоматологии» Абдрахманов Айдар Камилевич, 4403.

3.      «Малоинвазивные технологии лечения кариеса» Михайлова Анна, 4502.

4.      Продукция компании СOLGATE-PALMOLIVE. Зульфия Сунгатуллина.

    5.   Поиск литературы. К. м. н. Ширяк Т. Ю.

 

1.      к.м.н., асс. Цинеккер Д.А.

2.      д.м.н, проф. Мамаева Е.В.

3.      к.м.н, доц. Ширяк Т.Ю.

 

3.

26.12.16

1.      «Травматическое поражение ЗЧС в детском возрасте» Савельева Оксана Сергеевна, 4407.

2.      «ISDAS. Новая классификация кариеса» Фатехова Рамиля Хямзяевна, 4402.

3.      «Прогнозирование риска развития кариеса зубов» Силагадзе Е.М., аспирант.

4.      Современные методы диагностики начальных форм кариеса». Михайлова Анна, 4502.

5.       Реставрация постоянных моляров. Мастер-класс. Иматдинова Лилия, 4505.

 

1.      к.м.н., асс. Цинеккер Д.А.

2.      к.м.н, доц. Ширяк Т.Ю.

3.      д.м.н., проф. Ксембаев С.С.

4.

00.02.17

1.      «Влияние ранней потери зубов на формирование ЗЧА» Камальдинова Аделя Рустемовна, 4406.

2.      «Ротовое дыхание как причина развития ЗЧА» Зотова Арина Сергеевна, 4406.

3.      «Матрицы и матричные системы» Гимадеева Альфия, 4402. Мастер-класс.

4.      «Стоматологический статус детей г. Нижнекамск. Влияние экологии на стоматологическое здоровье детей», Халикова Ксения, 4402.

5.      «Обоснование комплексного лечения пародонта у подростков». Абдрахманов Айрат К. аспирант

6.        Клинический случай. Багманова Вилена К. 4309.

1.      к.м.н., асс. Яхина З.Х.

2.      к.м.н., асс. Яхина З.Х.

3.      к.м.н, доц. Ширяк Т.Ю.

4.      асс. Саматова Р.З.

5.      д.м.н., проф. Мамаева Е. В.

6.      к.м.н, доц. Ширяк Т. Ю.

 

5.

00.03.17

1.      «Профессиональные заболевания врача-стоматолога» Егорова Ангелина Владимировна, 4505.

2.      «Эффективность герметизации фиссур постоянных зубов», Габидуллина Алия В., 4501.

3.      «Анализ стоматологического статуса студентов КГМУ» Махмутова А.И., 4401.

4.       Клинический случай.

5.      Мастер-класс.

1.      к.м.н, асс. Ахметова Г.М.

2.      к.м.н, асс. Ширяк Т. Ю.

3.       к.м.н, асс. Абдрашитова А.Б.

Куратор СНК кафедры стоматологии детского возраста к.м.н., доцент Ширяк Татьяна Юрьевна

Староста СНК кафедры стоматологии детского возраста Камальдинова Аделя Рустемовна, 4406.

 

Список научно-практических тем, ищущих своего исследователя

Литературные обзоры.

1.      Аномалии развития твердых тканей зубов. (Руководитель к.м.н. Ширяк Т. Ю.)

2.      Лазеры в детской стоматологии.

3.      Изменения окраски временных зубов. (Руководитель к.м.н. Ширяк Т. Ю.)

4.      Коффердам. История. Классификация. Техника наложения. Мастер-класс.

5.      Реставрация резцов. Мастер-класс.

Научно-практические работы.

6.      Сравнительная эффективность препаратов для аппликационного обезболивания (Руководитель к.м.н. Ширяк Т. Ю.).

7.       Стоматологический статус детей г. Йошкар-Ола. Влияние экологии на стоматологическое здоровье детей. (Руководитель Саматова Р. З.)

8.      СПЛАТ «Жидкая эмаль». Оценка эффективности препарата (Руководитель Саматова Р. З.).

9.      Анализ факторов риска развития кариеса детей г. Нижнекамска по данным анкетирования (Руководитель Саматова Р. З.).

Клинические случаи № 1, №2, №3 (терапия), № 4, 5 (хирургия), № 6, № 7 (генетика).

 

Мастер класс «Еставрация верхнего первого моляра»

 

Бауэр Владлена, Мингалеева Адель — орлинаторы 1 года. Мастер-класс «Мануальные навыки вестибулопластики»

Фомичева Р.Р. группа 4406 доклад «Профессиональные заболевания врачей — стоматологов»

Габидуллина А.В., группа 4508 доклад «Оценка эффективности герметизации фиссур»

 

Камальдинова Адель, группа 4406 доклад «Влияние ранней потери зубов на формирование зубочелюстных аномалий»

23 марта 2017  состоялось очередное заседание студенческого научного кружка

 

 

 

 

Мастер-класс «Использование матриц и матричных систем»

 

.

Гимадиева А.Р. группа 4402  доклад «Матрицы и матричные системы»

 

Галиуллина Изель  группа 4407  Багманова Вилена группа 4309 клинический случай «Гипофосфатазия»

 

Кадырова Э.И. группа 4502 доклад «Обеспечение ортодонтической помощью детей и подростков РТ»

 

Халикова Ксения группа 4402 доклад «Анализ факторов риска развития кариеса зубов  детей г. Нижнекамск по данным анкетирования»

 

Михайлова Анна группа 4502 доклад «Современные методы диагностики начальных форм кариеса»

 

3 марта 2017  состоялось очередное заседание студенческого научного кружка

 

 

Мастер класс «Реставрация постоянных моляров» — Иматдинова Лиля 

Разбор клинического случая — Адгамов Данияр

Доклад «Новая классификация кариеса» — Фатехова Рамиля

Доклад «Компьютерная система диагностики пародонта» — Савельева Оксана

 

1 декабря 2016 года состоялось второе заседание студенческого научного кружка

 

«Применение метода фотодинамической лазерной стерилизации в практике детского врача-стоматолога» Шарафиева Инзиля Фанисовна, 4407. (Руководитель к.м.н.. ассистент Цинеккер Д.А.)

 «Использование метагеномики в стоматологии» Абдрахманов Айдар Камилевич, 4403. (Руководитель к.м.н., профессор Мамаева Е.В.)

 «Малоинвазивные технологии лечения кариеса» Михайлова Анна, 4502. (Руководитель к.м.н., доцент Ширяк Т.Ю.)

«Интересный клинический случай — лечение прогении при помощи брекет-систем «Damon» клинический ординатор 2 года обучения Викторова Анастасия (Руководитель д.м.н., профессор Хамитова Н.Х.)

Гостем СНО кафедры была представитель компании СOLGATE-PALMOLIVE Зульфия Сунгатуллина

 

31 октября состоялась первое в этом учебном году (2016) заседание студенческого кружкa

Доклад «Анализ зубных паст системы Президент» (Студенты Тойбердина Жанна, Богомазова Екатерина (группа 4406). Руководитель д.м.н., профессор Мамаева Е.В.)

 

Доклад «Ретроспективная оценка эффективности социально-оздоровительной программы у детей младшего школьного возраста » (Студентка Егорова Ангелина (группа 4505). Руководитель к.м.н., ассистент М.Г. Габдрахманова)

Доклад «Элайнеры» (Студенты Галиуллина Изэль (группа 4407), Чугунова Ольга (группа 4408). Руководдитель д.м.н., профессор Хамитова Н.Х.)

 

Внимание !!!

31 октября в 16.00 состоится заседание студенческого кружка

Доклад №1. «Элайнеры» Галиуллина Изэль (группа 4407), Чугунова Ольга (группа 4408).
 

Доклад №2. «Анализ зубных паст системы Президент» Тойбердина Жанна, Богомазова Екатерина (группа 4406).

Доклад №3. «Ретроспективная оценка эффективности социально-оздоровительной программы у детей младшего школьного возраста » Егорова Ангелина (группа 4505)

 

 

Достижения за 2015/2016 учебный год

Куратором кружка является медицинских наук, профессор Хамитова Наиля Ханифовна.

Староста —  Мингалеева Аделя Рафисовна (тел. 89274541151). 

Члены кружка принимают активное участие в жизни кафедры, занимаются научной работой и участвуют в различных мероприятиях — олимпиадах и конференциях…

 

Количество выступлений кружковцев на конференциях: 3

Количество публикаций: 8

Участие в различных конкурсах, олимпиадах

— Ягафарова Эльмира Альбертовна, гр.4403- победитель междисциплинарной олимпиады «Чемпионат стоматологического мастерства» среди студентов 4 курса в номинации «СТОМАТОЛОГИЯ ДЕТСКОГО ВОЗРАСТА»

— Мингалеева Аделя Рафисовна, гр. 4505- участник  IIВсероссийского этапа международного студенческого конкурса по эстетической реставрации зубов TROPHY 2016

                                                                                                                                                             

План работы СНК кафедры стоматологии детского возраста в 2015/2016 учебный год

Количество заседаний кружка в течение года: 8

Количество студентов на кружке: 15.

Список студентов, посещающих кружок

 


31 марта 2016 состоялось заседание научного кружка по госпитальной педиатрии. Студенты стоматологического факультета Егорова А.В. (гр. 4404), Борисова С.О. (гр. 4406) выступили с докладом на тему «Профилактика стоматологических заболеваний у детей»

 

 

	

 

Информационное письмо.pdf
 

  

 

           

 

 

 

8 АПРЕЛЯ 2015 ГОДА В 16.00 СОСТОЯЛСЯ КРУЖОК ПО ДИСЦИПЛИНЕ «СТОМАТОЛОГИЯ  ДЕТСКОГО ВОЗРАСТА»

БЫЛИ ПРЕДСТАВЛЕНЫ И ОБСУЖДЕНЫ ИНТЕРЕСНЫЕ  РАБОТЫ:

1. Ищенко О.А. (группа 4202). «Характеристика преимуществ использования SAF system в детской стоматологии» (Руководитель — Ширяк Т.Ю.).

2. Павлуцкая В.В. (группа 4406) «Уровень санитарно-гигиенических навыков у учащихся  школы №85» (Руководитель Ахметова Г.М.)

3. Хабибуллина А.Н. (группа 4403) «Определение жизнеспособности пульпы» (Руководитель — Ширяк Т.Ю.).

4. Малаева Айна,Акагова Тамила (группа 4202) «Сивак в профилактике стоматологических заболеваний.

 

3-4 апреля состоится Российская научно-практическая конференция «Здоровье в 21 веке».

Место проведения – зал «Лермонтов» Дата и время работы: 3 апреля, 13.00-16.30.

Стоматологическая Секция 2 представлена докладами и кафедры стоматологии детского возраста

1. Интегрированный комплексный подход к стоматологическому сопровождению детей в периоде сменного прикуса. Ксембаев С.С., д.м.н., профессор кафедры стоматологии детского возраста КГМУ. 2.  Миофункциональные нарушения у детей и подростков с патологией прикуса. Хамитова Н.Х., д.м.н., профессор кафедры стоматологии детского возраста КГМУ; Игнатьева Л.А., ординатор кафедры . 3.  Эффективность отечественных препаратов в витальной пульпотомии временных зубов.Ширяк Т.Ю., к.м.н., ассистент кафедры стоматологии детского возраста; Салеев Р.А., д.м.н., профессор; Уразова Р.З., д.м.н., профессор зав. кафедрой стоматологии детского  возраста КГМУ. 4.  Влияние миогимнастических упражнений на состояние мышечной системы челюстно-лицевой области.  Хамитова Н.Х., д.м.н., профессор кафедры стоматологии детского возраста КГМУ, Сингатуллина Э.Р., врач–ортодонт детской стоматологической поликлиники №1 5.  Новые аспекты в лечении острого герпетического стоматита у детей Тидген К.В., ординатор кафедры стоматологии детского возраста КГМУ 6.  «KaVo KEY Laser 3+» в терапии пародонта. Цинеккер Д. А., к.м.н., ассистент кафедры стоматологии детского возраста КГМУ .

26 марта  2015 года состоялась защита диссертации прикрепителя кафедры 

Шайдуллина Ильнара

«Диагностика и ранее ортодонтическое лечение зубочелюстных аномалий у детей с нарушением физического развития, проживающих в сельской местности «

научный руководитель Хамитова Наиля Ханифовна

научный консультант Мингазова Э.Р.

 

 

4 декабря 2014 года остоялось заседание кружка по дисциплине «Детская стоматология».

Ребята выступили со сложными и  интересными докладами.

 

25 сентября 2014 года состоялась защита диссертации аспиранта кафедры  

Сингатуллиной Диляры Рафаэлевны 

«Характер течения ретенционного периода у ортодонтических пациентов при различном состоянии вегетативной нервной системы «.docx   

научный руководитель Мамаева Елена Владимировна

 

4 апреля 2014 г. 

в Казани в ТРК «Корстон» состоялась

VI-й Российская научно-практическая конференция «Здоровье человека в XXI веке»,

 посвященная 200-летию со дня основания Казанского медицинского университета.

Организатор конференции – Казанский государственный медицинский университет. 

Соорганизатор: Министерство здравоохранения Республики Татарстан

Секция «Актуальные прблемы стоматологии» прошла с зале «Шостакович 2».

 

19 декабря 2013 года состоялась защита диссертации ассистента кафедры 

Цинеккер Дины Айдаровны

«Оосбенности хронического гипертрофического гингивита у подростков  13–15 лет.pdf     

научный руководитель Мамаева Елена Владимировна

 

28 ноября 2013 года состоялась защита диссертации внешего соискателя кафедры

Халиуллиной Айгуль Айдаровны

«Разработка и клинико-функциональное обоснование эффективности зубочелюстного тренажера.pdf»

научный руководитель Ксембаев Саид Сальменович

 

 

1 ноября 2013 года состоялась VI-ая  Российская научно-практическая конференция «Профилактика и лечение стоматологических заболеваний» (г.Казань, 1 ноября 2013 года).

Информационное письмо. docx

Сборник научных статей .pdf

Программа конференции.pdf

 

 

5-6 апреля 2013 года состоялась V-ая  Российская научно-практическая конференция «Здоровье человека в 21 веке» (г.Казань, 1 ноября 2013 года)

Программа конференции.pdf

 

28 марта 2013 года состоялась защита диссертации внешего соискателя кафедры

Салиховой Лилии Ирековны

«Факторы риска и характер изменений зубочелюстной системы у детей и подростков при рецессии десны».doc

научный руководитель Мамаева Елена Владимировна

 

2012 году состоялась защита диссертации внешего соискателя кафедры

Абдрашитовой Алены Борисовны

«Воздействие антисептиков в составе зубных паст на стоматологических, микробный статус и состояние местного иммунитета полости рта.doc»

научный руководитель Уразова Расима Закиевна

 

 

2012 году состоялась защита диссертации внешего соискателя кафедры

Хадыевой Мадины Наилевы

«Оптимизация комплексного лечения больных хроническим генерализованным пародонтитомdoc»

научный руководитель Ксембаев Саид Сальменович

 

 

2011 году состоялась защита диссертации внешего соискателя кафедры

Азимова Гумера Фархатовича

«Пути оптимизации индивдуальной гигиены полости рта.pdf»

научный руководитель Ксембаев Саид Сальменович


 

 

 

Геологический институт КНЦ РАН

2021

Balagansky V.V., Myskova T.A., Lvov P.A., Larionov A.N., Gorbunov I.A. Neoarchean A-type acid metavolcanics in the Keivy Terrane, northeastern Fennoscandian Shield: geochemistry, age, and origin // Lithos. 2021. 380-381. 105899. https://doi.org/10.1016/j.lithos.2020.105899

Tolstikhin I., Tarakanov S., Kolobov V., Gannibal M. Mobility of Radiogenic Helium in Amphibole // Minerals. 2021. 11. 27. https://doi.org/10.3390/min11010027

 

2020

Artyushkov E.V, Kol’ka V.V., Chekhovich P.A. The Occurrence of a Lower Viscosity Layer in the Crust of Old Cratons as a Cause of the Strongly Differentiated Character of Postglacial Uplift // Doklady Earth Sciences. 2020. V. 492. No. 1. P. 351­–355. https://doi.org/10.1134/S1028334X20050037

Arzamastsev A.A., Stepanova A.V., Samsonov A.V., Skuf’in P.K., Salnikova E.B., Larionov A.N., Larionova Yu.O., Egorova S.V., Erofeeva K. G. Mafic Magmatism of Northeastern Fennoscandia (2.06–1.86 Ga): Geochemistry of Volcanic Rocks and Correlation with Dike Complexes // Stratigraphy and Geological Correlation. 2020. V. 28. P. 1–34. https://doi.org/10.1134/S0869593820010025

Arzamastsev A.A., Egorova S.V., Erofeeva K.G., Samsonov A.V., Stepanova A.V., Skuf’im P.K., Chashchin V.V., Veselovsky R.V. Paleoproterozoic (2.51-2.40 Ga) igneous provinces of the northeastern Fennoscandia: geochemistry of volcanic rocks and correlation with intrusive complexes // Stratigraphy and Geological Correlation. 2020. Vol. 28. No. 6. P. 603–629. https://doi.org/10.1134/S08695938220060039

Baluev A.S., Morozov Y.A., Terekhov E.N., Shcherbakova T.F., Bayanova T.B., Serov P.A. Massifs of Disintegrated Granitoids in the Junction Zone of the East European and West Arctic Platforms: Composition, Age, and Hydrocarbon Potential // Geotectonics. 2020. V. 54. P. 173–187. https://doi.org/10.1134/S0016852120020028

Chashchin V.V., Bayanova T.B., Savchenko Y.E., Kiseleva D.V., Serov P.A. Petrogenesis and Age of Rocks from the Lower Zone of the Monchetundra Mafic Platinum-Bearing Massif, Kola Peninsula // Petrology. 2020. V. 28. P. 151–182. https://doi.org/10.1134/S0869591120020022

Fomina E., Kozlov E., Bazai A. Factor Analysis of XRF and XRPD Data on the Example of the Rocks of the Kontozero Carbonatite Complex (NW Russia). Part I: Algorithm // Crystals. 2020. 10 (10). 874. https://doi.org/10.3390/cryst10100874

Gannibal M.A., Kolobov V.V., Barry P.H., Tyne R.L., Tarakanov S.V., Tolstikhin I.N. Helium concentrations and isotope compositions in 10 km deep groundwaters // Chemical Geology. 2020. V. 533. 119442. https://doi.org/10.1016/j.chemgeo.2019.119442

Gurin G., Titov K., Ilyin Yu., Fomina E. Spectral induced polarization in anisotropic rocks with electrically conductive inclusions: synthetic model study // Geophysical Journal International. 2020. 224 (2). P. 871-895. https://doi.org/10.1093/gji/ggaa480

Kabanova N.A., Panikorovskii T.L., Shilovskikh V.V., Vlasenko N.S., Yakovenchuk V.N., Aksenov S.M., Bocharov V.N., Krivovichev S.V. The Na2−nHn [Zr(Si2O7)]∙mh3O Minerals and Related Compounds (n= 0–0.5; m= 0.1): Structure Refinement, Framework Topology, and Possible Na+-Ion Migration Paths // Crystals. 2020. 10 (11). 1016. https://doi.org/10.3390/cryst10111016

Kalashnikov A.O., Nikulin I.I., Stepenshchikov D.G. Unsupervised geochemical classification and automatic 3D mapping  of the  Bolshetroitskoe high-grade iron ore  deposit (Belgorod Region, Russia) // Scientific Reports. 2020. 10. 17861. https://doi.org/10.1038/s41598-020-74505-y

Kaulina T., Lyalina L., Kamenetsky V., Il’chenko V., Bocharov V., Gannibal M. Composition and Structure of Zircon from Hydrothermal Uranium Occurrences of the Litsa Ore Area (Kola Region, Russia) // Geosciences. 2020. 10. 278. https://doi.org/10.3390/geosciences10080278

Kompanchenko A. Coulsonite FeV2O4—A Rare Vanadium Spinel Group Mineral in Metamorphosed Massive Sulfide Ores of the Kola Region, Russia // Minerals. 2020. 10 (10). 843. https://doi.org/10.3390/min10100843

Kompanchenko A.A., Voloshin A.V., Bazai A.V. The mineral composition of Paleoproterozoic metamorphosed massive sulfide ores in the Kola region (a case study of the Bragino ore occurrence, Southern Pechenga) // Geology of Ore Deposits. 2020. Vol. 62. №7. PP. 618-628. https://doi.org/10.1134/S1075701520070077

Korsakova O., Tolstobrov D., Nikolaeva S., Kolka V., Tolstobrova A. Imandra Lake depression in the Late Glacial and early Holocene (Kola Peninsula, N-W Russia) // Baltica. 2020. V. 33. № 2. P.  177–190. https://doi.org/10.5200/baltica.2020.2.5

Kozlov E., Fomina E., Khvorov P. Factor Analysis of XRF and XRPD Data on the Example of the Rocks of the Kontozero Carbonatite Complex (NW Russia). Part II: Geological Interpretation // Crystals. 2020. 10 (10). 873. https://doi.org/10.3390/cryst10100873

Kozlov E., Fomina E., Sidorov M., Shilovskikh V., Bocharov V., Chernyavsky A., Huber M. The Petyayan-Vara Carbonatite-Hosted Rare Earth Deposit (Vuoriyarvi, NW Russia): Mineralogy and Geochemistry // Minerals. 2020. 10 (1). 73. https://doi.org/10.3390/min10010073

Kozlov N.E., Sorokhtin N.O., Martynov V.E. Using Petrogeochemical Modeling to Understand the Relationship between Paleozoic Magmatism in the Kola Region and Its Precambrian History // Geosciences. 2020. 10 (1). 11. https://doi.org/10.3390/geosciences10010011

Krivolutskaya N., Belyatsky B., Gongalsky B., Dolgal A., Lapkovsky A., Bayanova T.B. Petrographical and Geochemical Characteristics of Magmatic Rocks in the Northwestern Siberian Traps Province, Kulyumber River Valley. Part II: Rocks of the Kulyumber Site // Minerals. 2020. 10 (5). 415. https://doi.org/10.3390/min10050415

Kudryashov N.M., Skublov S.G., Galankina O.L., Udoratina O.V., Voloshin A.V. Abnormally high-hafnium zircon from rare-metal pegmatites of the Vasin-Mylk deposit (the northeastern part of the Kola Peninsula) // Chemie der Erde. 2020. 80(3). 125489. https://doi.org/10.3390/min10050415

Kudryashov N.M., Udoratina O.V., Coble M.A., Steshenko E.N. Geochronological and Geochemical Study of Zircon from Tourmaline-Muscovite Granites of the Archaean Kolmozero–Voronya Greenstone Belt: Insights into Sources of the Rare-Metal Pegmatites // Minerals. 2020. 10(9). 760. https://doi.org/10.3390/min10090760

Kunakkuzin E., Borisenko E., Nerovich L., Serov P., Bayanova T., Elizarov D. The Origin and Evolution of Ore-Bearing Rocks in the Loypishnun Deposit (Monchetundra Massif, NE Fennoscandian Shield): Isotope Nd-Sr and REE Geochemical Data // Minerals. 2020. 10 (3). 286. https://doi.org/10.3390/min10030286

Mikhalsky E.V., Alexeev N.L., Kamenev I.A., Larionov A.N., Gogolev M.A., Svetov S.A., Kunakkuzin E.L. Chemical Composition, U-Th-Pb Age, and Geodynamic Setting of Metavolcanic Filla Series (Rauer Islands, East Antarctica) // Geotectonics. 2020. 54. 3. 285–307. https://doi.org/10.1134/S0016852120030073

Lenz M., Savelieva L., Frolova L., Cherezova A., Moros M., Baumer M., Gromig R., Kostromina N., Nigmatullin N., Kolka V., Wagner B., Fedorov G., Melles M. Lateglacial and Holocene environmental history of the central Kola region, northwestern Russia revealed by a sediment succession from Lake Imandra // Boreas. 2020. https://doi.org/10.1111/bor.12465

Lyalina L.M., Savchenko Ye.E., Kadyrova G.I., Selivanova E.A. Meliphanite and Leucophanite from the Sakharjok Alkaline Massif, Kola Peninsula // Geology of Ore Deposits. 2020. Vol. 62. No. 8. P. https://doi.org/10.1134/S1075701520080097

Mazukhina S.I., Sandimirov S.S., Pozhilenko V.I., Gudkov A.V. The genesis of the natural water chemistry in the South-Western Khibiny Mountains (the Malaya Belaya River Basin) // Journal of Environmental Science and Health — Part A Toxic/Hazardous Substances and Environmental Engineering. 2020. 55(5) P. 511–516. https://doi.org/10.1080/10934529.2019.1710086

Mikhailova J.A., Pakhomovsky Y.A., Panikorovskii T.L., Bazai A.V., Yakovenchuk V.N. Eudialyte Group Minerals from the Lovozero Alkaline Massif, Russia: Оccurrence, Сhemical Сomposition and Petrogenetic Significance // Minerals. 2020. 10 (12). 1070 https://doi.org/10.3390/min10121070

Mikhalsky E.V., Alexeev N.L., Kamenev I.A., Larionov A.N., Gogolev M.A., Svetov S.A., Kunakkuzin E.L. Chemical Composition, U-Th-Pb Age, and Geodynamic Setting of Metavolcanic Filla Series (Rauer Islands, East Antarctica) // Geotectonics. 2020. 54. 3. 285–307. https://doi.org/10.1134/S0016852120030073

Mikhalsky E.V., Tkacheva D.A., Skublov S.G., Leitchenkov G.L., Rodionov N.V., Kapitonov I.N., Kunakkuzin E.L. Low-grade Sandow Group metasediments of the Denman Glacier area (East Antarctica): Chemical composition, age and provenance from U–Pb detrital zircon data, with some palaeotectonic implications // Polar Science. 2020. 1000587. https://doi.org/10.1016/j.polar.2020.100587

Moiseev M.M., Panikorovskii T.L., Aksenov S.M., Mazur A.S., Mikhailova J.A., Yakovenchuk V.N., Bazai A.V., Ivanyuk G.Y., Agakhanov A.A., Shilovskikh V.V., Pekov I.V., Kasatkin A.V., Rusakov V.S., Yapaskurt V.O., Karpenko V.Y., Krivovichev S.V. Insights into crystal chemistry of the vesuvianite-group: manaevite-(Ce), a new mineral with complex mechanisms of its hydration // Physics and Chemistry of Minerals. 2020. V. 47. 18. https://doi.org/10.1007/s00269-020-01086-7

Mustafaev A.A., Gertner I.F., Ernst R.E., Serov P.A., Kolmakov Yu.V. The Paleozoic-Aged University Foidolite-Gabbro Pluton of the Northeastern Part of the Kuznetsk Alatau Ridge, Siberia: Geochemical Characterization, Geochronology, Petrography and Geophysical Indication of Potential High-Grade Nepheline Ore // Minerals. 2020. 10 (12). 1128. https://doi.org/10.3390/min10121128

Nivin V. The Origin of Hydrocarbon Gases in the Lovozero Nepheline-Syenite Massif (Kola Peninsula, NW Russia), as Revealed from He and Ar Isotope Evidence // Minerals. 2020. 10 (9). 830. https://doi.org/10.3390/min10090830

Ovchinnikov R.O., Sorokin A.A., Kudryashov N.M. The First Evidence of Cambrian Granitoid Magmatism during the Formation History of the Bureya Continental Massif of the Central Asian Fold Belt // Doklady Earth Sciences. 2020. 493 (1). P. 490–494. https://doi.org/10.1134/S1028334X20070120

Ovchinnikov R.O., Sorokin A.A., Kudryashov N.M., Kovach V.P., Plotkina V, J., Skovitina T.M., Age of the early paleozoic granitoid magmatism in the central part of the Bureya continental massif, Central Asian fold belt // Geodynamics & Tectonophysics. 2020. 11(1). P. 89–106. https://doi.org/10.5800/GT-2020-11-1-0465

Petrovskiy M.N. Rare-Earth Minerals from Carbonatite Veins in the Soustov Pluton, Kola Peninsula, as an Indicator of its Ore Specialization // Geology of Ore Deposits. 2020. Vol. 62. No. 8. P. 1–10. https://doi.org/10.1134/S1075701520080127

Petrovskiy M.N. The Niz’yavr Alkaline Pluton: Age, Isotope Characteristics, and Rare-Metal Mineralization // Geology of Ore Deposits. 2020. Vol. 62. No. 7. P. 1–10. https://doi.org/10.1134/S1075701520070090

Polyak B.G., Kikvadze O.E., Ermakov A.V., Hristov V.,Kamenskii I.L., Lavrushin V.Y., Nakov R., Deneva B. Velingrad Hydrogeothermal System (Bulgaria): Geochemical Features and Heat Output // Lithology and Mineral Resources. 2020. V. 55. P. 131–138. https://doi.org/10.1134/S0024490220020078

Поляк Б.Г., Толстихин И.Н., Хуторской М.Д. Восходящий тепломассопоток в континентальной коре – к проблеме движущих сил тектогенеза // Физика Земли. 2020. № 4. С. 61–82. https://doi.org/10.31857/S0002333720030084

Pripachkin P., Rundkvist T., Groshev N., Bazai A., Serov P. Archean Rocks of the Diorite Window Block in the Southern Framing of the Monchegorsk (2.5 Ga) Layered Mafic-Ultramafic Complex (Kola Peninsula, Russia) // Minerals. 2020. 10 (10). 848. https://doi.org/10.3390/min10100848

Prokopyev I., Kozlov E., Fomina E., Doroshkevich A., Dyomkin M. Mineralogy and Fluid Regime of Formation of the REE-Late-Stage Hydrothermal Mineralization of Petyayan-Vara Carbonatites (Vuoriyarvi, Kola Region, NW Russia) // Minerals. 2020. 10 (5). 405. https://doi.org/10.3390/min10050405

Rudnev S.N., Mal’kovets V.G., Belousova E.A., Tret’yakova I.G., Serov P.A., Kiseleva V.Y., Gibsher A.A., Nikolaeva V.I. Geochemistry, Sm-Nd, Rb-Sr, and Lu-Hf Isotopes, Sources, and Conditions of Formation of Early Paleozoic Plagiogranitoids in the South of the Lake Zone in Western Mongolia // Russian Geology and Geophysics. 2020. V. 61. P. 119–138. https://doi.org/10.15372/RGG2019087

Serov P.A., Bayanova T.B., Steshenko E.N., Kunakkuzin E.L., Borisenko E.S. Metallogenic Setting and Evolution of the Pados-Tundra Cr-Bearing Ultramafic Complex, Kola Peninsula: Evidence from Sm-Nd and U-Pb Isotopes // Minerals. 2020. 10 (2). 186. https://doi.org/10.3390/min10020186

Shevtsov A.N. A Processing and Interpreting the Data of Deep Frequency Sounding in a Complex with Audiomagnetotelluric Measurements (Murman-2018 Experiment) // Seismic instruments. 2020. 56. 5. P. 568–577. https://doi.org/10.3103/S0747923920050102

Sorokhtin N.O., Lobkovsky L.I., Kozlov N.E. The Crust-Mantle Carbon Cycle and Origin of Abiogenic Hydrocarbons // Oceanology. 2020. 60. 2. 248–258. https://doi.org/10.1134/S0001437020020101

Steshenko E.N., Bayanova T.B., Serov P.A. The Paleoproterozoic Kandalaksha-Kolvitsa Gabbro-Anorthosite Complex (Fennoscandian Shield): New U-Pb, Sm-Nd, and Nd-Sr (ID-TIMS) Isotope Data on the Age of Formation, Metamorphism, and Geochemical Features of Zircon (LA-ICP-MS) // Minerals. 2020. 10 (3). 254. https://doi.org/10.3390/min10030254

Svetlov A.V., Pripachkin P.V., Masloboev V.A., Makarov D.V. Classification of Low-Grade Copper–Nickel Ore and Mining Waste by Ecological Hazard and Hydrometallurgical Processability // Journal of Mining Science. 2020. Vol. 56. No. 2. P. 275–282. https://doi.org/10.1134/S1062739120026757

Suvorova O.V., Selivanova E.A., Mikhailova J.A., Masloboev V.A., Makarov D.V. Ceramic Products from Mining and Metallurgical Waste // Applied Sciences. 2020. 10 (10). 3515. https://doi.org/10.3390/app10103515

Terekhov E.N., Bayanova T.B., Baluev A.S., Kuznetsov N.B., Shcherbakova T.F., Serov P.A. Geochemistry of Paleozoic Dolerite Dikes in the Northeastern Kola Peninsula and Their Relations to Flood-Basalt and Alkaline Magmatism // Geochemistry International. 2020. 58. 8. P. 887–902. https://doi.org/10.1134/S0016702920080091

Vetrin V.R., Belousova E.A. The Lu–Hf isotope composition of zircons from syenites of the Saharjok alkaline massif, Kola Peninsula // Geology of Ore Deposits. 2020. Vol. 62. No. 7. P. 574-583. https://doi.org/10.1134/S1075701520070132

Vetrin V.R., Kremenetsky A.A. Lu–Hf Isotope-Geochemical Zircon Systematics and Genesis of the Neoarchean Alkaline Granites in the Keivy Megablock, Kola Peninsula // Geochemistry International. 2020. V. 58. P. 624–638. https://doi.org/10.1134/S0016702920060129

Voytekhovsky Y.L., Stepenshchikov D.G. On the real combinations of cubes and octahedra // Acta Crystallographica A-Foundation and Advances. 2020. V. 76. P. 206–210. https://doi.org/10.1107/S2053273319015821

Yadav B.S., Ahmad T., Kaulina T., Bayanova T., Bhutani R. Origin of post-collisional A-type granites in the Mahakoshal Supracrustal Belt, Central Indian Tectonic Zone, India: Zircon U-Pb ages and geochemical evidences // Journal of Asian Earth Sciences. 2020. 191. 104247. https://doi.org/10.1016/j.jseaes.2020.104247

Zhamaletdinov A.A. A Method for Quantifying Static Shift Distortions Using a Magnetic Field of Controlled Source (CSAMT) // Seismic instruments. 2020. 56. 5. P. 555–563. https://doi.org/10.3103/S0747923920050138

Zhitova E.S., Greenwell H.C., Krzhizhanovskaya M.G., Apperley D.C., Pekov I.V., Yakovenchuk V.N. Thermal Evolution of Natural Layered Double Hydroxides: Insight from Quintinite, Hydrotalcite, Stichtite, and Iowaite as Reference Samples for CO3- and Cl-Members of the Hydrotalcite Supergroup // Minerals. 2020. 10 (11). 961. https://doi.org/10.3390/min10110961

Zozulya D.R., Kullerud K., Ribacki E., Altenberger U., Sudo M., Savchenko Y.E. The Newly Discovered Neoproterozoic Aillikite Occurrence in Vinoren (Southern Norway): Age, Geodynamic Position and Mineralogical Evidence of Diamond-Bearing Mantle Source // Minerals. 2020. 10 (11). 1029. https://doi.org/10.3390/min10111029

Zozulya D., Macdonald R., Bagiński B. REE fractionation during crystallization and alteration of fergusonite-(Y) from Zr-REE-Nb-rich late- to post-magmatic products of the Keivy alkali granite complex, NW Russia // Ore Geology Reviews. 2020. 125. https://doi.org/10.1016/j.oregeorev.2020.103693

 

2019

Bayanova T.Korchagin A., Mitrofanov A., Serov P., Ekimova N.Nitkina E.Kamensky I.Elizarov D., Huber M. Long-lived mantle plume and polyphase evolution of Palaeoproterozoic PGE intrusions in the Fennoscandian Shield // Minerals. 2019. 9 (1). 59. https://doi.org/10.3390/min9010059

Borisova V.V.Voloshin A.V.Kompranchenko A. A.Selivanova E.A.Basay A. V. Namibite from Alakurtti Pegmatites, Kola Region // Geology of Ore Deposits. 2019. Vol. 61. 7. P. 1–7. https://doi.org/10.1134/S1075701519070043

Chashchin V.V.Savchenko Ye.E., Lyulko M.S. Deep-Seated Xenolith of the Platinum-Bearing Websterite from the Paleoproterozoic Volchetundra Gabbro–Anorthosite Massif in the Kola Region // Doklady Earth Sciences. 2019. V. 486. 1. P. 477–480. https://doi.org/10.1134/S1028334X19050015Чащин В.В.Савченко Е.Э.Люлько М.С. Глубинный ксенолит платиноносного вебстерита из палеопротерозойского Волчьетундровского габбро-анортозитового массива в Кольском регионе // Доклады Академии наук. 2019. Т. 486. № 1. С. 78–82. https://doi.org/10.31857/S0869-5652486178-82

Fomina E.Kozlov E., Ivashevskaja S. Study of diffraction data sets using factor analysis: a new technique for comparing mineralogical and geochemical data and rapid diagnostics of the mineral composition of large collections of rock samples // Powder Diffraction. 2019. 34. P. S59–S70. https://doi.org/10.1017/S0885715619000435

Fomina E., Kozlov E., Lokhov K., Lokhova O., Bocharov V. Carbon Sources and the Graphitization of Carbonaceous Matter in Precambrian Rocks of the Keivy Terrane (Kola Peninsula, Russia) // Minerals. 2019. 9 (2). 94. https://doi.org/10.3390/min9020094

Frank-Kamenetskaya O.V., Ivanyuk G.Y., Zelenskaya M.S., Izatulina A.R., Kalashnikov A.O., Vlasov D.Y., Polyanskaya E.I. Calcium Oxalates in Lichens on Surface of Apatite-Nepheline Ore (Kola Peninsula, Russia) // Minerals. 2019. 9 (11). 656. https://doi.org/10.3390/min9110656

Gavryushkina О.А., Kruk N.N., Semenov I.V., Vladimirov A.G., Kuibida Y.V., Serov P.A. Petrogenesis of Permian-Triassic intraplate gabbro-granitic rocks in The Russian Altai // Lithos. 2019. Vol. 326. P. 71–89. https://doi.org/10.1016/j.lithos.2018.12.016

Gorbatsevich F.F. On the Problem of Elastic Anisotropy Estimation in the Rocks with Quasi Orthotropic Symmetry // Izvestiya, Physics of the Solid Earth. 2019. 55. P. 927–935. https://doi.org/10.1134/S1069351319060016 Горбацевич Ф.Ф. К проблеме оценки упругой анизотропии горных пород квазиортотропной симметрии // Физика Земли. 2019. № 6. С. 130–139. https://doi.org/10.31857/S0002-333720196130-139

Groshev N.Y., Karykowski B.T. The Main Anorthosite Layer of the West-Pana Intrusion, Kola Region: Geology and U-Pb Age Dating // Minerals. 2019. 9 (2). 71. https://doi.org/10.3390/min9020071

Groshev N.Y., Rundkvist T.V., Karykowski B.T., Maier W.D., Korchagin A.U., Ivanov A.N., Junge M. Low-sulfide Platinum-Palladium Deposits of the Paleoproterozoic Fedorova-Pana Layered Complex, Kola Region, Russia // Minerals. 2019. 9 (12). 764. https://doi.org/10.3390/min9120764

Gudkov A.V., Kolobov V.V., Tarakanov S.S., Tolstikhin I.N. Mobility of Radiogenic Isotopes He-4 and He-3 and Their Retention in a Mineral (by the Example of Amphibole) // Doklady Earth Sciences. 2019. Vol. 488. Part 2. P. 1193–1195. https://doi.org/10.1134/S1028334X19100118 Гудков А.В., Колобов В.В., Тараканов С.В., Толстихин И.Н. Подвижность радиогенных изотопов 4Hе и 3Hе и их сохранность в минерале (на примере амфибола) // Доклады Академии наук. 2019. Т. 488. 5. С. 517–520. https://doi.org/10.31857/S0869-56524885517-520

Hannibal A.E. On the Possibility of Using Artificial Neural Networks in Seismic Monitoring Tasks // Seismic Instruments. 2019. 55. 3. P. 334–344. https://doi.org/10.3103/S074792391903006X

Il’chenko V.L., Gannibal M.A. Elastic Anisotropy and Internal Structure of Rocks from the Uranium Ore Occurrences of the Litsa Ore Area (Kola Region, Russia) // Geosciences. 2019. V. 9 (7). UNSP 284. P. 284–295. https://doi.org/10.3390/geosciences9070284

Ivanyuk G.Y.Yakovenchuk V.N., Panikorovskii T.L., Konoplyova N., Pakhomovsky Y.A.Bazai A.V., Bocharov V.N., Krivovichev S.V. Hydroxynatropyrochlore, (Na,Сa,Ce) 2 Nb 2 O 6 (OH), a new member of the pyrochlore group from the Kovdor phoscorite–carbonatite pipe, Kola Peninsula, Russia // Mineralogical Magazine. 2019. 83. P. 107–113. https://doi.org/10.1180/minmag.2017.081.102

Kalinin A.A., Kazanov O.V., Bezrukov V.I., Prokofiev V.Y. Gold Prospects in the Western Segment of the Russian Arctic: Regional Metallogeny and Distribution of Mineralization // Minerals. 2019. 9 (3). 137. https://doi.org/10.3390/min9030137

Kalinin A.A., Savchenko Y.E., Selivanova E.A. Mustard Gold in the Oleninskoe Gold Deposit, Kolmozero–Voronya Greenstone Belt, Kola Peninsula, Russia // Minerals. 2019. 9 (12). 786. https://doi.org/10.3390/min9120786

Kolesnikov V.E., Nilov M.Yu., Zhamaletdinov A.A. Multi-Electrode Electrical Profiling Results in the Northern Ladoga Area // Practical and Theoretical Aspects of Geological Interpretation of Gravitational, Magnetic and Electric Fields / Ed.: Nurgaliev D., Khairullina N. Springer Proceedings in Earth and Environmental Sciences. Cham: Springer Nature Switzerland AG. 2019. P. 321–329. https://doi.org/10.1007/978-3-319-97670-9_37

Kolka V.V.Korsakova O.P., Lavrova N.B., Shelekhova T.S., Zaretskaya N.E. Lithology, Biostratigraphy, and Geochronology of the Late Pleistocene–Holocene Sediments on the Coast of Onega Bay of the White Sea // Doklady Earth Sciences. 2019. Vol. 485. Part 1. P. 312–316. https://doi.org/10.1134/S1028334X19030115 Колька В.В.Корсакова О.П., Лаврова Н.Б., Шелехова Т.С., Зарецкая Н.Е. Литология, биостратиграфия и геохронология позднеплейстоцен-голоценовых осадков на побережье Онежского залива Белого моря // Доклады Академии наук. 2019. Т. 485. № 2. С. 221–225. https://doi.org/10.31857/S0869-56524852221-225

Korsakova O. Formal stratigraphy of the Neopleistocene (Middle and Upper/Late Pleistocene) in the Kola region, NW Russia // Quaternary International. 2019. https://doi.org/10.1016/j.quaint.2019.03.007

Korsakova O., Molodkov A., Yelovicheva Ya., Kolka V. Middle Pleistocene marine deposits on the Kola Peninsula (NW Russia) // Quaternary International. 2019. V. 509. P. 3–16. https://doi.org/10.1016/j.quaint.2018.09.019

Krivovichev S.V., Yakovenchuk V.N., Panikorovskii T.L., Savchenko E.E., Pakhomovsky Ya.A., Mikhailova Yu.A.Selivanova E.A., Kadyrova G.I., Ivanyuk G.Yu. Nikmelnikovite, Ca12Fe2+Fe33+Al3(SiO4)6(OH)20: A New Mineral from the Kovdor Massif (Kola Peninsula, Russia) // Doklady Earth Sciences. 488(2). P. 1200–1202. https://doi.org/10.1134/S1028334X19100143

Kruk N.N., Gvozdev V.I., Orekhov A.A., Kruk E.A., Kasatkin S.A., Golozubov V.V., Rudnev S.N., Aoki S., Komiya T.I., Kovach V.P., Serov P.A. Early Cretaceous Granitic and Monzonitic Rocks of the Southern Part of the Zhuravlevka Terrane (Sikhote-Alin): Geochemical Composition and Melt Sources // Russian Journal of Pacific Geology. 2019. 13. 3. P 220–238. https://doi.org/10.1134/S1819714019030047КрукН.Н., ГвоздевВ.И., ОреховА.А., КрукЕ.А., КасаткинС.А., ГолозубовВ.В., РудневС.Н., ШогоАоки, ЦуйошиКомия, КовачВ.П., СеровП.А.РаннемеловыегранитоидыимонцонитоидыюжнойчастиЖуравлевскоготеррейна (Сихотэ-Алинь): геохимическиеособенностииисточникирасплавов // Тихоокеанскаягеология. 2019. Т. 38. № 3. С. 38–57. https://doi.org/10.30911/0207-4028-2019-38-3-30-49

Kudryashov N.M., Udoratina O.V., Coble M.A. Isotope-geochronological (SHRIMP-RG) studies of zircon from muscovite-tourmaline granites of the Kolmozero-Voronya greenstone belt: insights for sources of rare metal pegmatites // IOP Conference Series: Earth and Environmental Science. 2019. 319. 012013. https://doi.org/10.1088/1755-1315/319/1/012013

Kuznetsov A.B., Lobach–Zhuchenko S.B., Kaulina T.V., Konstantinova G.V. Paleoproterozoic Age of Carbonates and Trondhjemites of the Central Azov Group: Sr Isotope Chemostratigraphy and U–Pb Geochronology // Doklady Earth Sciences. 2019. Vol. 484. Issue 2. P. 142–145. https://doi.org/10.1134/S1028334X19020211 Кузнецов А.Б., Лобач-Жученко С.Б., Каулина Т.В., Константинова Г.В. Палеопротерозойский возраст карбонатных пород и трондьемитов центральноприазовской серии: Sr-изотопная хемостратиграфия и U-Pb геохронология // Доклады Академии наук. 2019. Т. 484. № 6. C. 725–728. https://doi.org/10.31857/S0869-56524846725-728

Lobach-Zhuchenko S.B., Kaulina T.V., Marin Yu.B., Yurchenko A.V., Skublov S.G., Egorova Yu.S., Galankina O.L., Sergeev S.A. Paleoarchean U–Pb (SIMS SHRIMP-II) Age of Mafic Granulites from the Bug Complex, Ukrainian Shield // Doklady Earth Sciences. 2019. Vol. 484. Issue 1. P. 101–104. https://doi.org/10.1134/S1028334X19010240 Лобач-Жученко С.Б., Каулина Т.В., Марин Ю.Б., Юрченко А.В., Скублов С.Г., Егорова Ю.С., Галанкина О.Л., Сергеев C.А. Палеоархейский U-Pb (SIMS SHRIMP-II) возраст мафических гранулитов Побужского комплекса Украинского щита // Доклады Академии наук. 2019. Т. 484. № 3. С. 344-347. https://doi.org/10.31857/S0869-56524843344-347

Lyalina L.M., Kadyrova G.I., Selivanova E.A., Zolotarev Jr. A.A., Savchenko Y.E., Panikorovskii T.L. On Composition of Meliphanite from Nepheline Syenite Pegmatite of Sakharjok Massif, Kola Peninsula // Geology of Ore Deposits. 2019. 61. https://doi.org/10.1134/S1075701519070092

Lyalina L.M., Kamensky I.L., Tolstikhin I.N. Origin, occurrence, and mobility of He and Ar isotopes in meliphanite // Doklady Earth Sciences. 2019. Vol. 488, Part 1, P. 1120–1122. https://doi.org/10.1134/S1028334X19090277 Лялина Л.М., Каменский И.Л., Толстихин И.Н. Происхождение, места нахождения и подвижность изотопов гелия и аргона в мелифаните // Доклады Академии наук. 2019. Т. 488. № 3. С. 303–306. https://doi.org/10.31857/S0869-56524883303-306

Lyalina L.M.Selivanova E.A.Zozulya D.R.Ivanyuk G.Yu. Beryllium Mineralogy of the Kola Peninsula, Russia – A Review // Minerals. 2019. 9 (1). 12. https://doi.org/10.3390/min9010012

Mazukhina S., Tereshchenko P., Drogobuzhskaya S., Pozhilenko V. The speciation of chemical elements in water and their possible impact on human health // 16th International Symposium on Water-Rock Interaction (Wri-16) and 13th International Symposium on Applied Isotope Geochemistry (1st IAGC International Conference). E3S Web of Conferences. 2019. 98. 07017. https://doi.org/10.1051/e3sconf/20199807017

Mikhailova Ju.A.Ivanyuk G.Yu.Kalashnikov A.O.Pakhomovsky Ya.A.Bazai A.V.Yakovenchuk V.N. Petrogenesis of the Eudialyte Complex of the Lovozero Alkaline Massif (Kola Peninsula, Russia) // Minerals. 2019. 9 (10). 581 (31). https://doi.org/10.3390/min9100581

Mikhalsky E.V., Alexeev N.L., Kamenev I.A., Egorov M.S., Kunakkuzin E.L. Mafic dykes in the Rauer Islands and Vestfold Hills (East Antarctica): A chemical and Nd isotopic comparison // Precambrian Research. 2019. 329. P. 273–293. https://doi.org/10.1016/j.precamres.2018.11.014

Neradovsky Yu.N., Alekseeva S.A., Chernousenko E.V. Mineralogy and process properties of Kolvitsky titanomagnetite ore// IOP Conference Series: Earth and Environmental Science. 2019. 262. UNSP 012050 https://doi.org/10.1088/1755-1315/262/1/012050

Nikolaeva S., Tolstobrov D., Tolstobrova A. Disturbances in the primary stratigraphy of lake sediments on the Murmansk coast (Russia): their identification and relationship with catastrophic events // Baltica. 2019. 32 (2). P. 156–169. https://doi.org/10.5200/baltica.2019.2.3

Nitkina E.A., Kozlov N.E., Kozlova N.E., Kaulina T.V. Geochemical features and geological processes timescale of the Achaean TTG complexes of the Ingozero massif and the Pechenga frame (NE Baltic Shield) // Minerals. 2019. 9 (12). 767. https://doi.org/10.3390/min9120767

Nivin V.A. Occurrence forms, composition, distribution, origin and potential hazard of natural hydrogen–hydrocarbon gases in ore deposits of the Khibiny and Lovozero massifs: a review // Minerals. 2019. 9 (9). 535. https://doi.org/10.3390/min9090535

Nozhkin A.D., Likhanov I.I., Savko K.A., Krylov A.A., Serov P.A. Sapphirine-Bearing Granulites of the Anabar Shield // Geochemistry International. 2019. 57. 5. P. 524–539. https://doi.org/10.1134/S0016702919050070 Ножкин А.Д., Лиханов И.И., Савко К.А., Крылов А.А., Серов П.А. Сапфиринсодержащие гранулиты Анабарского щита // Геохимия. 2019. Т. 64. № 5. С. 486–502. https://doi.org/10.31857/S0016-7525645486-502

Raevsky A.B., Balagansky V.V., Rundkvist O.V., Mudruk S.V.An Iterative Solution of the 2-D Non-Linear Magnetic Inversion Problem with Particular Attention to the Anisotropy of Magnetic Susceptibility of Rocks // Practical and Theoretical Aspects of Geological Interpretation of Gravitational, magnetic and Electric Fields / Ed.: Nurgaliev D., Khairullina N. Springer Proceedings in Earth and Environmental Sciences. Cham: Springer Nature Switzerland AG. 2019. P. 213–221. DOI: 10.1007/978-3-319-97670-9_25

Raevsky A.B., Mudruk S.V., Balagansky V.V., Rundkvist O.V.Reconstructing the shape of large synforмлн лет, l folds based on the solution of the 2D non-linear magnetic inverse problem // Tectonophysics. 2019. V. 754. P. 33–44. https://doi.org/10.1016/j.tecto.2019.02.001

Sanko A., Motuzko A., Vashkov A., Dubman A., Koloshich S., Trifonov Y. Quaternary key-site Korchevo in Belarus: geology, paleontology and correlation // Quaternary International. 2019. https://doi.org/10.1016/j.quaint.2019.09.015

Shevtsov A.N. Joint Interpretation of Magnetotelluric and CSAMT Data on the Kola Peninsula (Kovdor Area) // Practical and Theoretical Aspects of Geological Interpretation of Gravitational, Magnetic and Electric Fields / Ed.: Nurgaliev D., Khairullina N. Springer Proceedings in Earth and Environmental Sciences. Cham: Springer Nature Switzerland AG. 2019. P. 23–30. https://doi.org/10.1007/978-3-319-97670-9_3

Skorokhodov A.A., Zhamaletdinov A.A. Computer Modeling of Lateral Influence of the Ladoga Anomaly (Janisjarvy Fault Zone) on the AMT Sounding Results // Practical and Theoretical Aspects of Geological Interpretation of Gravitational, Magnetic and Electric Fields / Ed.: Nurgaliev D., Khairullina N. Springer Proceedings in Earth and Environmental Sciences. Cham: Springer Nature Switzerland AG. 2019. P. 181–186 https://doi.org/10.1007/978-3-319-97670-9_21

Subbotin V.V., Vymazalova A., Laufek F., Savchenko Y.E., Stanley C.J., Gabov D.A., Plašil J. Mitrofanovite, Pt3Te4, a new mineral from the East Chuarvy deposit, Fedorovo-Pana intrusion, Kola Peninsula, Russia // Mineralogical Magazine. 2019. Vol. 83. P. 523–530. https://doi.org/10.1180/mgm.2018.150

Vetrin V.R. Isotopic-Geochemical Systematics (Sm–Nd, Lu–Hf) of Neoarchean Subalkaline and Alkaline Rocks of the Keivy Structure (Kola Peninsula): their Age and Genetic Relations // Geology of Ore Deposits. 2019. V. 61. No. 7. P. 1–8. https://doi.org/10.1134/S1075701519070146

Vetrin V.R. Parental Melts of Neoarchean Subalkaline Magmatic Rocks of the Keivy Structure (Kola Peninsula) // Doklady Earth Science. 2019. V. 488. Part 1. P. 1059–1062. https://doi.org/10/1134/S1028334X19090095Ветрин В.Р. Источники вещества неоархейских субщелочных магматических пород Кейвской структуры (Кольский полуостров) // Доклады АН. 2019. Т. 488. № 1. С. 595–598. https://doi.org/10.31857/S0869-5652488167-70

Yakovenchuk V.N.Pakhomovsky Ya.A., Panikorovskii T.L., Zolotarev A.A., Mikhailova Ju.A., Bocharov V.N., Krivovichev S.V., Ivanyuk G.Yu. Chirvinskyite, (Na,Ca)13(Fe,Mn,□)2(Ti,Nb)2(Zr,Ti)3(Si2O7)4(OH,O,F)12·2H2O, a new mineral with the new kind of wallpaper structure, from the Khibiny alkaline massif (Kola Peninsula, Russia) // Minerals. 2019. 9 (4). 219 (15). https://doi.org/10.3390/min9040219

Zaretskaya N.E. Korsakova O.P., Panin A.V. Marine Isotopic Stage 3 in Northeastern Europe: geochronology and events // Russian Geology and Geophysics. 2019. V. 60. No. 8. P. 911–925. https://doi.org/10.15372/RGG2019056 Зарецкая Н.Е., Корсакова О.П., Панин А.В. МИС 3 на Северо-Востоке Европы: геохронология и событийность // Геология и геофизика. 2019. Т.60. № 8. С. 1153–1170. https://doi.org/10.15372/GiG2019056

Zhamaletdinov A.A. Intermediate Conducting Layers in the Continental Earth’s Crust — Myths and Reality // Practical and Theoretical Aspects of Geological Interpretation of Gravitational, Magnetic and Electric Fields / Ed.: Nurgaliev D., Khairullina N. Springer Proceedings in Earth and Environmental Sciences. Cham: Springer Nature Switzerland AG. 2019. P. 349–358. https://doi.org/10.1007/978-3-319-97670-9_40

Zhamaletdinov A.A. Study of the Cu-Ni Productive Suite of the Pechenga Structure on the Russian-Norway Border Zone with the Use of MHD Installation “Khibiny” // Minerals. 2019. 9 (2). 96. https://doi.org/10.3390/min9020096

Zhamaletdinov A.A., Petrishchev M.S., Semenov V.Yu. Two Approaches to the Solution of Inversion Problem in the Bear Experiment. // Practical and Theoretical Aspects of Geological Interpretation of Gravitational, Magnetic and Electric Fields / Ed.: Nurgaliev D., Khairullina N. Springer Proceedings in Earth and Environmental Sciences. Cham: Springer Nature Switzerland AG. 2019. P. 133–140 https://doi.org/10.1007/978-3-319-97670-9_15

Zhamaletdinov A.A., Rokityansky I.I., Sokolova E.Yu. Evolution of Ideas on the Nature and Structure of Ladoga Anomaly of Electrical Conductivity // Practical and Theoretical Aspects of Geological Interpretation of Gravitational, Magnetic and Electric Fields / Ed.: Nurgaliev D., Khairullina N. Springer Proceedings in Earth and Environmental Sciences. Cham: Springer Nature Switzerland AG. 2019. P. 197-206 https://doi.org/10.1007/978-3-319-97670-9_23

Zhamaletdinov A.A., Velikhov E.P., Shevtsov A.N., Skorokhodov A.A., Kolobov V.V., Ivonin V.V., and Kolesnikov V.V. The Murman-2018 Experiment on Remote Sensing in Order to Study the “Impenetrability” Boundary at the Transition between Brittle and Plastic States of the Crystalline Earth’s Crust // Doklady Earth Sciences. 2019. Vol. 486. Part 1. P. 575–579. https://doi.org/10.1134/S1028334X19050301 Жамалетдинов А.А. Велихов Е.П., Шевцов А.Н., Скороходов А.А., Колобов В.В., Ивонин В.В., Колесников В.В. Эксперимент “Мурман-2018” по дистанционному зондированию с целью исследования границы “непроницаемости” на переходе между хрупким и пластичным состояниями кристаллической земной коры // Доклады Академии наук. 2019. Т. 486. № 3. С. 91–96. https://doi.org/10.31857/S0869-56524863359-364

Zozulya D.Lyalina L., Macdonald R., Bagiński B., Savchenko Ye., Jokubauskas P. Britholite Group Minerals from REE‐Rich Lithologies of Keivy Alkali Granite—Nepheline Syenite Complex, Kola Peninsula, NW Russia // Minerals. 2019. 9 (17). 732. https://doi.org/10.3390/min9120732

Левашова Е.В., Возняк Д.К., Скублов С.Г., Каулина Т.В., Кульчицкая А.А., Галанкина О.Л. Геохимия расплавных включений в цирконе из Азовского Zr-REE месторождения (Украинский щит) // Мінералогічний журнал. 2019. Т. 41. № 2. С. 45–61. https://doi.org/10.15407/mineraljournal.41.02.045Levashova E.V., Voznyak D.K., Skublov S.G., Kaulina T.V., Kulchytska H.O., Galankina O.L. Geochemistry of melt inclusions in zircon from Azov Zr-REE deposit (Ukrainian Shield) // Mineralogical Journal-Ukraine. 2019. 41. 2. P. 45–61. https://doi.org/10.15407/mineraljournal.41.02.045

Николаева С.Б. Послеледниковая тектоника и палеосейсмодислокации в районе «Ковды» (Кандалакшский залив, восточная часть Фенноскандинавского щита) // Вестник Санкт-Петербургского университета. Науки о Земле. 2019. Т. 64. Вып. 3. С. 434–453. https://doi.org/10.21638/spbu07.2019.304

 

 

2018

Astafieva M.M., Balaganskii V.V. Keivy Paraschists (Archean–Early Proterozoic): Nanobacteria and Life // Stratigraphy and Geological Correlation. 2018. V. 26. No. 3. P. 354–363. https://doi.org/10.1134/S0869593818030024 Астафьева М.М., Балаганский В.В. Кейвские парасланцы (архей–ранний протерозой), нанобактерии и жизнь // Стратиграфия. Геологическая корреляция. 2018. Т. 26. № 3. С. 117–126. https://doi.org/10.7868/S0869592X18030080

Chanturiya V.A., Minenko V.G., Makarov D.V., Suvorova O.V., Selivanova E.A. Advanced Techniques of Saponite Recovery from Diamond Processing Plant Water and Areas of Saponite Application // Minerals. 2018. 8 (12). 549. https://doi.org/10.3390/min8120549

Chashchin V.V., Petrov S.V., Drogobuzhskaya S.V. Loypishnyun Low-Sulfide Pt-Pd Deposit of the Monchetundra Basic Massif, Kola Peninsula, Russia // Geology of Ore Deposits. 2018. Vol. 60. No. 5. P. 418–448. https://doi.org/10.1134/S1075701518050021 Чащин В.В., Петров С.В., Дрогобужская С.В. Малосульфидное платино-палладиевое месторождение Лойпишнюн Мончетундровского базитового массива (Кольский полуостров, Россия) // Геология рудных месторождений. 2018. Т. 60. № 5. С. 472–503. https://doi.org/10.1134/S0016777018050027

Gannibal M.A., Tolstikhin I.N., Verchovsky A.B., Skiba V.I., Vetrin V.R., Gudkov A.V. Sites and Origin of Noble Gases in Minerals: A Case Study of Amphibole from Alkaline Granitoids of the Kola Peninsula // Geochemistry International. 2018. V. 56 (11). P. 1084–1092. https://doi.org/10.1134/S0016702918110046 Ганнибал М.А., Толстихин И.Н., Верховский А.Б., Скиба В.И., Ветрин В.Р., Гудков А.В. Места нахождения и происхождение благородных газов в минералах (на примере амфибола из щелочных гранитов Кольского полуострова) // Геохимия. 2018. № 11. С. 1041–1050. https://doi.org/10.1134/S0016752518110043

Gavryushkina O.A., Kruk N.N., Semyonov I.V., Vladimirov A.G., Kuibida Ya.V., Serov P.A. Petrogenesis of Permian-Triassic intraplate gabbro-granitic rocks in the Russian Altai // Lithos. 2019. Vol. 326–327. P. 71–89. https://doi.org/10.1016/j.lithos.2018.12.016

Groshev N.Yu., Pripachkin P.V., Karykowski B. T., Malygina A.V., Rodionov N. V., and Belyatsky B. V. Genesis of a Magnetite Layer in the Gabbro-10 Intrusion, Monchegorsk Complex, Kola Region: U–Pb SHRIMP-II dating of metadiorites // Geology of Ore Deposits. 2018. Vol. 60. No. 6. P. 486–496. https://doi.org/10.1134/S1075701518060028 Грошев Н., Припачкин П., Karykowski B.T., Малыгина А., Родионов Н.В., Беляцкий Б.В. Генезис магнетитового пласта массива Габбро-10, Мончегорский комплекс, Кольский регион: данные U–PB SHRIMP-II датирования метадиоритов // Геология рудных месторождений. 2018. Т. 60. № 6. С. 546–557. https://doi.org/10.1134/S0016777018060023

Gurin G., Ilyin Y., Nilov S., Ivanov D., Kozlov E., Titov K. Induced polarization of rocks containing pyrite: Interpretation based on X-ray computed tomography // Journal of Applied Geophysics. 2018. 154. P. 50–63. https://doi.org/10.1016/j.jappgeo.2018.04.019

Ivanyuk G.Y., Konopleva N.G., Yakovenchuk V.N., Pakhomovsky Y.A., Panikorovskii T.L., Kalashnikov A.O., Bocharov V.N., Bazai A.A., Mikhailova J.A., Goryainov P.M. Three-D Mineralogical Mapping of the Kovdor Phoscorite-Carbonatite Complex, NW Russia: III. Pyrochlore Supergroup Minerals // Minerals. 8 (7). 277. https://doi.org/10.3390/min8070277

Ivanyuk G.Y., Pakhomovsky Y.A., Panikorovskii T.L., Mikhailova J.A., Kalashnikov A.O., Bazai A.V., Yakovenchuk V.N., Konopleva N.G., Goryainov P.M. Three-D Mineralogical Mapping of the Kovdor Phoscorite-Carbonatite Complex, NW Russia: II. Sulfides // Minerals. 8 (7). 292. https://doi.org/10.3390/min8070292

Karykowski B.T., Maier W.D., Groshev N.Y., Barnes S.J., Pripachkin P.V., McDonald I., Savard D. Critical Controls on the Formation of Contact-Style PGE-Ni-Cu Mineralization: Evidence from the Paleoproterozoic Monchegorsk Complex, Kola Region, Russia // Economic Geology. 2018. 113(4). P. 911–935. https://doi.org/10.5382/econgeo.2018.4576

Karykowski B.T., Maier W.D., Groshev N.Y., Barnes S.J., Pripachkin P.V., McDonald I. Origin of Reef-Style PGE Mineralization in the Paleoproterozoic Monchegorsk Complex, Kola Region, Russia // Economic Geology. 2018. 113(6). P. 1333–1358. https://doi.org/10.5382/econgeo.2018.4594

Kaulina T.V., Kalinin A.A., Il’chenko V.L., Gannibal M.A., Avedisyan A.A., Elizarov D.V., Nerovich L.I., Nitkina E.A. Age and Formation Conditions of U Mineralization in the Litsa Area and the Salla-Kuolajarvi Zone (Kola Region, Russia) // Minerals. 2018. 8 (11). 563. https://doi.org/10.3390/min8120563

Kolobov V.V., Barannik M.B., Efimov B.V., Zhamaletdinov A.A., Shevtsov A.N., Kopytenko Yu.A. Energy-4 Generator for Monitoring Seismically Active Regions and Electromagnetic Sounding of the Earth’s Crust. Experience of Application in the Kovdor-2015 Experiment // Seismic Instruments. 2018. 54. 3. P. 268–280. https://doi.org/10.3103/S0747923918030143

Kompanchenko A.A., Voloshin A.V., Balagansky V.V. Vanadium Mineralization in the Kola Region, Fennoscandian Shield // Minerals. 2018. 8 (11). 474. https://doi.org/10.3390/min8110474

Kozlov E., Fomina E., Sidorov M., Shilovskikh V. Ti-Nb Mineralization of Late Carbonatites and Role of Fluids in Its Formation: Petyayan-Vara Rare-Earth Carbonatites (Vuoriyarvi Massif, Russia) // Geosciences. 2018. 8(8). 281. https://doi.org/10.3390/geosciences8080281

Kozlov N.E., Sorokhtin N.O., Martynov E.V. Geodynamic Evolution and Metallogeny of Archaean Structural and Compositional Complexes in the Northwestern Russian Arctic // Minerals. 2018. 8 (12). 573. https://doi.org/10.3390/min8120573

Kruk N.N., Golozubov V.V., Kiselev V.I., Kruk E.A., Rudnev S.N., Serov P.A., Kasatkin S.A., Moskalenko E.Y. Paleozoic Granitoids of the Southern Part of the Voznesenka Terrane (Southern Primorye): Age, Composition, Melt Sources, and Tectonic Settings // Russian Journal of Pacific Geology. 2018. 12 (3). P. 190–209. https://doi.org/10.1134/S1819714018030041 Крук Н.Н., Голозубов В.В., Киселев В.И., КрукЕ.А., Серов П.А., Касаткин С.А., Москаленко Е.Ю. Палеозойские гранитоиды южной части Вознесенского террейна (Южное Приморье): возраст, вещественный состав, источники расплавов и обстановки формирования // Тихоокеанская геология. 2018. Т. 37. №3. С. 32–53. https://doi.org/10.30911/0207-4028-2018-37-3-32-53

Lavrushin V.Y., Israfailov Y.G., Polyak B.G., Pokrovsky B.G., Bujakaite M.I., Kamensky I.L. Conditions of the formation of thermomineral waters in the Talysh fold zone of the Lesser Caucasus (Azerbaijan) based on isotope-geochemical data (3DeD mu/4DeD mu,) // Lithology and mineral resources. 2018. 53(1). P. 53–75. https://doi.org/10.7868/S0024497X18010044 Лаврушин В.Ю., Исрафилов Ю.Г., Поляк Б.Г., Покровский Б.Г., Буякайте М.И., Каменский И. Условия формирования термоминеральных вод Талышской складчатой зоны Малого Кавказа (Азербайджан) по изотопно-химическим данным (3Hе/4Hе, δ13C(CO2), δ13C(Ch5), δ15NN2, 87Sr/86Sr, δDh3O и δ18Oh3O) // Литология и полезные ископаемые. 2018. № 1. С. 58–82. https://doi.org/10.7868/S0024497X18010044

Mikhailova J.A., Ivanyuk G.Y., Kalashnikov A.O., Pakhomovsky Y.A., Bazai A.V., Panikorovskii T.L., Yakovenchuk V.N., Konopleva N.G., Goryainov P.M. Three-D Mineralogical Mapping of the Kovdor Phoscorite-Carbonatite Complex, NW Russia: I. Forsterite // Minerals. 2018. 8(6). 260. https://doi.org/10.3390/min8060260

Mikhal’skii E.V., Borovkov N.V., Gonzhurov N.A., Gogolev M.A., Svetov S.A., Kunakkuzin E.L. Reconstruction of the Neoproterozoic-Cambrian Orogenesis in Princess Elisabeth Land (East Antarctica) from a Study of Granitic Rocks // Geotectonics. 2018. 52 (4). P. 421–446. https://doi.org/10.1134/S0016852118040052 Михальский Е.В., Боровков Н.В., Гонжуров Н.А., Гоголев М.А., Светов С.А., Кунаккузин Е.Л. Реконструкция неопротерозойско–кембрийского орогенеза на Земле Принцессы Елизаветы (Восточная Антарктида) по данным изучения гранитоидов // Геотектоника. 2018. № 4. С. 25–53. https://doi.org/10.1134/S0016853X18040057

Nedosekova I.L., Koroteev V.A., Bayanova T.B., Belyatsky B.V. Sources of Ore Substance of Carbonatite Complexes of the Ural Fold Belt: Rb-Sr and Sm-Nd Isotope Data // Doklady Earth Sciences. 2018. 480(2). P. 773–777. https://doi.org/10.1134/S1028334X18060156

Nikolaeva S.B., Nikonov A.A., Shvarev S.V., Rodkin M.V. Detailed paleoseismological research on the flank of the Lake Imandra depression (Kola region): new approaches and results // Russian Geology and Geophysics. 2018. 59(6). P. 697–708. https://doi.org/10.1016/j.rgg.2018.05.008 Николаева С.Б., Никонов А.А., Шварев С.В., Родкин М.В. Детальные палеосейсмогеологические исследования в бортовой зоне впадины оз. Имандра (Кольский регион): новые подходы и результаты // Геология и геофизика. 2018. Т. 59. № 6. С. 866–880. https://doi.org/10.15372/GiG20180608

Nivin V.A., Pukha V.V., Lovchikov A.V., Rakhimov R.G. Features and Factors of Time Variations in Hydrogen Release at Lovozersky Rare-Metal Deposit (Kola Peninsula) // Geochemistry International. 2018. 56(7). P. 688–701. https://doi.org/10.1134/S0016702918070078 Нивин В.А., Пуха В.В., Ловчиков А.В., Рахимов Р.Г. Особенности и факторы временных вариаций выделения водорода на Ловозерском редкометальном месторождении (Кольский полуостров) // Геохимия. 2018. № 7. С. 661–675. https://doi.org/10.1134/S0016752518070075

Ovchinnikov R.O., Sorokin A.A., Kudryashov N.M. Age of the Early Precambrian (?) Intrusive Complexes of the Northern Bureya Continental Massif, Central Asian Fold Belt // Russian Journal of Pacific Geology. 2018. 12(4). P. 289–302. https://doi.org/10.1134/S181971401804005X

Polyak B.G., Cheshko A.L., Kikvadze O.E., Kamensky I.L., Prasolov E.M. Isotope-Geochemical Features and Genesis of Gases in the East Carpathian Region // Lithology and mineral resources. 2018. 53(5). P. 380–393. https://doi.org/10.1134/S0024490218050085 Поляк Б.Г., Чешко А.Л., Киквадзе О.Е., КаменскийИ.Л., Прасолов Э.М. Изотопно-геохимические особенности и генезис газов Восточно-Карпатского региона // Литология и полезные ископаемые. 2018. № 5. С. 417–431. https://doi.org/10.1134/S0024497X18050087

Prokofiev V.Y., Kalinin A.A., Lobanov K.V., Banks D.A.; Borovikov A.A., Chicherov M.V. Composition of Fluids Responsible for Gold Mineralization in the Pechenga Structure of the Pechenga-Imandra-Varzuga Greenstone Belt, Kola Peninsula, Russia // Geology of ore deposits. 2018. 60(4). P. 277–299. https://doi.org/10.1134/S1075701518040037 Прокофьев В.Ю., Калинин А.А., Лобанов К.В., Бэнкс Д.А., Боровиков А.А., Чичеров М.В. Cостав рудообразующих флюидов золотой минерализации Печенгской структуры зеленокаменного пояса Печенга-Имандра-Варзуга (Кольский полуостров, Россия) // Геология рудных месторождений. 2018. Т. 60. № 4. С. 317–341. https://doi.org/10.1134/S0016777018040032

Rodionov A.A., Buchko I.V., Kudryashov N.M. Age, Mineralogical and Geochemical Features, and Tectonic Position of Gabbroids of the Dzhigdinskii Massif, Southeastern Environ of the North Asian Craton // Russian Journal of Pacific Geology. 2018. 12. 3. P. 210–224. https://doi.org/10.1134/S1819714018030065

Rundqvist T.V., Pripachkin P.V., Bazai A.V. Plagioclase Composition in Rocks of PGE-Bearing Layered Series in the Vurechuaivench Massif, Monchegorsk Complex, Kola Region // Geology of Ore Deposits. 2018. V. 60. 8. P. 736–743. https://doi.org/10.1134/S1075701518080081

Selivanova E.A., Lyalina L.M., Savchenko Ye.E. Compositional and Textural Variations in Hainite-(Y) and Batievaite-(Y), Two Rinkite-Group Minerals from the Sakharjok Massif, Keivy Alkaline Province, NW Russia // Minerals. 2018. 8(10). 458. https://doi.org/10.3390/min8100458

Smirnov V.N., Ivanov K.S., Ronkin Y.L., Serov P.A., Gerdes A. Sr, Nd, and Hf Isotope Composition of Rocks of the Reft Gabbro-Diorite-Tonalite Complex (Eastern Slope of the Middle Urals): Petrological and Geological Implications // Geochemistry International. 2018. 56(6). P. 495–508. https://doi.org/10.1134/S0016702918060101

Sorokhtin N.O., Lobkovsky L.I., Kozlov N.E. Ore Genesis Laws in Subduction Zones // Oceanology. 2018. 58(1). https://doi.org/10.1016/10.1134/S0001437018010137

Steshenko E.N., Nikolaev A.I., Bayanova T.B., Drogobuzhskaya S.V., Chashchin V.V., Serov P.A., Lyalina L.M., Novikov A.I., Elizarov D.V. The Paleoproterozoic Kolvitsa Anorthosite Block: New Data on the U–Pb Age (ID TIMS) and Geochemical Features of Zircon // Doklady Earth Sciences. 2018. Vol. 479. Part 1. P. 366–370. https://doi.org/10.1134/S1028334X18030224 Стешенко Е., Николаев А.И., Баянова Т., Дрогобужская С.В., Чащин В., Серов П., ЛялинаЛ., Новиков А.И., Елизаров Д. Палеопротерозойский Колвицкий анортозитовый массив: новые данные о возрасте (U-Pb, ID-TIMS) и геохимических особенностях циркона // Доклады Академии наук. 2018. Т. 479. № 2. С. 187–191. https://doi.org/10.7868/S0869565218080169

Svetlov A., Makarov D., Pripachkin P., Usov A., Potokin A., Goryachev A. Methods of Increasing the Recovery of Non-Ferrous Metals from the Low-Grade Copper-Nickel Ores for Heap Leaching // Inzynieria Mineralna-Journal of The Polish Mineral Engineering Society. 2018. 1. P. 173–177. https://doi.org/10.29227/IM-2018-01-28

Tkacheva D.A., Mikhalsky E.V., Sushchevskaya N.M., Kunakkuzin E.L., Skublov S.G., Sergeev S.A. Age and Geochemistry of the Cape Burks Gabbroids (Russkaya Station Area, West Antarctica) // Geochemistry International. 2018. 56(7). P. 628–650. https://doi.org/10.1134/S001670291807011X Ткачева Д.А., Михальский Е.В., Сущевская Н.М., Кунаккузин Е.Л., Скублов С.Г., Сергеев С.А. Возраст и геохимическая характеристика габброидов мыса Беркс (район станции Русская, Западная Антарктида) // Геохимия. 2018. № 7. С. 616–640. https://doi.org/10.1134/S0016752518070129

Tolstikhin I., Tarakanov S., Gannibal M. Helium diffusivity and fluxes from a sedimentary basin (Permo-Carboniferous trough, Northern Switzerland) // Chemical Geology. 2018. 486. P. 40–49. https://doi.org/10.1016/j.chemgeo.2018.03.029

Tolstikhin I.N. The late Earth’s accretion: Processes and materials // Russian Journal of Earth Sciences. 2018. 18(1). ES1003. https://doi.org/10.2205/2018ES000614

Trishina O., Gorbatsevich F., Kovalevskiy M. Comparison of petrophysical properties of predominant rocks from the archaean section of the Kola Superdeep (SG-3) // Acta Geodynamica et Geomaterialia. 2018. 15(3). P. 247–257. https://doi.org/10.13168/AGG.2018.0018

Vetrin V.R., Belousova E.A., Kremenetsky A.A. Lu–Hf Isotopic Systematics of Zircon from Lower Crustal Xenoliths in the Belomorian Mobile Belt // Geology of Ore Deposits. 2018. Vol. 60. No. 7. P. 1–10. https://doi.org/10.1134/S1075701518070085

Voytekhovsky Yu.L. Algebraical geometry of icosahedral viruses // Paleontological Journal. 2018. V. 52. N 14. P. 47–50.

Zaitsev V.A., Elizarov D.V., Bychkova Ya.V., Senin V.G., Baynova T.B. First Data on the Geochemistry and Age of the Kontay Intrusion in Polar Siberia // Geochemistry International. 2018. Vol. 56. No. 3. P. 211–225. https://doi.org/10.1134/S0016702918030102 Зайцев В.А., Елизаров Д.В., Бычкова Я.В., Сенин В.Г., Баянова Т.Б. Первые данные о геохимии и возрасте Контайской интрузии, Полярная Сибирь // Геохимия. 2018. № 3. С. 222–236. https://doi.org/10.7868/S0016752518030020

Zhamaletdinov A.A., Shevtsov A.N., Korotkova T.G. Lunisolar Tides Influence on Electrical Conductivity of the Earth’s Crust in the Territory of Kola Peninsula. // Izvestiya, Physics of the Solid Earth. 2018. Vol. 54. No. 3. P. 1–13. https://doi.org/10.1134/S1069351318030102 Жамалетдинов А.А., Шевцов А.Н., Короткова Т.Г. Влияние лунно-солнечных приливов на электропроводность земной коры на территории Кольского полуострова // Физика Земли. 2018. № 3. С. 92–105. https://doi.org/10.7868/S0002333718030079

Zhirov D., Zhirova A. Neotectonics of the Khibiny alkaline massif // 18th International Multidisciplinary Scientific GeoConference SGEM 2018. 2018. Issue 1.1. P. 355–362. https://doi.org/10.5593/sgem2018/1.1/S01.045

Zolotarev A.A., Selivanova E.A., Krivovichev S.V., Savchenko Y.E., Panikorovskii T.L., Lyalina L.M., Pautov L.A., Yakovenchuk V.N. Shkatulkalite, a Rare Mineral from the Lovozero Massif, Kola Peninsula: A Re-Investigation // Minerals. 2018. 8(7). 303. https://doi.org/10.3390/min8070303

Zozulya D., Kullerud K., Ravna E.K., Savchenko Ye.E., Selivanova E.A., Timofeeva M.G. Mineralogical and geochemical constraints on magma evolution and late-stage crystallization history of the Breivikbotn silicocarbonatite, Seiland igneous province in Northern Norway: prerequisites for zeolite deposits in carbonatite complexes // Minerals. 2018. V. 8 (11). 537. https://doi.org/10.3390/min8110537

Бучко И.В., Сорокин А.А., Родионов А.А., Кудряшов Н.М. Первые свидетельства среднетриасового базитового магматизма в юго-западной части Джугджуро-Станового супертеррейна (Иликанский террейн) // Доклады Академии наук. 2018. Т. 479. № 6. С. 650–654. https://doi.org/10.7868/S0869565218120101

Елбаев А.Л., Гордиенко И.В., Баянова Т.Б., Гороховский Д.В., Орсоев Д.А., Бадмацыренова Р.А., Зарубина О.В. U-Pb-возраст и геохимические особенности ультрамафит-мафитов офиолитовой ассоциации Джидинской зоны (юго-западное Забайкалье) // Доклады Академии наук. 2018. Т. 478. № 4. С. 452–455. https://doi.org/10.7868/S0869565218040163

Родионов А.И., Николаева С.Б., Рязанцев П.А. Оценка возможностей георадиолокации при изучении сейсмогенных нарушений и деформаций в донных осадках (на примере озера Уполокшское, северо-восток Фенноскандинавского щита) // Геодинамика и тектонофизика. 2018. Т. 9. № 4. С. 1189–1203. https://doi.org/10.5800/GT-2018-9-4-0390

Терехов Е.Н., Морозов Ю.А., Смолькин В.Ф., Баянова Т.Б., Щербакова Т.Ф. О проявлении дайкового магматизма андезит-базальтового состава в палеопротерозойской рифтогенной системе Кольского кратона (Балтийский щит) // Доклады Академии наук. 2018. Т. 479. № 3. С. 302–308. https://doi.org/10.7868/S0869565218090141

 

2017

Akimova E.Y., Verchovsky A.B., Kozlov E.N., Lokhov K.I. Composition of the gases from minerals of corundum-bearing rocks from the Belomorian mobile belt (North Karelia, Russia) // 17th International Multidisciplinary Scientific GeoConference SGEM 2017. SGEM2017 Conference Proceedings. 29 June — 5 July 2017. Vol. 17. Issue 11. P. 103-108. https://doi.org/10.5593/sgem2017/11/S01.013

Akimova E.Yu., Kozlov E.N., Lokhov K.I. Origin of corundum rocks of the Belomorian mobile belt: Evidence from noble gas isotope geochemistry // Geochemistry International. 2017. Vol. 55. № 11. P. 1000–1009. https://doi.org/10.1134/s0016702917110027

Baltybaev Sh.K., Yurchenko A.V., Lobach-Zhuchenko S.B., Balagansky V.V., Galankina O.L., Morozov M.V., Bogomolova E.S. Conditions of metamorphism of garnet-bearing aluminous gneisses in the Orekhov-Pavlograd zone of the Ukrainian Shield // Russian Geology and Geophysics. 2017. Vol. 58. № 11. P. 1333–1348. https://doi.org/10.1016/j.rgg.2017.11.002

Bayanova T.B., Rundquist T.V., Serov P.A., Korchagin A.U., Karpov S.M. The Paleoproterozoic Fedorov–Pana Layered PGE Complex of the Northeastern Baltic Shield, Arctic Region: New U–Pb (Baddeleyite) and Sm–Nd (Sulfide) Data // Doklady Earth Sciences. 2017. Vol. 472. Part 1. P. 1–5. https://doi.org/10.1134/S1028334X17010019

Dmitrieva N.V., Letnikova E.F., Vishnevskaya I.A., Serov P.A. Geochemistry of Precambrian volcanosedimentary rocks of the Karsakpai Group in southern Ulutau (Central Kazakhstan) // Russian Geology and Geophysics. 2017. Vol. 58. № 8. P. 935–948. https://doi.org/10.1016/j.rgg.2017.07.004

Glukhovskii M.Z., Kuz’min M.I., Bayanova T.B., Lyalina L.M., Makrygina V.A., Shcherbakova T.F. The First Discovery of Hadean Zircon in Garnet Granulites from the Sutam River (Aldan Shield) // Doklady Earth Sciences. 2017. Vol. 476. Part 1. P. 1026–1032. https://doi.org/10.1134/S1028334X17090033

Gorbatsevich F.F., Trishina O.M. Petrophysical properties of the Pechenga rocks of different metamorphic facies // Acta Geodynamica et Geomaterialia. 2017. Vol. 14. No. 43 (188) P. 409–423. https://doi.org/10.13168/AGG.2017.0022

Ivanyuk G.Yu., Kalashnikov A.O., Pakhomovsky Ya.A., Bazai A.V., Goryainov P.M. Mikhailova J.A., Yakovenchuk V.N., Konopleva N.G. Subsolidus evolution of the magnetite-spinel-ulvöspinel solid solutions in the Kovdor phoscorite-carbonatite complex, NW Russia // Minerals. 2017. 7, 215. https://doi.org/10.3390/min7110215

Kalashnikov A.O., Ivanyuk G.Yu., Mikhailova J.A., Sokharev V.A. Approach of automatic 3D geological mapping: the case of the Kovdor phoscorite-carbonatite complex, NW Russia. Scientific Reports. 2017. 7:6893. https://doi.org/10.1038/s41598-017-06972-9

Kaulina T.V., Avedisyan A.A., Tomilenko A.A., Ryabukha M.A., Il’chenko V.L. Fluid inclusions in quartz from uranium mineralization areas of the Litsa ore cluster (Kola Peninsula) // Russian Geology and Geophysics. 2017. V. 58. P. 1059–1069. https://doi.org/10.1016/j.rgg.2017.02.001

Lobach-Zhuchenko S.B., Balaganskii V.V., Koreshkova M.Yu., Lokhov K.I., Baltybaev Sh.K., Stepanyuk L.M., Egorova Yu.S., Sergeev S.A., Kapitonov I.N., Galankina O.L., Bogomolov E.S., Berezhnaya N.G., Sukach V.V. Paleoarchean Orthopyroxenites of the Bug Granulite–Gneiss Domain at the Ukrainian Shield // Doklady Earth Sciences. 2017. Vol. 474. Part 2. P. 700–705.

Lobach-Zhuchenko S.B., Kaulina T.V., Baltybaev S.K., Balagansky V.V., Egorova Yu.S., Lokhov K.I., Skublov S.G., Sukach V.V., Bogomolov E.S., Stepanyuk L.M., Galankina O.L., Berezhnaya N.G., Kapitonov I.N., Antonov A.V., Sergeev S.A. The long (3.7–2.1 Ga) and multistage evolution of the Bug Granulite–Gneiss Complex, Ukrainian Shield, based on the SIMS U–Pb ages and geochemistry of zircons from a single sample // Crust–Mantle Interactions and Granitoid Diversification: Insights from Archaean Cratons. Geological Society. London, Special Publications 449. 2017. P. 175–206. https://doi.org/10.1144/SP449.3

Lobach-Zhuchenko S.B., Kaulina T.V., Lokhov K.I., Egorova Yu.S., Skublov S.G., Galankina O.L., Antonov A.V. Isotope-geochemical features of zircon and its significance for reconstruction of geological history of an Early Archean granulites of the Ukrainian shield // Geology of Ore Deposits. 2017. Vol. 59. N 8.

Macdonald R., Bagiński B., Kartashov P.M., Zozulya D. Behaviour of ThSiO4 during hydrothermal alteration of rare-metal rich lithologies from peralkaline rocks // Mineralogical Magazine. 2017. Vol. 81(4). P. 873–893. https://doi.org/10.1180/minmag.2016.080.138

Macdonald R., Bagiński B., Zozulya D. Differing responses of zircon, chevkinite-(Ce), monazite-(Ce) and fergusonite-(Y) to hydrothermal alteration: Evidence from the Keivy alkaline province, Kola Peninsula, Russia // Mineralogy and Petrology. 2017. Vol. 111 (4). P. 523–545. https://doi.org/10.1007/s00710-017-0506-2

Mikhailova J.A., Pakhomovsky Ya.A., Ivanyuk G.Yu., Bazai A.V., Yakovenchuk V.N., Elizarova I.R., Kalashnikov A.O. REE mineralogy and geochemistry of the Western Keivy peralkaline granite massif, Kola Peninsula, Russia // Ore Geology Reviews. 2017. Vol. 82. P. 181–197. https://doi.org/10.1016/j.oregeorev.2016.11.006

Mikheev E.I., Vladimirov A.G., Fedorovsky V.S., Bayanova T.B., Mazukabzov A.M., Travin A.V., Volkova N.I., Khromykh S.V., Khlestov V.V., Tishin P.A. Age of Overthrust-Type Granites in the Accretionary-Collisional System of the Early Caledonides (Western Baikal Region) // Doklady Earth Sciences. 2017. Vol. 472. № 2. P. 152–158. https://doi.org/10.1134/S1028334X17020167

Nikolaeva S.B., Lavrova N.B., Denisov D.B. A catastrophic holocene event in the lake bottom sediments of the Kola region (northeastern Fennoscandian shield) // Doklady Earth Sciences. 2017. Vol. 473. Part 1. P. 308–312. https://doi.org/10.1134/S1028334X17030072

Nivin V.A., Rundqvist T.V. Formation of Pt-Bearing Western Pana Pluton on the Kola Peninsula: Fluid Regime as Deduced from Helium and Argon Isotopic Compositions // Geology of Ore Deposits. 2017. Vol. 59. № 1. P. 36–55. https://doi.org/10.1134/S1075701517010068

Nozhkin A.D., Likhanov I.I., Bayanova T.B., Serov P.A. First Data on Late Vendian Granitoid Magmatism of the Northwestern Sayan-Yenisei Accretionary Belt // Geochemistry International. Vol. 55. № 9. 792–801. https://doi.org/10.1134/S0016702917070072

Nozhkin A.D., Likhanov I.I., Reverdatto V.V., Bayanova T.B., Zinoviev S.V., Kozlov P.S., Popov N.V., Dmitrieva N.V. Late Vendian postcollisional leucogranites of Yenisei Ridge // Doklady Earth Sciences. 2017. Vol. 474. № 2. P. 674–679. https://doi.org/10.1134/S1028334X17060125

Panikorovskii T.L., Mazur A.S., Bazai A.V., Shilovskikh V.V., Galuskin E.V., Chukanov N.V., Rusakov V.S., Zhukov Yu.M., Avdontseva E.Yu., Aksenov S.M., Krivovichev S.V. X-ray diffraction and spectroscopic study of wiluite: implications for the vesuvianite-group nomenclature // Physics and Chemistry of Minerals. 2017. Vol. 44(8). P. 577–593. https://doi.org/10.1007/s00269-017-0885-2

Saikia A., Gogoi B., Kaulina T., Lialina L., Bayanova T. Ahmad M. Geochemical and U-Pb zircon age characterization of granites of Bathani volcano sedimentary sequence, Chotanagpur Granite Gneiss Complex, Eastern India: vestiges of Nuna supercontinent in Central Indian Tectonic Zone // Crustal Evolution of India and Antarctica: The Supercontinent Connection. Geological Society, London. Special Publications 457. P. 233–253. https://doi.org/10.1144/SP457.11

Sarifakioglu E., Dilek Y., Sevin M., Pehlivan S., Kandemir O., Moller A., Bayanova T., Uysal I., Keles M. Permo-Triassic and Liassic Tethyan Oceanic Tracts within the Pontide Belt Along the Southern Margin of Eurasia, Northern Anatolia // Acta Geologica Sinica-English Edition. 2017. Vol. 91. P. 33–34. https://doi.org/10.1111/1755-6724.13168

Shevtsov A.N., Zhamaletdinov A.A., Kolobov V.V., Barannik M.B. Frequency Electromagnetic Sounding with Industrial, Power Lines on Karelia-Kola Geotraverse // Journal of Mining Institute. 2017. Vol. 224. P. 178–188. https://doi.org/10.18454/PM1.2017.2.178

Smirnov V.N., Ivanov K.S., Ronkin Y.L., Koroteev V.A., Serov P.A., Gerdes A. The Sr, Nd, and Hf isotopic geochemistry of rocks of the gabbro-diorite-tonalite association from the Eastern Segment of the Middle Urals as an indicator of the age of the continental crust in this area // Doklady Earth Sciences. 2017. Vol. 474. № 1. P. 516–519. https://doi.org/10.1134/S1028334X17050269

Sorokin A.A., Kudryashov N.M. The cambrian–ordovician diorite–granodiorite–granite association of the Mamyn terrane (central asian fold belt): U–Pb geochronological and geochemical data // Doklady Earth Sciences. 2017. Vol. 472. № 1. P. 113–118. https://doi.org/10.1134/S1028334X17010275

Sorokin A.A., Kudryashov N.M., Kotov A.B., Kovach V.P. Age and Tectonic Setting of the Early Paleozoic Magmatism of the Mamyn Terrane, Central Asian Orogenic Belt, Russia // Journal of Asian Earth Sciences. 2017. V. 144. P. 22–39. https://doi.org/10.1016/j.jseaes.2017.01.017

Sorokin A.A., Ovchinnikov R.O., Kudryashov N.M., Kotov A.B., Kovach V.P. Two stages of Neoproterozoic magmatism in the evolution of the Bureya continental massif of the Central Asian Fold Belt // Russian Geology and Geophysics. 2017. Vol. 58. № 10. P. 1171–1187. https://doi.org/10.1016/j.rgg.2016.12.009

Sorokin A.A., Smirnova Y.N., Sorokin A.P., Kudryashov N.M. Middle Triassic Age of Metarhyolite of the Bondikha Formation, Argun Continental Massif, Central Asian Fold Belt // Doklady Eearth Sciences. 2017. Vol. 473. № 1. P. 296–299. https://doi.org/10.1134/S1028334X17030084

Steshenko E.N., Nikolaev A.I., Bayanova T.B., Drogobuzhskaya S.V., Chashchin V.V., Serov P.A., Lyalina L.M., Novikov A.I. The Paleoproterozoic Kandalaksha Anorthosite Massif: New U–Pb (ID–TIMS) Data and Geochemical Features of Zircon // Doklady Earth Sciences. 2017. Vol. 477. Part 2. P. 1454–1457. https://doi.org/10.1134/S1028334X17120194

Suvorova O., Kumarova V., Nekipelov D., Selivanova E., Makarov D., Masloboev V. Construction ceramics from ore dressing waste in Murmansk region, Russia // Construction and Building Materials. 2017. № 153. P. 783–789. https://doi.org/10.1016/j.conbuildmat.2017.07.137

Svetlov A., Seleznev E., Makarov D., Selivanova E., Masloboev V., Nesterov D. Heap leaching and perspectives of bioleaching technology for the processing of low-grade copper-nickel sulfide ores in Murmansk region, Russia // Inzynieria Mineralna-Journal of the Polish Mineral Engineering Society. 2017. 39. No 1. P. 51–57.

Tolstikhin I.N., Ballentine Ch.J., Polyak B.G., Prasolov E.M., Kikvadze O.E. The noble gas isotope record of hydrocarbon field formation time scales // Chemical Geology. 2017. Vol. 471. P. 141–152. https://doi.org/10.1016/j.chemgeo.2017.09.032

Voytekhovsky Y.L. Accelerated scattering of convex polyhedra // Acta Crystallographica A-Foundation and Advances. Vol. 73. № 5. P. 423–425. https://doi.org/10.1107/S2053273317009196

Voytekhovsky Y.L. Convex polyhedra with minimum and maximum names // Acta Crystallographica A-Foundation and Advances. Vol. 73. № 3. P. 271–273. https://doi.org/10.1107/S2053273317005526

Voytekhovsky Y.L. Ordering of convex polyhedra and the Fedorov algorithm // Acta Crystallographica A-Foundation and Advances. Vol. 73. №1. P. 77–80. https://doi.org/10.1107/S2053273316017095

Voytekhovsky Y.L., Stepenshchikov D.G. The Rome de Lisle problem // Acta Crystallographica. 2017. Vol. 73. № 6. P. 480–484. https://doi.org/10.1107/S2053273317011834

Zhamaletdinov A.A., Velikhov E.P., Shevtsov A.N., Kolobov V.V., Kolesnikov V.E., Skorokhodov A.A., Korotkova T.G., Ivonin V.V., Ryazantsev P.A., Birulya M.A. The Kovdor-2015 Experiment: Study of the Parameters of a Conductive Layer of Dilatancy–Diffusion Nature (DD Layer) in the Archaean Crystalline Basement of the Baltic Shield // Doklady Earth Sciences. 2017. Vol. 474. Part 2. P. 641–645. https://doi.org/10.1134/S1028334X17060095

Zhirov D.V. New Type of Brittle Deformations: Two-Axial Turn Structure of Fractures in the Kovdor Carbonatite Intrusion (NW Russia) // 17th International Multidisciplinary Scientific GeoConference SGEM 2017. SGEM2017 Conference Proceedings. 29 June — 5 July 2017. Vol. 17. Issue 11. P. 375–382. https://doi.org/10.5593/sgem2017/11/S01.048

Zhirov D.V., Vinogradov Yu.A., Zhirova A.M., Klimov S.A., Zhukova S.A. 3D-analysis of the Rock Burst Taken Place on 27/01/2016 at Mining Section 14 of the Kirovsk Mine (Khibiny, Russia) // 17th International Multidisciplinary Scientific GeoConference SGEM 2017. SGEM2017 Conference Proceedings. 29 June — 5 July 2017. Vol. 17. Issue 11. P. 11–18. https://doi.org/10.5593/sgem2017/12/S02.002

Zozulya D.R., Lyalina L.M., Savchenko Ye.E. Britholite-group minerals as sensitive indicators of changing fluid composition during pegmatite formation: evidence from the Keivy alkaline province, Kola peninsula, NW Russia // Mineralogy and Petrology. 2017. Vol. 111. № 4. P. 511–522. https://doi.org/10.1007/s00710-017-0493-3

НАУЧНЫЙ ЖУРНАЛ »CHRONOS» ЕСТЕСТВЕННЫЕ И ТЕХНИЧЕСКИЕ НАУКИ СБОРНИК НАУЧНЫХ ПУБЛИКАЦИЙ «ЕСТЕСТВЕННЫЕ И ТЕХНИЧЕСКИЕ НАУКИ В СОВРЕМЕННОМ МИРЕ»

21

процесс, поскольку гидроперекиси являются активатором синтеза простогландинов, влияющих на

поддержание тромбоцитарно-сосудистого гемолиза. Уровень МДА в подготовительном,

соревновательном и восстановительном периодах борцов, существенно и значимо ниже в контроле, р<0,01

и только в переходный период годичного цикла уровень МДА в эритроцитах борцов статистически

достоверно выше такового в эритроцитах контрольной группы (410, 54 ± 26, 469 ммоль/л против 316,64 ±

13,341 ммоль/л в контроле, р<0,01).

Активность каталазы в восстановительном и переходном периодах в эритроцитах борцов значимо не

отличается от такового в эритроцитах контрольной группы, хотя в переходном периоде показатели

активности каталазы у борцов имеют некоторую тенденцию к снижению (3,6 ± 1,17 ммоль/мин/л против

4,4±0,87 ммоль/мин/л в контроле). В подготовительном периоде активность каталазы эритроцитов борцов

резко снижена (3,0 ± 0,61 ммоль/мин/л против 9,7±1,67 ммоль/мин/л, р<0,001). В соревновательном

периоде, напротив, имеет резко выраженное и статистически значимое повышение активности каталазы в

эритроцитах борцов по сравнению с контролем (21,2 ± 1,85 ммоль/мин/л против 8,9±1,67 ммоль/мин/л, в

контроле, р<0,001).

Анализ взаимосвязи между физической работоспособностью и системой ПОЛ у борцов показал

наличие корреляции низкой силы во все периоды годичного цикла. Установлена связь между физической

работоспособностью и каталазой в плазме крови у борцов в подготовительном периоде (р<0,05), во всех

остальных периодах связи с АО системой в плазме крови и эритроцитах – низкой силы. Анализ динамики

показателя системы ПОЛ-АО в эритроцитах борцов позволил выявить выраженное разнонаправленное

изменение этих показателей в соревновательном периоде, что может свидетельствовать о возможности

оксидативного стресса в эритроцитах в этот период. Показатели системы ПОЛ-АО в плазме и эритроцитах

периферической крови борцов на различных этапах годичного цикла важны для оценки

антиоксидативного статуса на уровне целостного организма. Уровень ПОЛ служит отражением

адаптационных реакций организма на клеточном уровне. Полученные данные свидетельствуют об

изменениях оксидативного стресса у борцов в соревновательном периоде связанные с глубоким

эмоциональным и мышечным напряжением, и может являться звеном в патогенезе самых различных

патологических состояний. Соотношение прооксидантной и АО системы в плазме и эритроцитах

периферической крови у борцов может меняться в зависимости от индивидуального состояния организма

и степени интенсивности тренировочных и соревновательных процессов. Хорошо известно, что в плазме

крови обычно определяется преимущественно внеклеточная супероксиддисмутаза (СОД3), так как СОД1

(цитоплазматическая) СОД2 (митохондриальная) возникают в значимых концентрациях в крови лишь при

повреждении тканей, гетолизе. У борцов активность СОД была снижена по сравнению с контролем, по

окончании соревновательного периода на 48 % (соответственно, с 2256,50 усл.ед/мин. г. белка – у

контрольных, 1118,82 усл.ед / мин.г. белка — у борцов по окончании соревновательного периода) (р <0,05),

после отдыха – на 38 % (1315,67 усл.ед/мин.г. белка) (р <0,05), по окончании подготовительного периода

на 27% (1562,33 усл.ед /мин.г. белка), (р <0,05). Казалось, можно было ожидать противоположной

динамики активности фермента как компенсаторного ответа на повышение уровня образования АФК при

физической нагрузке. Однако, как показано в исследованиях, которых компенсаторная активация

сыворотки крови истощается к 3-м суткам. Таким образом, в условиях систематических высоких

физических нагрузок наблюдалось истощение активности СОД сыворотки крови, не возвращающееся к

нормальным значениям ни в период отдыха, ни в ходе подготовительного периода [11, c.1576-1581; 13,

c.803-809]

Изменение активности глутатион S- трансферазы в плазме крови спортсменов носит иной характер.

Так, по окончании соревновательного периода активность фермента повышена на 244% (в контрольной

группе – 58,18 мкмоль/мин. г. белка, борцы по окончании соревновательного периода – 12,89

мкмоль/мин.г. белка) (р < 0,05). После отдыха – на 396 % (14,0 мкмоль/мин.г. белка (р < 0,05), по окончании

подготовительного – на 660 %(р < 0,05). Эти результаты согласуются с литературными данными, где

показаны компенсаторные повышения активности ферментов системы антиоксидантной защиты и

глутатион S- трансферазы в частности в диапазоне от 20 % до 800% при высокой физической нагрузке [16,

c.22; 15, c.153-159; 10, c.162]. Учитывая, что глутатион S- трансфераза является ферментом, который за

счет восстановленного глутатиона осуществляет прямую регенерацию липоперекисей в мембранах без

предварительного фосфолипазного гидролиза, снижая последствия окислительного стресса и эндогенной

интоксикации, а также способствует выведению из организма токсичных продуктов перекисного

окисления липидов и окислительной модификации белков, компенсаторный рост активности данного

фермента в условиях систематических физических нагрузок выглядит вполне закономерным [1, c.9-12; 8,

c.47-53; 9, c.256]. Тем не менее, интересно отметить, имеющее место явление угнетения активности

фермента впоследствии высокой истощающей нагрузки по окончании соревновательного периода, однако

возникающее снижение нивелируется исходно чрезвычайно повышенной активностью. Таким образом,

можно предположить, что именно глутатион S- трансфераза является основным ферментом,

компенсирующим окислительный стресс при высокой систематической физической нагрузке.

Выводы. Уровень малонового диальдегида в плазме крови и эритроцитах существенно превышает

контрольный на протяжении всего годового тренировочно-соревновательного макроцикла. Максимум

концентрация МДА достигает по окончании соревновательного периода и не восстанавливается за

Барсков Игорь Сергеевич — пользователь, сотрудник

Барсков Игорь Сергеевич пользователь

кандидат геолого-минералогических наук с 1965 года
доктор биологических наук с 1979 года
профессор по кафедре с 16 марта 1995 г.
Прежние места работы (Нажмите для отображения)
Соавторы: Алексеев А.С., Кононова Л.И., Леонова Т.Б., Розанов А.Ю., Горева Н.В., Лебедев О.А., Реймерс А.Н., Янин Б.Т., Кабанов П.Б., Агаджанян А.К., Ванчуров И.А., Исакова Т.Н., Шиловский О.П. показать полностью…, Кияшко С.И., Лопатин А.В., Банников А.Ф., Иванов А.В., Лазарев С.С., Мигдисова А.В., Новиков И.В., Пазухин В.Н., Раутиан А.С., Смирнова С.Б., Dauphin Y., Goreva N.V., Mamet B., Ponomarenko A.G., Алифанов В.Р., Афанасьева Г.А., Борисенок В.И., Бывшева Т.В., Вейс А.Ф., Вислобокова И.А., Гагиев М.Х., Голубев В.К., Губин Ю.М., Дзержинский Ф.Я., Жамойда А.И., Иваненко Н.Б., Карху А.А., Кочеткова Н.М., Красилов В.А., Кузина Л.Ф., Кулагина Е.И., Махлина М.Х., Мащенко Е.Н., Михайлова И.А., Новицкая Л.И., Расницын А.П., Рожнов С.В., Сенников А.Г., Старостина Л.П., Суханов В.Б., Федонкин М.А., Филатова Л.И., Шиманский В.Н., Coquel R., Davydov V.I., Feuchtner G., Knuuti J., Lazarev S.S., Makhlina M.H., Martinez-Chacon M.L., Mendez C.A., Rodriguez R.M., Sanchez de Posada L.C., Villa E., WEISS F., van Ginkel A.C., Аристов В.А., Бардашев И.А., Богословская М.Ф., Бойко М.С., Вискова Л.А., Воробьева Э.И., Высоцкий В.И., Гибшман Н.Б., Ефимов М.Б., Журавлев А.Ю., Киселев Г.Н., Королёва Н.В., Кручек С.А., Кузнецова Т.В., Кузьмин А.В., Кузьмина Я.М., Кутелия З.А., Ломизе М.Г., Мазарович О.А., Макридин В.П., Митта В.В., Москаленко Т.В., Назарова В.М., Немировская Т.И., Орлова О.А., Ржезницкий О.В., Ростовцева Ю.И., Симаков К.В., Соболев Р.Н., Сычевская Е.К., Халымбаджа В.Г., Шлыков В.Г., Юрина А.Л., Яцков С.В., 2 Рейтлингер Е.А., Abazid R., Alkadhi H., Andreini D., Arfini F., BELL M.L., Ba J., Bamberg F., Barbagallo R., Barnette A., Barskova M.I., Bischoff B., Bittencourt M.S., Blanco-Ferrara S., Blanke P., Bogaert J., Bogoslovsky B.I., Boucart J., Brenckle P., Bullock-Palmer R., Cademartiri F., Carrascosa P., Cary R., Castellon F.C., Catena A., Chan B.K., Chartrand-Lefebvre C., Chen M., Choi B.D., Chou B., Clayton G., Collet J., Cuellar H., Cuif J.P., DESAI B.G., Dantas R.N., Dauphen Y., Dawood A., Delgado L.A., Denis А., Der A, Desbiolles L., Deseive S., Desmet K., Deviggiano A., Dewey M., Dickson D., Esper J., Fang X., Fang X., Forsdahl S.H., Friederich G.E., Gautret P., Genders T.S., Godoy Z.M., Goetschalckx K., Gomez D., Gopalan D., Goreva N.V., Grove E.L., Grove E.L., Günther A., Hadamitzky M., Hadamitzky M., Hansen G., Hausleiter J., Heckner M., Hossein B., Huapalla E.C., Hunink M.G., Husic M., JC, Jadav U., Jayawardhana K., Jie W., Juergen O., Kajander S., Kim T.H., Kitagawa K., Konovalova V.A., Konovalova V.A., Konovola V., Krestin G.P., Kristiansen J.F., Kucheva N.A., Kusina L.F., Lambrechtsen J., Laue M., Leipsic J., Leipsic J., Leschka S., Lesser J., Lesser J., Ludwig J., MARZAN M.B., Maaniitty T., Maffei E., Magnussen J., Mahmarian J., Mangold S., Marquet R., Martuscelli E., Martuscelli E., Massberg S., Maurovich-Horvat P., Maurovich-Horvat P., Meijboom W.B., Meijs M.F., Mylona M., Nagasawa S., Naoum C., Naoum C., Nemyrovska T.I., Newby D., Newman W.A., Nguyen T.T., Nomura C.H., Nomura C.H., Otten L.J., PETERSEN K.K., Palomares J.R., Park C., Parkhaev P., Pint, Plank F., Pontone G., Pontone G., Preciado-Anaya A., Pugliese F., Rabbat M., Ramanathan S., Reusken A., Reza Orozco M.A., Richards B.C., Rodriguez S., Rubinshtein R., Rubinshtein R., Ryu S., SMALL G.R., Schlosser T., Schmermund A., Schmermund A., Schoenecker N., Schoepf U.J., Schuijf J.D., Serra C.S., Shanbhag S.M., Shimanskii V.V., Shin S., Silvia F., Sinitsyn V.V., Skiadopoulou S., Smettei O.A., Solovieva M.N., Solovjev A.N., Sperandii M.G., Steyerberg E.W., Stocker T.J., Suchanek V., Szilveszter B., Tabbalat R., Tabbalat R., Tchigova V.A., Thomas D.J., Tokmakova A.J., Villines T.C., Wang J.Y., Wang S., Williams A., Williams C.T., Williams T., Yang D.S., Yu J., Zamudio M.D., Zhu Y.F., Zimmermann W., all e., de Feyter P.J., de Graaf F.R., mar S., van Beek E.J., van Mieghem C.A., van Rosendael A., Ёлкин Е.А., Адамия Ш.А., Аполлонов М.К., Арешин А.В., Артамонов В.А., Артюшкова О.В., Архипов Ю.В., Астафьева М.М., Ахметшина Л.З., Барышев В.Н., Бейсенова К.К., Белая Н.И., Березнер О.С., Богословский Б.И., Большакова Л.Н., Бондарев В.П., Борисенко Ю.А., Броушкин А.В., Буланов В.В., Василевич Ф.И., Венгерцев В.С., Вишневская B.C., Владыченский А.С., Волкова А.А., Воробьева Э.И., Воробьёва Э.И., Воронов А.В., ВоронцоваТ Н., Галета Я.В., Гатовский Ю.А., Гладенков Ю.Б., Глазкова И.В., Глазкова М.А., Головинова М.А., Голубев В.К., Голубева Е.И., Голубцов В.К., Горбачик Т.Н., Горденко Н.В., Горожанин В.М., Горожанина Е.Н., Горюнова Р.В., Горячев В.Н., Готе Р., Готре П., Грюндель Й., Дежкин В.В., Демченко А.Н., Десаи Б., Джамалов Р.Г., Дмитровская Ю.Е., Дофен Я., Друщиц В.В., Дубинин Е.П., Дэни Ф., Евстигнеева Т.А., Емельчнова Л.Г., Жерихин В.В., Жилин С.Г., Журавлева Ф.А., Заварзина А.Г., Зайцева Л.В., Захаров В.А., Зеленков Н.В., Зиновьев М.С., И С., Иванов О.П., Ипполитов А.П., ИсаковаТ Н., Карцева О.А., Киселев Д.Н., Кияшко С.П., Ковалев А.А., Козодеров В.В., Комарова Н.Г., Короновский Н.В., Косенко З.А., Косоруков В.Л., Косоруков В.Л., Кочетова Н.Н., Кочуров Б.И., Крамер Д.А., Кручек, Кузнецов П.В., Кузьминская К.С., Кузьмичева Е.И., Куиф Ж.П., Курзанов С.М., Курочкин Е.Н., Кушлина В.Б., Л Ф., Лаврентьева В.Д., Лаптева Е.М., Лаптева Н.И., Лебедев И.Г., Лозовский В.Р., Ломизе М.Г., Любченко О.В., Мавринская Т.М., Мазаев А.В., Макеева В.М., Маслакова Н.И., Массол М., Мейен С.В., Мельникова Л.М., Меннер В.В., Мизенс Г.А., Миранцев Г.В., Михайлов К.Е., Морозов П.Е., Морозов Ю.Е., Морозова И.П., Назаров Б.Б., Непоклонова М.И., Нигмаджанов И.М., Никитин Е.Д., Николаева С.В., Нутчина А.А., Овнатанова Н.С., Овчинникова Е.А., Оноприенко Ю.И., Орлеанский В.К., Остапенко В.А., Очев В.Г., Павличева Е.Н., Пантюлин А.Н., Пегета В.П., Перевозчиков И.В., Петрушевская М.Г., Пивоварова И.П., Показеев К.В., Пономаренко А.Г., Пономаренко Г.А., Попова Л.В., Протасевич Д.Л., Пучков В.Н., Радионова Э.П., Разина Т.П., Рейтлингер Е.А., Ржезницкий О.В., Розанова А.А., Розанова А.Ю., Ромина Л.В., Сабодина Е.П., Садовничий В.А., Садыхова И.А., Сельцер В.Б., Серова Л.Д., Синицын В.Е., Сладковская М.Г., Смирин В.М., Смирин Ю.М., Смирнова Л.В., Смуров А.В., Снакин В.В., Снигирева М.П., Соколов Б.С., Соловьева М.Н., Стародубцева И.А., Старостин В.И., Степанова Т.И., Счастливцева Н.П., Тарасова Л.О., Терещенко В.С., Тесакова Е.М., Ткачук В.А., Усс Н.И., Ушатинская Г.Т., Фарзан Р.Х., Финк Т.Е., Фокин П.А., Хераскова Т.Н., Хиами, Хилл Р., Цейслер В.М., Че М., Чижова В.А., Шарова Sharova Н.Ю., Шеин С.А., Школин А.А., Шмидт А.В., Шубин С.В., Шуменко С.И., Шурыгина С.В., Щербаков О.А., Эпштейн В.М., Янбулатова М.Г., чин а.с.
291 статья, 18 книг, 34 доклада на конференциях, 31 тезисы докладов, 2 НИР, 1 награда, 2 членства в научных обществах, 2 членства в редколлегиях журналов, 6 членств в редколлегиях сборников, 8 членств в программных комитетах, 4 членства в диссертационных советах, 13 диссертаций, 4 дипломные работы, 25 учебных курсов, 2 выступление в СМИ
Количество цитирований статей в журналах по данным Web of Science: 452, Scopus: 472

РИНЦ:
IstinaResearcherID (IRID): 838743
ResearcherID: C-3864-2012
Scopus Author ID: 6701366640

Деятельность


  • Статьи в журналах
      • 2018 Reduction in radiation exposure in cardiovascular computed tomography imaging: results from the PROspective multicenter registry on radiaTion dose Estimates of cardiac CT angIOgraphy iN daily practice in 2017 (PROTECTION VI)
      • Stocker T.J., Deseive S., Leipsic J., Hadamitzky M., Chen M.Y., Rubinshtein R., Heckner M., Bax J.J., Fang X.M., Grove E.L., Lesser J., Maurovich-Horvat P., Otton J., Shin S., Pontone G., Marques H., Chow B., Nomura C.H., Tabbalat R., Schmermund A., Kang J.W., Naoum C., Atkins M., Martuscelli E., Massberg S., Hausleiter J., Carrascosa P., Deviggiano A., Naoum C., Magnussen J., Otton J., Kaplan A., Feuchtner G., Plank F., De Smet K., Buls N., Cury R.C., Bittencourt M.S., Nomura C.H., Dantas R.N., Leipsic J., Blanke P., Chartrand-Lefebvre C., Chin A., Small G., Chow B., Silva F.C., Godoy Z.M., Silva F.C., Fang X.M., Jie W., Cadena A., Adla T., Suchanek V., Grove E.L., Pedersen K.B., Lambrechtsen J., Husic M., Knuuti J., Maaniitty T., Bischoff B., Arnoldi E., Schmermund A., Eckert J., Hadamitzky M., Finck T., Hell M., Marwan M., Bamberg F., Mangold S., Schlosser T., Ludwig J., Mylona M., Skiadopoulos S., Maurovich-Horvat P., Szilveszter B., Jadav U., Pinto B.V., Rubinshtein R., Hussein E., Andreini D., Pontone G., Martuscelli E., Sperandio M., Kitagawa K., Nagasawa N., Tabbalat R., Farhan R.A., Sierra Galan L.M., Delgado L.A., Sierra Galan L.M., Reza Orozco M.A., Castellon F.C., Zamudio M.D., Preciado-Anaya A., Gomez R.P., Forsdahl S.H., Hansen G.A., Gunther A., Kristiansen J.F., Huapalla E.C., Chavez P.T., de A Goncalves P., Ramanathan S., Sinitsyn V., Glazkova M., Abazid R., Smettei O.A., Dawood A., Omar S.H., Kang J.W., Yang D.H., Kim T.H., Park C.H., Shin S., Ryu S.J., Palomares J.R., Cuellar H., Bax J.J., van Rosendael A., Williams M.C., Newby D., van Beek E.J.R, Bull R., Jayawardhana K., Dickson P., Espey J., Lesser J., Han B.K., Bullock-Palmer R., Rabbat M., Schoenecker N., Thomas D.M., Gore R.S., Atkins M., Chen M.Y., Shanbhag S.M., Mahmarian J., Yu J., Villines T.C., Nguyen B.
      • в журнале European Heart Journal, издательство Oxford University Press (United Kingdom), том 39, № 41, с. 3715-3723
      • 2016 НИКОЛАЙ НИКОЛАЕВИЧ КАЛАНДАДЗЕ (1939–2015)
      • Агаджанян А.К., Алифанов В.Р., Банников А.Ф., Барсков И.С., Буланов В.В., Вислобокова И.А., Воробьева Э.И., Голубев В.К., Губин Ю.М., Ефимов М.Б., Карху А.А., Кузнецова Т.В., Кузьмина Я.М., Курзанов С.М., Куркин А.А., Лебедев О.А., Леонова Т.Б., Лозовский В.Р., Лопатин А.В., Мащенко Е.Н., Розанов А.Ю.
      • в журнале Палеонтологический журнал, № 3, с. 111-111 DOI
      • 2014 REPORT OF THE TASK GROUP TO ESTABLISH A GSSP CLOSE TO THE EXISTING VISEAN–SERPUKHOVIAN BOUNDARY
      • Richards B., Aretz M., Barnette A., Barskow I., Blanco-Ferrara S., Brenckle P., Clayton G., Dean M., Brooks E., Gibsman N., Hecker M., Konovola V., Korn D., Kulagina E., Lane R., Mamet B., Nemyrovska T., Nikoloeva S., Pazukhin V., Qi Y., et al.
      • в журнале Newsletter on Carboniferous Stratigraphy, том 31, с. 29-33
      • 2013 ПАЗУХИН ВЛАДИМИР НИКОЛАЕВИЧ (1951-2013)
      • Кулагина Е.И., Кочетова Н.Н., Артюшкова О.В., Мавринская Т.М., Маслов В.А., Пучков В.Н., Барышев В.Н., Горожанин В.М., Горожанина Е.Н., Николаева С.В., Кононова Л.И., Алексеев А.С., Барсков И.С., Горева Н.В., Гатовский Ю.А., Иванова Р.М., Кучева Н.А., Степанова Т.И., Черных В.В., Мизенс Г.А., и др.
      • в журнале Минералогический сборник, № 10, с. 283-285
      • 2012 Академик Георгий Александрович Заварзин (1933–2011)
      • Розанов А.Ю., Рожнов С.В., Лопатин А.В., Агаджанян А.К., Астафьева М.М., Барсков И.С., Броушкин А.В., Герасименко Л.М., Горденко Н.В., Жегалло Е.А., Заварзина А.Г., Зайцева Л.В., Кушлина В.Б., Лазарев С.С., Леонова Т.Б., Мельникова Л.М., Миранцев Г.В., Орлеанский В.К., Пономаренко А.Г., Федонкин М.А., Ушатинская Г.Т.
      • в журнале Палеонтологический журнал, № 4, с. 107-108
      • 2012 Академик Леонид Петрович Татаринов (1926–2011)
      • Розанов А.Ю., Рожнов С.В., Лопатин А.В., Агаджанян А.К., Алифанов В.Р., Банников А.Ф., Барсков И.С., Вислобокова И.А., Воробьёва Э.И., Голубев В.К., Губин Ю.М., Дзержинский Ф.Я., Дмитриева Е.Л., Ивахненко М.Ф., Карху А.А., Лебедев О.А., Леонова Т.Б., Мащенко Е.Н., Новиков И.В., Новицкая Л.И., Пархаев П.Ю., Пономаренко А.Г., Расницын А.П., Раутиан А.С., Соколов Б.С., Сенников А.Г., Соловьёв А.Н., Суханов В.Б., Сычевская Е.К., Туманова Т.А., Федонкин М.А., Шишкин М.А.
      • в журнале Палеонтологический журнал, том 3, с. 106-108
      • 2012 Евгений Николаевич Курочкин (1940–2011)
      • Розанов А.Ю., Рожнов С.В., Лопатин А.В., Агаджанян А.К., Алифанов В.Р., Афанасьева Г.А., Афанасьева О.Б., Банников А.Ф., Барсков И.С., Вискова Л.А., Вислобокова И.А., Воробьева Э.И., Голубев В.К., Губин Ю.М., Дзержинский Ф.Я., Дмитриева Е.Л., Зеленков Н.В., Ивахненко М.Ф., Карху А.А., Леонова Т.Б., Мащенко Е.Н., Новиков И.В., Новицкая Л.И., Пономаренко А.Г., Расницын А.П., Раутиан А.С., Сенников А.Г., Соловьев А.Н., Суханов В.Б., Сычевская Е.К., Терещенко В.С., Туманова Т.А., Федонкин М.А., Шишкин М.А.
      • в журнале Палеонтологический журнал, № 5, с. 106-108
      • 2011 A clinical prediction rule for the diagnosis of coronary artery disease: validation, updating, and extension
      • Genders T.S., Steyerberg E.W., Alkadhi H., Leschka S., Desbiolles L., Nieman K., Galema T.W., Meijboom W.B., Mollet N.R., de Feyter P.J., Cademartiri F., Maffei E., Dewey M., Zimmermann E., Laule M., Pugliese F., Barbagallo R., Sinitsyn V., Bogaert J., Goetschalckx K., Schoepf U.J., Schuijf J.D., Bax J.J., de Graaf F.R., Knuuti J., Kajander S., van Mieghem C.A., Meijs M.F., Cramer M.J., Gopalan D., Feuchtner G., Friedrich G., Krestin G.P., Hunink M.G.
      • в журнале European Heart Journal, издательство Oxford University Press (United Kingdom), том 32, № 11, с. 1316-1330
      • 2006 К ЮБИЛЕЮ ЛЕОНИДА ПЕТРОВИЧА ТАТАРИНОВА
      • Агаджанян А.К., Афанасьева Г.А., Банников А.Ф., Барсков И.С., Большакова Л.Н., Вискова Л.А., Вишневская B.C., Воробьева Э.И., Дзержинский Ф.Я., Дмитриева Е., Ивахненко М.Ф., Красилов В.А., Кузьмина Я.М., Курочкин Е.Н., Леонова Т.Б., Лопатин А.В., Новиков И.В., Новицкая Л.И., Пономаренко А.Г., Расницын А.П., Розанов А.Ю.
      • в журнале Палеонтологический журнал, № 6, с. 3-6
      • 2004 ВИЛЛИ ЦИГЛЕР (1929-2002)
      • Алексеев А.С., Аристов В.А., Бардышев И.А., Барсков И.С., Горева Н.В., Кононова Л.И., Кручек С.А., Немировская Т.И., Овнатанова Н.С., Розанов А.Ю., Снигирева М.П.
      • в журнале Палеонтологический журнал, № 1, с. 107-108
      • 2001 Открытие уникального местонахождения среднеюрской фауны и флоры в Подмосковье
      • Алексеев А.С., Агаджанян А.К., Арешин А.В., Барсков И.С., Горденко Н.В., Ефимов М.Б., Кабанов П.Б., Красилов В.А., Красников Н.М., Лебедев О.А., Розанова А.А., Сенников А.Г., Смирнова С.Б., Суханов В.Б., Фокин П.А., Шмидт А.В.
      • в журнале Доклады Академии наук, издательство Наука (М.), том 377, № 3, с. 359-362
      • 1994 Основные морфологические события в истории развития цефалопод в палеозое
      • Барсков И.С., Богословская М.Ф., Киселев Г.Н., Кузина Л.Ф., Леонова Т.Б., Шиманский В.Н., Яцков С.В.
      • в журнале Стратиграфия. Геологическая корреляция, издательство Наука (М.), том 2, № 1, с. 55—61
      • 1984 Devonian-Carboniferous transitional deposits of the Berchogur section Mugodzary, USSR (preliminary report)
      • Barskov I.S., Simakov K.V., Alekseev A.S., Bogoslovsky B.I., Byvsheva T.V., Gagiev M.H., Kononova L.I., Kochetkova N.M., Kusina L.F., Reitlinger E.A.
      • в журнале CFS Courier Forschungsinstitut Senckenberg, издательство E. Schweizerbart’sche Verlagsbuchhandlung (Germany), № 67, с. 207-230
  • Статьи в сборниках
      • 2018 Микроструктурная и минералогическая архитектура ростров некоторых батских мегатеутид (Belemnitida)
      • Ипполитов А.П., Барсков И.С., Косоруков В.Л., Десаи Бх
      • в сборнике Современные проблемы изучения головоногих моллюсков морфология, систематика, эволюция, экология и биостратиграфия. Вып. 5. Мат. совещания (Москва, 29 – 31 октября 2018 г.) под ред. Т.Б. Леоновой, И.С. Барскова, В.В. Митта, место издания ПИН РАН Москва, том 5, с. 94-99
      • 2018 Они выжили!» Первые находки представителей отрядов Discosorida и Oncocerida? (Cephalopoda, Nautiloidea) в пермских отложениях Шах-Тау, Башкирия
      • Барсков И.С., Бойко М.С., Мазаев А.В.
      • в сборнике Т.Б.Леонова, И.С.Барсков, В.В.Митта (Ред.). Современные проблемы изучения головоногих моллюсков. Морфология, систематика, эволюция, экология и биостратиграфия, место издания Палеонтологический институт РАН Москва, том 5, с. 70-72
      • 1997 Paleontological analysis and comparison of the Moscovian/Kasimovian boundary beds in the Moscow Basin (Russia) and in the Cantabrian Mountains (Spain)
      • Villa E., Alekseev A.S., Barskov I.S., Coquel R., Davydov V.I., van Ginkel A.C., Goreva N.V., Isakova T.N., Kabanov P.B., Kononova L.I., Lazarev S.S., Lebedev O.A., Makhlina M.Kh, Mamet B., Martinez-Chacon M.L., Mendez C., Rodriguez R.M., Sanchez de Posada L.C., Shkolin A.V.
      • в сборнике Proceedings of the XIII International Congress on the Carboniferous and Permian. Prace Panstwowego Instytutu Geologicznego, том 157, с. 173-185
      • 1995 Middle Upper Carboniferous Boundary Interval Biostratigrahy In Moscow Basin. — Moscovian-Kasimovian Stages
      • Alekseev A.S., Barskov I.S., Goreva N.V., Makhlina M.H., Isakova T.N., Lazarev S.S., Kabanov P.B., Lebedev O.A., Shkolin A.V., Kononova L.I.
      • в сборнике In XIII International. Congress Carboniferous.-Permian. (XIII ICC-P) Aug. Abstracts.Krakow, Poland, место издания Panstwowy Instytut Geologiczny Pan Warszawa, с. 4-5
      • 1995 Биостратиграфия пограничных отложений среднего и верхнего карбона Подмосковья
      • Алексеев А.С., Горева Н.В., Махлина М.Х., Исакова Т.Н., Барсков И.С., Лазарев С.С., Кабанов П.Б., Лебедев О.А., Школин А.А., Кононова Л.И.
      • в сборнике Биостратиграфия среднего-верхнего палеозоя Русской платформы и складчатых областей Урала и Тянь-Шаня, место издания ВНИГНИ Москва, с. 88-99
      • 1985 Пограничные отложения девона и карбона Мугоджар
      • Симаков К.В., Алексеев А.С., Барсков И.С., Богословский Б.И., Бывшева Т.В., Гагиев М.Х., Кононова Л.И., Кочеткова Н.М., Кузина Л.Ф., Кулагина Е.И., Оноприенко Ю.И., Пазухин В.Н., Радионова Э.П., Разина Т.П., Рейтлингер Е.А., Смирнова Л.В., Янбулатова М.Г.
      • в сборнике Биостратиграфия пограничных отложений девона и карбона, место издания Северо-Восточный комплексный научно-исследовательский институт АН СССР Магадан, том 9, с. 1-55
  • Книги
      • 2010 Наука о Земле: геоэкология: учебное пособие /Ответ. ред. А.В. Смуров, Ф.И. Василевич, М.И. Непоклонова, В.М. Макеева
      • Барсков И.С., Белая Н.И., Березнер О.С., Бондарев В.П., Ванчуров И.А., Василевич Ф.И., Владыченский А.С., Воронов А.В., Голубева Е.И., Дежкин В.В., Демченко А.Н., Дубинин Е.П., Евстигнеева Т.А., Емельчнова Л.Г., Иванов О.П., Ковалев А.А., Козодеров В.В., Комарова Н.Г., Кочуров Б.И., Кузнецов П.В., Кузьминская К.С., Лаптева Е.М., Лаптева Н.И., Лебедев И.Г., Любченко О.В., Макеева В.М., Непоклонова М.И., Никитин Е.Д., Остапенко В.А., Пантюлин А.Н., Пелымский Г.А., Перевозчиков И.В., Пивоварова И.П., Попова Л.В., Ромина Л.В., Сабодина Е.П., Садовничий В.А., Смуров А.В., Снакин В.В.
      • место издания КДУ Москва, ISBN 978-5-98227-733-6, 564 с.
      • 1995 Палеонтология. Палеоэкология под ред В.П. Макридина и И.С.Барскова
      • Очев В.Т., Красилов В.А., Зиновьев М.С., Раутиан А.С., Макридин В.П., Шуменко С.И., Шиманскuй В.Н., Кузьмичева Е.И., Борисенко Ю.А., Гладенков Ю.Б., Пегета В.П., Алексеев А.С., Барсков И.С., Жилин С.Г., Михайлов К.Е.
      • место издания Недра Москва, ISBN 5 -247- 03463-5 , 494 с.
  • Доклады на конференциях
      • 2018 «Они выжили!» Первые находки представителей отрядов Discosorida и Oncocerida? (Cephalopoda, Nautiloidea) в пермских отложениях Шах-Тау, Башкирия (Устный)
      • Авторы: Барсков И.С., Бойко М.С., Мазаев А.В.
      • Современные проблемы изучения головоногих моллюсков. Морфология, систематика, эволюция, экология и биостратиграфия, Палеонтологический институт им. А.А. Борисяка РАН. Москва, Россия, 29-30 октября 2018
  • Тезисы докладов
      • 1996 Из биосферы — в литосферу. Некоторые закономерности диагенетического распределения элементов в биогенных карбонатах
      • Барсков И.С., Куиф Ж.П., Дофен Я., Дэни Ф., Готре П., Кияшко С.П., Массол М., Шлыков В.Г.
      • в сборнике Проблемы Изучения Биосферы, тезисы докладов Всероссийской научной конференции, Саратов, 3-4 декабря 1996 года, место издания Саратов, тезисы, с. 27-39
      • 1995 Paleontological analysis and comparison of Moscovian/Kasimovian transition in the Moscow Basin (Russia) and in the Cantabrian Mountains (Spain)
      • Villa E., Alekseev A.S., Barskov I.S., Coquel R., Davydov V.I., van Ginkel A.C., Goreva N.V., Isakova T.N., Kabanov P.B., Kononova L.I., Lazarev S.S., Lebedev O.A., Makhlina M.Kh, Mamet B., Martinez-Chacon M.L., Mendez C., Rodriguez R.M., Rodriguez S., Sanchez de Posada L.C., Shkolin A.V.
      • в сборнике XIII International Congress on Carboniferous-Permian. August 28–September 2, 1995. Krakow, Poland. Abstracts, тезисы, с. 146
      • 1994 Биостратиграфия пограничных отложений среднего и верхнего карбона Подмосковья
      • Алексеев А.С., Горева Н.В., Махлина М.Х., Исакова Т.Н., Барсков И.С., Лазарев С.С., Кабанов П.Б., Лебедев О.А., Школин А.В., Кононова Л.И.
      • в сборнике Новые данные по биостратиграфии палеозоя Русской платформы и складчатых областей Урала и Тянь-Шаня. Чтения памяти С. В. Семихатовой. Тезисы докладов, место издания ВНИГНИ Москва, тезисы
  • НИРы
      • 1 января 2016 — 31 декабря 2022 Палеонтологическая и стратиграфическая характеристика фанерозойских и позднепротерозойских отложений России и сопредельных территорий
      • Кафедра палеонтологии
      • Руководители: Барсков И.С., Лопатин А.В. Ответственный исполнитель: Юрина А.Л. Участники НИР: Алексеев А.С., Гатовский Ю.А., Зайцева Е.Л., Зверьков Н.Г., Кононова Л.И., Кузнецова Т.В., Мамонтов Д.А., Назарова В.М., Наумчева М.А., Орлова О.А., Попов Я.А., Розанов А.Ю., Ростовцева Ю.И., Сахненко К.В., Смирнова Т.Н., Сумина Е.Л., Ульяхин А.В., Фелькер А.С., Якимова А.А., Янин Б.Т.
  • Награды и премии
  • Членство в научных обществах
  • Участие в редколлегии журналов
  • Участие в редколлегии сборников
  • Участие в программных комитетах конференций
  • Членство в диссертационных советах
      • 18 декабря 2017 — 20 декабря 2019 МГУ.04.04, МГУ имени М.В. Ломоносова, Геологический факультет
      • 25.00.02 — Палеонтология и стратиграфия (геол.-минерал. науки)
      • зам. председателя
      • Действующие члены совета: Короновский Н.В., Алексеев А.С., Лубнина Н.В., Никишин А.М., Гатовский Ю.А., Банников А.Ф., Барабошкин Е.Ю., Божко Н.А., Бычков А.Ю., Веселовский Р.В., Гаврилов Ю.О., Герман А.Б., Дубинин Е.П., Журавлев А.Ю., Захаров В.С., Казанский А.Ю., Копаевич Л.Ф., Костюченко С.Л., Леонова Т.Б., Лопатин А.В., Марков А.В., Морозов Ю.А., Ростовцева Ю.В., Тевелев А.В., Хераскова Т.Н., Чехович П.А.
  • Руководство диссертациями
  • Диссертации
      • 1979 Морфогенез и экогенез палеозойских цефалопод
      • Докторская диссертация по специальности 25.00.02 — Палеонтология и стратиграфия (биол. науки)
      • Автор: Барсков И.С., д.б.н., проф.
      • Защищена в совете Д 002.212.01 при Палеонтологический институт РАН
      • Организация, в которой выполнялась работа: Палеонтологический институт им. А. А. Борисяка РАН
  • Руководство дипломными работами
  • Авторство учебных курсов
  • Преподавание учебных курсов
  • Выступление в СМИ

Жизнь на Земле могла возникнуть в щелочных озерах с высоким содержанием фосфора

Фосфор — один из шести основных химических элементов, из которых строятся живые организмы. Поэтому считается, что жизнь могла возникнуть только в среде, содержащей свободный фосфор или его соединения. Но, если судить по сохранившимся отложениям, в большинстве древних водоемов концентрация фосфатов была слишком мала для появления первых живых организмов. Есть и исключения — так называемые содовые озера, образующиеся в условиях жаркого климата в бессточных котловинах. Американские ученые изучили современные содовые озера и пришли к выводу, что их аналоги в древности вполне могли стать местом зарождения жизни.

Фосфор играет важную роль для земных живых организмов — он вместе с сахарами формирует основу ДНК и РНК, входит в состав молекул АТФ, поставляющих энергию для большинства биохимических и физиологических процессов, а также участвует в построении клеточных мембран и других частей клеток.

Главный источник фосфора для человека и других организмов — ткани животных и растения. Последние берут этот элемент из почвы, где он также имеет органическое происхождение. Большая часть неорганического фосфора на Земле находится в форме фосфатов — нерастворимых минералов, наиболее распространенным из которых является фосфат кальция апатит (Са5[PO4]3(F, Cl, ОН)). Фосфор в апатите находится в связанном виде, недоступном для вхождения в состав живых организмов.

В свободном состоянии фосфор в природе не встречается из-за высокой химической активности. Поэтому вопрос о том, откуда взялись растворимые в воде соединения фосфора, необходимые для первых организмов, пока остается без ответа. В научной литературе он получил название «проблемы фосфатов».

Американские ученые Джонатан Тонер (Jonathan Toner) и Дэвид Кэтлинг (David Catling) из Вашингтонского университета в Сиэтле предложили вариант решения этой проблемы, рассмотрев в качестве потенциальной «колыбели жизни» карбонатные (содовые) озера. Результаты исследования опубликованы в журнале Proceedings of the National Academy of Sciences.

Содовые озера (см. Soda lake) — это, как правило, бессточные водоемы, образующиеся в засушливом климате в понижениях рельефа и собирающие воду с окружающей территории. Высокая скорость испарения и отсутствие стока приводят к тому, что воды этих озер становятся сильнощелочными (с значением pH от 9 до 12) за счет высокой концентрации в них карбонатных солей, в первую очередь — карбоната натрия.

Минеральные озера с карбонатными водами встречаются по всему миру, как правило, в засушливых и полузасушливых районах. Крупнейшими из них являются Каспийское море, Аральское море, Иссык-Куль, озеро Ван в Турции, озеро Туркана в Кении. Много содовых озер расположено вдоль всей Восточно-Африканской рифтовой долины.

Несмотря на кажущуюся непригодность для жизни из-за высокой щелочности, содовые озера — весьма продуктивные экосистемы. Первичная продукция за счет фотосинтеза в них составляет около 10 г/см2 в день, что более чем в 16 раз превышает среднемировое значение для озер и ручьев (0,6 г/см2 в день, см. J. Melack, P. Kilham, 1974. Photosynthetic rates of phytoplankton in East African alkaline, saline lakes). Наиболее важными фотосинтезаторами в содовых озерах являются цианобактерии, а высокая первичная продукция обусловлена практически неограниченной доступностью растворенного в щелочных водах углекислого газа.

Авторы изучили богатые карбонатами озера: Моно и Серлс в Калифорнии, Лонар в Индии, Магади (lake Magadi) в Кении и одноименное озеро в Танзании (рис. 1). Оказалось, что в этих водоемах уровень фосфора в 50 000 раз выше, чем в реках, морской воде, а также в озерах других типов.

Чтобы выявить химический механизм такого концентрирования, ученые провели эксперименты по осаждению ионов Ca2+ и фосфат-ионов в насыщенных фосфатами и карбонатами растворах. Изменяя начальные соотношения реагентов (NaHCO3, Na2CO3, Na2HPO4 и NaF) — главных компонентов содовых растворов — и время реакции, авторы наблюдали за осаждением из растворов осадка, который затем анализировали с использованием методов оптической эмиссионной спектроскопии с индуктивно-связанной плазмой (ICP-OES — Inductively coupled plasma optical emission spectrometry) и рентгеноструктурного анализа.

Лабораторные тесты показали, что кальций в содовых озерах связывается с карбонат-ионом раньше, чем с фосфат-ионом, оставляя фосфат в свободном доступе в воде. Обычно же фосфор осаждается в виде нерастворимых фосфатов кальция еще до осаждения карбоната кальция. При этом, чем выше содержание в водах растворенного неорганического углерода, тем больше в них остается свободного фосфора (рис. 2).

Обычно в пребиотических экспериментах, в которых получают органические вещества из неорганических молекул, для включения фосфора в биомолекулы (реакции фосфорилирования) используются молярные (с концентрациями более 1 моля) растворы фосфата, чтобы преодолеть его плохую реакционную способность с органическими веществами в воде. Анализы показали, что в среднем воды содовых озер содержат до 0,1 моля фосфата, но в отдельных случаях, например, в особо засушливый период, когда нет притока свежей воды, содержащей Ca2+ или Mg2+, концентрация фосфатов в водах содовых озер за счет испарения может расти вплоть до 1 моль, пока раствор не достигнет насыщения по отношению к солям Na+ — главного катиона содовых озер — и не начнется отложение фосфата натрия. А начнется оно только после осаждения карбоната/бикарбоната натрия и его хлоридных солей.

Так что времени присутствия в растворе свободного фосфата в значительных концентрациях вполне достаточно для того, чтобы начался пребиотический синтез фосфорорганических соединений. Испарение с образованием обогащенного фосфатами осадка по той же схеме может происходить вдоль всех окраин содовых озер вообще постоянно, независимо от притока свежей воды.

Авторы считают, что 4 млрд лет назад на Земле были все условия для формирования таких озер и зарождения в них жизни. Свежие вулканические породы при контакте с насыщенной углекислым газом атмосферой подвергались интенсивному кислотному выветриванию и высвобождающийся при этом из пород фосфор вместе с кальцием поступали в водоемы, где фосфор в результате пребиотических реакций включался в состав строительных блоков для создания РНК, белков и жиров.

В отсутствие микробных поглотителей фосфора этот элемент должен был накапливаться в древних карбонатных озерах в еще более высоких концентрациях, чем в современных озерах. И для этого не требовалась такая высокощелочная среда, как сейчас. Из-за повышенного содержания СО2 в атмосфере насыщенные фосфатом рассолы на ранней Земле могли быть нейтральными или даже слабокислыми (рН 6,5–9, рис. 3).

Ранее эти же авторы показали, что условия содовых озер позволяют формированию высоких концентраций цианидов — солей синильной кислоты, участвующих в синтезе аминокислот, нуклеотидов и предшественников липидов (J. D. Toner, D. C. Catling, 2019. Alkaline lake settings for concentrated prebiotic cyanide and the origin of life). Исследователи экспериментально доказали, что в закрытых щелочных бассейнах мог осаждаться ферроцианид натрия, образующийся при реакции цианистого водорода ранней атмосферы Земли с железом. Последующее термическое разложение ферроцианида натрия приводило к образованию растворимого в воде цианида натрия NaCN, готового для участия в пребиотических реакциях.

Источник: Jonathan D. Toner, David C. Catling. A carbonate-rich lake solution to the phosphate problem of the origin of life // Proceedings of the National Academy of Sciences. 2019. DOI: 10.1073/pnas.1916109117.

Владислав Стрекопытов

94 – Металлогения древних и современных океанов

Е. П. Макагонов

Институт минералогии УрО РАН,

г. Миасс

 

Кристаллографические идеи в минералогии
XX–XXI веков

 

В начале XX в. термин “минерал” еще во многом соответствовал своему этимологическому определению от латинского слова minera – руда. В объекты минералогии входили практически все полезные ископаемые. Классификации минералов строились на химической основе и включали в себя минеральные вещества органического происхождения: соли органических кислот, углеводороды, парафины, смолы, битумы (включая газообразные и жидкие). В. И. Вернадский в 1923 г. писал: “В настоящее время мы называем минералом физически и химически индивидуализированный продукт земных химических реакций, состоящий из химических молекул” [1]. Вместе с тем, значительная часть минералогии касалась твердых веществ, встречающихся в виде кристаллов, описание которых было обязательным атрибутом всех минералогических сводок.

К началу XX в. была завершена теория макрокристаллов. Для правильных систем точек и фигур Е. С. Федоровым и А. Шенфлисом были выведены 230 пространственных групп симметрии. Расшифровка кристаллических структур началась с момента открытия в 1912 г. М. Лауэ явления дифракции рентгеновских лучей на кристаллической решетке. Это открытие стимулировало развитие структурной кристаллографии и кристаллохимии и оказало огромное влияние на развитие минералогии. Также на развитие методов кристаллоструктурного анализа оказали влияние новые представления о строении атомов. В 1913 г. Г. Мозли открыл закон, связывающий положение химического элемента в периодической системе и его характеристическое рентгеновское излучение. На основе этого закона был сделан вывод о том, что атомный номер химического элемента численно равен заряду атомного ядра и, соответственно, общему количеству электронов в оболочке нейтрального атома. Н. Бор и др. разработали модели распределения электронов по уровням и подуровням. Решение уравнения Шредингера для многоатомных систем позволило рассчитывать распределение электронной плотности для кристаллов, величины их энергий и некоторые физические свойства. Это дало возможность разработать теоретические методы моделирования структур минералов и помогло в расшифровке структур сложных соединений.

К середине XX в. минералогические справочники стали пополняться данными по структуре минералов. Кристалличность природных веществ стала определяющей при вычленении минералов из природных объектов. В 1942 г. А. В. Винчел писал, что минерал – кристаллическая фаза, находимая в неорганической природе [7]. В 1946 г. проф. А. С. Уклонский дал определение: минералом следует называть закономерное сочетание атомов и ионов в пространственную решетку, устойчивую при определенной температуре, среде, давлении, обладающее присущими ему физическими и химическими свойствами, которые можно определить при помощи современных методов исследования [5]. В середине века от минералогии отпочковалось учение о каустоболитах и природных коллоидах.

Пространственная решетка кристаллов не допускает существование пятерных осей симметрии и осей с порядком выше шести, известных для отдельных молекул и живых существ. Это послужило основанием для проведения границы между живой и неживой природой. Но полностью освободиться от “некристалличности” минералогии не удалось. С помощью электронного микроскопа Уиттакер обнаружил трубчатое строение хризотил-асбеста. Кристаллическая периодичность в этом минерале сохраняется лишь для плоских сеток и слоев и, к тому же, искривленных. Минералы опал, настуран и др., относящиеся к твердым гелям, не подходили под определение “минерал” – они рентгеноаморфны.

Во второй половине XX в. граница между кристаллами и некристаллами начала размываться. Была обнаружена высокая упорядоченность и кристаллические свойства у ряда соединений, построенных из длинных молекул и обладающих текучестью. В отличие от кристаллов их назвали “квазикристаллами”. Возникли проблемы и с кристаллографической симметрией. В 1984 г. Д. Шехтман и др. из расплава алюминия с марганцем получили кристаллы правильной икосаэдрической формы, т. е. с осями пятого порядка. Чтобы не нарушать стройность классической кристаллографии их назвали “квазикристаллами”.

В 1990 г. В. Кречмер и К. Фостирополус получили новую структурную разновидность чистого углерода, ранее предсказанную теоретически. В отличие от алмаза и графита молекулы нового вещества состояли из 30 атомов углерода и имели икосаэдрическую симметрию. Внешне форма молекул подобна футбольному мячу, сшитому из пятиугольников и шестиугольников. Атомы углерода в такой молекуле располагаются в вершинах многоугольников. В. Кречмер и Д. Хаффман назвали их фуллеренами в честь Бакминстера Фуллерена – создателя икосаэдрического геодезического купола.

В 1997 г. фуллерены были открыты американскими исследователями в карельском шунгите. В настоящее время фуллерены обнаружены в импактных брекчиях, углистых хондродитах, в фульгуритах, возникающих при ударе молнии в углеродсодержащие породы.

К этому времени были изготовлены высокоразрешающие электронные микроскопы, позволяющие видеть и изучать объекты величиной несколько нанометров. Интерес минералогов к новому объекту и возможности изучения минеральных образований размером 10-7–10-9 м привели к открытию на границе XX и XXI вв. нового мира структурно- и морфологически упорядоченных объектов: нанокристаллов, протокристаллов, кластеров, молекулярных агрегатов. В минералогии возникло новое направление – наноминералогия, которая охватила область перехода от молекул к макротелам. В этой области образуются отдельные цепочечные, ленточные, листовые и полиэдрические структуры. В предкристаллическом состоянии ленточные молекулы могут скручиваться в спирали, слои – в трубки, возникают агрегаты полиэдров.

Оказалось, что наноструктуры не только образуют фазово-обособленные наноиндивиды, но и являются структурными элементами (частями) минеральных индивидов. Изгибание слоев при формировании наноминералов характерно не только для листовых силикатов, но и для сульфидов типа молибденита и других минералов. Внутреннее строение минеральных индивидов в виде нитей обнаружено у самородных металлов, кварца, галита и др. Субфуллереновая глобулярная структура оказалась не только у шунгитов и опалов. Она имеется во фрамбоидальном самородном золоте, пирите, у минералов марганца. Можно сказать, что рост минералов осуществляется путем сборки наноиндивидов. Практическая минералогия открывает явления, которые теоретически предсказали кристаллографы в 50–70-х годах XX в. в рамках различных симметрий: симметрии подобия А. В. Шубникова, многоцветной симметрии Н. В. Белова, криволинейной симметрии Д. В. Наливкина, гомологии В. И. Михеева, теории реберных и вершинных форм И. И. Шафрановского и др.

Примечательным оказалось и то, что подобные постройки обнаруживаются и у предбиологических и простейших биологических структур. На минеральные наноструктуры похожи капсулоподобные нанобактерии с минеральными оболочками и жидкостью внутри полостей. Структурно подобны наноуглеродным минеральным индивидам простейшие вирусы, которые часто имеют икосаэдрическую симметрию. Кристаллоподобными очертаниями обладают железобактерии. По фуллереновому типу построены кремниевые скелеты радиолярий. Н. П. Юшкиным еще в 1971 г. на примере формирования самородной серы выделен был особый биологический способ зарождения кристаллов.

Биоминеральные агрегаты гетит-лепидокрокитового, железо-марганцевого, серного, сульфидного, кремниевого и алюмосиликатного составов обнаруживаются на всей поверхности Земли, особенно в зонах тропического климата. В наиболее концентрированном виде они наблюдаются на гидротермальных полях, в зонах развития подводных курильщиков, где широко развиты бактериальные маты кальций-железо-кремниевого состава.

Биоминеральные оазисы оказались генетической причиной образования некоторых сульфидных месторождений, яшм, бурых железняков, марганцевых руд, бокситов, а также скоплений благородных металлов, ванадия, фосфора, урана в черных сланцах. Таким образом, на границе XX и XXI вв. в круге интересов минералогии оказались минерально-органические соединения, отторгнутые от минералогии в середине XX в.

Переход от атомов к молекулам и, далее, к наноиндивидам и минералам характеризует одну сторону эволюционного ряда развития минеральных систем. С другой стороны этого ряда формируются сростки и минеральные агрегаты. В середине XX в. Х. Кюриен и И. Ле Корр применили идеи двуцветной симметрии к выводу законов двойникования. Полный вывод этих законов был сделан В. А. Мокиевским, И. И. Шафрановским и др. в 1966 г. В 1976–1991 гг. на основе цветной симметрии нами был завершен вывод законов симметрии для любых срастаний [2]. Среди групп симметрии, описывающих эти законы, имеются некристаллографические и предельные группы.

Сростки минералов образуются не только путем простой совместной кристаллизации соприкасающихся индивидов, но и при преобразованиях минералов: полиморфных переходах, механическом двойниковании, переходах типа порядок-беспорядок. При этих явлениях происходит деформация кристаллической решетки. Наиболее простые деформации совершаются с помощью сдвигов, растяжений-сжатий. При таких деформациях прямоугольные кристаллические ячейки преобразуются в косоугольные и наоборот.

Пытаясь решить задачу преобразования минералов в природе, мы пришли к выводу, что симметрия их кристаллических решеток не исчезает, а из прямоугольной переходит в косоугольную. Еще в начале XX в. Е. С. Федоров выделил два предельных вида кристаллические структуры: кубические и гексагональные. Все остальные структуры отличаются от предельных видов на малые углы. В середине XX в. В. И. Михеев, разрабатывая способ расшифровки рентгенограмм для порошковатых неокристаллизованных минералов, обратил внимание на схожесть структур высокосимметричных и низкосимметричных кристаллов. Используя представления Е. С. Федорова, В. И. Михеев вывел точечные группы косой симметрии, которые он назвал группами гомологии. Группы гомологии удобно рассматривать в косоугольных (аффинных) координатах. Термин “гомология” широко употребляется в науке для характеристики подобных, схожих, равных объектов, поэтому Михеевские группы были названы нами “аффинными кристаллографическими группами гомологии”.

В конце XX в. был сделан вывод всех групп аффинной гомологии, включая кристаллографические пространственные, некристаллографические и предельные, определены гомологические свойства кристаллических решеток, разработаны схемы изменения симметрии и гомологии при образовании механических двойников. В начале XXI в. эти исследования объединены в учении о косоугольной симметрии – “аффинной гомологии кристаллов” [3].

Комплекс теорий о симметрии сростков и гомологии позволяет с позиций обобщенной симметрии описать процесс формирования и преобразования не только структур, состоящих из минеральных индивидов, но и применим для описания процессов сборки и перестройки наноминеральных структур.

Параллельно кристаллоструктурному направлению развивались представления о природе кристаллохимической связи. В начале века одновременно возникли первые электронные модели химической связи В. Косселя (ионная связь) и Дж. Льюиса (ковалентная связь). Затем разработан был метод валентных связей и молекулярных орбиталей. Последовательно развивались теории кристаллического (лигандного) поля, молекулярных орбиталей, зонная теория. Созданию этих теорий с 50-х годов XX в. способствовала разработка методов спектроскопии твердого тела.

Кристаллохимические и кристаллофизические представления применяются минералогами для установления связи генезиса и особенностей структур, состава и свойств минералов. Сведения о квантовой теории строения атомов использовались в минералогии А. Е. Ферсманом, В. И. Вернадским, В. М. Гольдшмидтом, Д. П. Григорьевым, В. И. Лебедевым, А. С. Поваренным, У. Файфом, Р. Бернсом, А. С. Марфуниным и др.

В целом было определено, что принципиальные отличия между отдельными видами связи в кристаллах отсутствуют, и имеется непрерывный переход между предельными случаями: ионной, ковалентной, металлической и остаточной (ван-дер-ваальсовой) связями. Как отметил В. С. Урусов в учебнике теоретической кристаллохимии, природа химической связи едина – это электростатическое взаимодействие электронов и ядер внутри и между атомами, сближенными на расстояния, когда возникает эффективное перекрывание электронных оболочек [6].

В 80-х годах прошлого столетия популярность приобретают исследования деформационной электронной плотности в кристаллах – разницы между наблюдаемым распределением и суммарной плотностью сферически симметричных атомов. Эти исследования показали, что сгущения электронных плотностей для большинства кристаллических структур имеют вид асимметричных эллипсоидальных частиц. На это указывают и дробные эффективные радиусы зарядов атомов в кристалле, которые определяются как разность между числом электронов, реально принадлежащих окрестностям атома в структуре и числом электронов в нейтральном атоме. Известно, что в лигандном (кристаллическом) поле симметрия электронных оболочек нарушается, и это проявляется в расщеплении энергетических спектров кристаллов. Эллипсоидальная форма строения атомного ядра также более отвечает экспериментальным данным, чем сферическая.

Но при асимметричности частиц, структуры кристаллических соединений обладают правильным решетчатым строением, поэтому реальную картину распределения связей в кристалле можно получить, построив правильные системы асимметричных частиц. Эту задачу начал решать В. В. Нардов в 60-х годах XX в. В настоящее время нами сделан полный вывод подобных систем для низшей категории, в которой кристаллизуется 80 % минералов земной коры [4].

В разрабатываемой теории частицы, при собственной асимметричности, различаются направлениями связи (точками соприкосновения с другими частицами) с разными ориентирующими свойствами (способностью присоединять другие частицы с разворотами, инверсией, зеркальным отражением или их комбинациями). Соответственно, мы получаем классификацию частиц, присоединение которых к первичной частице происходит согласно законам распределения симметрийных связей в частицах и определяет строение всех построек, описываемых Федоровскими группами симметрии. Возможно, что именно эти свойства асимметричных частиц приводят к объединению их в соответствующие молекулы, наноминералы и кристаллические постройки.

 

Литература

  • Вернадский В. И. История минералов земной коры. Т. 1, вып. 1. М.-Л. 1923. 208 с.
  • Макагонов Е. П. Симметрия сростков минеральных индивидов. М.: Наука. 1991. 195 с.
  • Макагонов Е. П. Аффинная гомология кристаллов. Миасс: ИМин УрО РАН, 2002. 140 с.
  • Макагонов Е. П., Макагонов П. Е. Кристаллографические системы асимметричных частиц, низшая категория // Уральский минералогический сборник № 12. Миасс: ИМин РАН, 2002. С. 122–133.
  • Уклонский А. С. Новое определение понятия “минерал” // Вопросы минералогии, геохимии, петрографии. М., 1946. С. 15–19.
  • Урусов В. С. Теоретическая кристаллохимия. М.: МГУ, 1987. 275 с.
  • Winchell A. N. Elements of mineralogy emphasisng the variations in minerals. New York, 1942

Original text

4.5789370536804

Languages

  • العربية
  • বাংলা
  • Български
  • Bosanski
  • Català
  • Čeština
  • Dansk
  • Deutsch
  • Eesti
  • Ελληνικά
  • Español
  • Esperanto
  • Euskara
  • فارسی
  • Français
  • Galego
  • 한국어
  • Hrvatski
  • Bahasa Indonesia
  • Italiano
  • עברית
  • ქართული
  • Latviešu
  • Lietuvių
  • Magyar
  • Македонски
  • Bahasa Melayu
  • Nederlands
  • 日本語
  • Norsk bokmål
  • Norsk nynorsk
  • Polski
  • Português
  • Română
  • Русский
  • Slovenčina
  • Slovenščina
  • Српски / srpski
  • Srpskohrvatski / српскохрватски
  • Suomi
  • Svenska
  • ไทย
  • Türkçe
  • Українська
  • Tiếng Việt
  • 中文

Альтернативный механизм патогенной внутри- и внеклеточной кальцификации и камнеобразования

Abstract

Фосфат кальция откладывается при многих заболеваниях, но механизмы образования остаются предположительными. Нанобактерии — это мельчайшие бактерии с клеточными стенками, недавно обнаруженные в крови человека и коровы, а также в сыворотке коммерческой клеточной культуры. В этом исследовании мы установили с помощью энергодисперсионного рентгеновского микроанализа и химического анализа, что все фазы роста нанобактерий производят биогенный апатит на их клеточной оболочке.ИК-спектроскопия с преобразованием Фурье выявила минерал как карбонат-апатит. Биоминерализация в средах для культивирования клеток привела к образованию биопленок и минеральных агрегатов, очень похожих на те, которые обнаруживаются при кальцификации тканей и камнях в почках. В фибробластах, инфицированных нанобактериями, электронная микроскопия выявила внутри- и внеклеточные отложения игольчатых кристаллов, окрашиваемых окрашиванием по фон Коссу и напоминающие кальсосферы, обнаруженные при патологической кальцификации. Предыдущие модели камнеобразования привели к гипотезе о том, что повышенный pH из-за активности уреазы и / или щелочной фосфатазы является литогенным фактором.Наши результаты показывают, что карбонат-апатит может образовываться без этих факторов при pH 7,4, при физиологических концентрациях фосфата и кальция. Нанобактерии могут производить апатит в среде, имитирующей тканевые жидкости и клубочковый фильтрат, и представляют собой уникальную модель для исследований кальцификации in vitro .

Образование дискретных и организованных неорганических кристаллических структур внутри макромолекулярных внеклеточных матриц — широко распространенное биологическое явление, обычно называемое биоминерализацией.Кость млекопитающих и зубная эмаль являются примерами биоминерализации с участием минералов апатита. Молекулярные основы минерализации остаются в значительной степени неизвестными (1). В последнее время бактерии стали участвовать в биогеохимических циклах образования минералов в водных отложениях (2, 3). Основным компонентом современных аутигенных фосфатных минералов в морских отложениях является карбонат (гидрокси) фторапатит Ca 10 (PO 4 ) 6-x (CO 3 ) x (F, OH) 2 + x .Микроорганизмы способны откладывать апатит вне термодинамического равновесия в морской воде. Они могут отделять Ca от Mg и активно зародышеобразовать карбонат-апатит с помощью специфических олигопептидов в условиях pH <8,5 и [Mg]: [Ca]> 0,1 (4). Такие состояния присутствуют и в организме человека.

Мы обнаружили цитотоксические нанобактерии в крови человека и коровы in vitro (5) и in vivo (6). Они депонированы в DSM (№ 5819–5821; Брауншвейг, Германия).Нанобактерии обладают необычными свойствами, что затрудняет их обнаружение стандартными микробиологическими методами. Хотя обычно они имели диаметр 0,2–0,5 мкм, они проходили через фильтры 0,1 мкм, вероятно, потому, что крошечные формы (0,05–0,2 мкм) также наблюдались в просвечивающей электронной микроскопии (ПЭМ) (7). Нанобактерии были плохо разрушаемыми, окрашиваемыми, фиксируемыми и исключительно устойчивыми к нагреванию (8, 9). Их время удвоения составило около 3 дней. Высокие дозы γ-облучения или аминогликозидных антибиотиков предотвращали их размножение.Согласно последовательности гена 16S рРНК (EMBL {«type»: «entrez-нуклеотид», «attrs»: {«text»: «X98418», «term_id»: «1666476»}} X98418 и {«type»: » entrez-nucleotide «,» attrs «: {» text «:» X98419 «,» term_id «:» 1666477 «}} X98419), нанобактерии попадают в подгруппу α-2 Proteobacteria, которая также включает Brucella и Bartonella видов (10). К последним родам относятся патогены человека и животных, которые имеют сходство с нанобактериями, например, некоторые антигены (наши неопубликованные данные), внутри- и внеклеточное расположение в организме хозяина и цитопатические эффекты (5).

В этом исследовании мы представляем доказательства того, что нанобактерии могут действовать как центры кристаллизации (очаги) для образования биогенных структур апатита. Процесс минерализации был изучен in vitro с одним изолятом крупного рогатого скота из коммерческой эмбриональной сыворотки крупного рогатого скота (FBS) и изолятом человека. Наши результаты вызывают озабоченность в медицине, потому что нанобактериальная бактериемия встречается у людей, а нанобактериальные очаги могут инициировать патологическую кальцификацию.

МАТЕРИАЛЫ И МЕТОДЫ

Методы культивирования нанобактерий.

Нанобактерии культивировали в среде DMEM (GIBCO) в условиях культивирования клеток млекопитающих (37 ° C; 5–10% CO 2 / 90–95% воздуха). Сыворотка использовалась в конечной концентрации 10% в качестве добавки и источника нанобактерий, которыми были FBS (лот 5; Sera-Lab, Crawley Down, Sussex, UK) или человеческая сыворотка от 29-летнего финского мужчины, как описано ранее (5). Культуры были приготовлены с использованием строгих асептических методов в учреждении для культивирования клеток. Образцы нанобактерий фильтровали через 0.Фильтры 2 мкм перед культивированием. Субкультуры были сделаны с использованием той же сыворотки или γ-облученной FBS (γ-FBS) в качестве культуральной добавки. FBS и нанобактерии подвергали γ-облучению, если указано, в минимальной дозе 30 кГр, вводимой при комнатной температуре в течение примерно 16 часов (Kolmi-Set, Ilomantsi, Финляндия).

Субкультивирование нанобактерий в бессывороточной среде DMEM проводили с ежемесячными пассажами 1:11 в течение 5 лет. Нанобактерии SF прочно прикрепляются ко дну культурального сосуда. Эти культуры пассировали или собирали резиновым скребком.Культуры были созданы на среде Loeffler с добавлением 10% кондиционированной среды из культуры нанобактерий, а DMEM заменил воду в формуле (11). Инкубационный период составлял 6 недель в условиях культивирования клеток.

Использовали только чистые культуры нанобактерий. Положительная идентификация нанобактерий включала типичные скорости роста и оптические свойства, специфическую окрашиваемость Hoechst 33258 и непрямое иммунофлуоресцентное окрашивание (IIFS), как описано ниже. Были проведены контрольные эксперименты, чтобы определить, может ли происходить спонтанная кристаллизация в культуральной среде.Среду инкубировали с γ-FBS или γ-облученными нанобактериями или без них (10). Ни минерализации, ни размножения нанобактерий не наблюдалось даже во время 6-месячного наблюдения.

Приготовление и заражение клеток 3T6.

Клетки 3T6 (ATCC CCL 96) культивировали на покровных стеклах, как описано ранее (5). Культуры нанобактерий SF соскребали, к культурам клеток добавляли порции по 100 мкл и инкубировали в течение 24 часов в инкубаторе. В контрольные эксперименты добавляли только DMEM.ТЕМ, IIFS (5), окрашивание ДНК и фон Коссы использовали для наблюдения за взаимодействием клеток с нанобактериями SF.

Камни в почках.

Тридцать случайно собранных камней в почках (K-SKS; Центральная лаборатория анализа камней, Ювяскюля, Финляндия) были деминерализованы в 1 M HCl, а затем нейтрализованы (2), центрифугированы при 14000 × g в течение 15 минут, и гранулы использованы для IIFS и ТЕМ. Часть гранул суспендировали в DMEM, стерилизовали фильтрованием и культивировали в DMEM с добавлением γ-FBS в условиях культивирования нанобактерий.

Способы окрашивания. Окрашивание ДНК

флуорохромом Hoechst 33258 проводили, как описано в наборе Hoechst Stain (Flow Laboratories), за исключением случаев, когда указано, увеличивая концентрацию красителя с 0,5 мкг / мл до 5 мкг / мл (7). В IIFS использовали анти-нанобактериальные моноклональные антитела класса IgG 1 , Nb 8/0 и Nb 5/2 (5). Эпитоп последнего mAb инактивировали, инкубируя его в боргидрате натрия (3 × 1 мин; 0,5 мг / мл в PBS), если указано, для проверки специфичности связывания.Образцы просматривали под микроскопом Nikon Microphot-FXA с флуоресцентной оптикой и оптикой дифференциального интерференционного контраста (ДИК). Специфическое определение кальцификации проводили с помощью окрашивания по фон Коссу (12). Клетки 3T6, подвергшиеся воздействию нанобактерий SF в течение 48 часов, использовали в качестве образцов.

Электронная микроскопия и энергодисперсионный рентгеновский микроанализ (EDX).

Для отрицательного окрашивания нанобактерии выделяли центрифугированием при 40000 × g в течение 1 часа непосредственно из FBS, разведенного 1: 5 в PBS.Медную сетку размером 400 меш с углеродным покрытием помещали на каплю суспензии нанобактерий в PBS на 1 мин, промывали водой и окрашивали на капле 1% -ной фосфорновольфрамовой кислоты в течение 90 секунд. Сканирующую электронную микроскопию (СЭМ) и ПЭМ выполняли, как описано ранее (5). Топографические особенности нанобактерий исследовали с помощью сканирующего электронного микроскопа, оснащенного EDX, как описано ранее (13). Гидроксиапатит (№-H-0252; Sigma) был использован в качестве ссылки.

ИК-спектроскопия с преобразованием Фурье (FTIR), химический анализ и ферментные анализы.

Гидроксильные и карбонатные группы в минералах апатита были обнаружены с помощью FTIR в K-SKS (Центральная лаборатория анализа камня) по стандартному методу (14). Химический анализ нанобактерий проводили, как описано ранее (15). Активность фермента уреазы анализировали стандартным методом (16) и щелочной фосфатазой (ЩФ) с p -нитрофенилфосфатом в качестве субстрата при pH 9,5.

РЕЗУЛЬТАТЫ

Свойства культуры, морфология и образование апатита нанобактериями в средах, содержащих сыворотку.

Световая микроскопия с оптикой DIC выявила едва обнаруживаемые нанобактерии около дна культурального сосуда примерно после 1-недельного периода культивирования. Через 2 недели нанобактерии появились в виде групп, хорошо видимых под микроскопом. Через 1 мес. Многие из них образовали сгустки и начали прикрепляться к дну культурального сосуда, а к концу 2 мес. Большинство из них оказались в биопленке белого цвета, видимой невооруженным глазом. Критериями чистой культуры нанобактерий служили рефрактерные агрегаты типичных кокковидных частиц (рис. A ), показывающий окрашиваемость ДНК (рис. B ) только модифицированным методом, отрицательный результат культивирования на агаре с овечьей кровью и положительный результат IIFS с mAb против нанобактерий (5).

Световые и электронные микроскопические изображения нанобактерий и их анализ с помощью EDX. ( A ) ДИК-изображение прикрепленных к дну нанобактерий после 2-месячного периода культивирования. ( B ) Окрашивание ДНК той же площади (× 1600) модифицированным методом Hoechst. ( C ) Отрицательное окрашивание нанобактерий, выделенных непосредственно из FBS.(Полоса = 200 нм.) ( D ) СЭМ-микрофотография, показывающая их переменный размер. (Полоса = 1 мкм.) ( E ) Делящаяся нанобактерия, покрытая «волосатым» слоем апатита. (Полоса = 100 нм.) ( F ) Микрофотография ПЭМ нанобактерий, погребенных в слое апатита после 3-месячного периода культивирования (полоса = 1 мкм) и G при более высоком увеличении (полоса = 200 нм). Белые центральные области в F являются артефактами из-за потери минерального слоя при секционировании. ( H ) EDX-анализ нанобактерий в SEM, показывающий пики Ca и P, аналогичные пикам гидроксиапатита ( I ).

Отрицательное окрашивание нанобактерий в некультивируемых FBS выявило кокковидные частицы размером от 0,2 до 0,3 мкм (рис. C ). После 1-месячного периода культивирования SEM выявила аналогичные формы кокковидных форм диаметром 0,2–0,5 мкм (рис. D ). Их шероховатые поверхности напоминали те, что были видны на ПЭМ (рис. E – G ). Во время более длительных периодов культивирования они в основном прикреплялись к культуральному сосуду и, наконец, оказывались в минеральном слое (Рис. F и G ). Химический анализ с использованием EDX дал те же пики Ca и P, что и для гидроксиапатита (рис. H и I ). Культуры человеческого изолята дали идентичные результаты (не показаны). Химический анализ нанобактерий, собранных после 3-месячного периода культивирования, показал высокое содержание неорганического материала. Сухая масса гранул варьировалась от 23 до 39% и состояла из: N 1–1,3%; Р 12,3–14,6%; Ca 23,4–23,5%; Mg 1,4–1,9%; К 0,1%; и Na 1,2–1,4%. FTIR показал, что карбонат-апатит присутствовал в образцах всех возрастов культур от 7 до 180 дней как у человеческих, так и у бычьих нанобактерий.Контрольный гидроксиапатит был правильно идентифицирован в тесте. Аналитические методы не исключают возможное присутствие незначительных количеств других минеральных фаз. Чтобы исключить такую ​​возможность, нужен кристаллографический анализ. Нанобактерии не проявляли активности уреазы или АР, и их питательная среда оставалась при pH 7,4.

Образование апатита нанобактериями в среде Леффлера.

Макроскопические колонии нанобактерий на модифицированной среде Леффлера (рис. A и B ) были каменистыми, серовато-коричневыми, проходимыми, проникали через слой среды и прикреплялись ко дну культурального сосуда после 6 недель культивирования.IIFS с mAb против нанобактерий (данные не показаны) и ПЭМ выявили нанобактерии, покрытые игольчатыми кристаллами апатита (фиг. C ), подобными кристаллам гидроксиапатита (фиг. D ).

Каменные колонии нанобактерий и сравнение с гидроксиапатитом. ( A ) Колонии на модифицированной среде Леффлера в 10-сантиметровом планшете. Колонии проникали сквозь среду, образуя каменные столбы. Стрелка показывает одну типичную серовато-коричневую колонию, изображенную в B . (× 40.) ( C ) Отложения игольчатых кристаллов в столбе, обнаруженные с помощью просвечивающей электронной микроскопии. (Бар = 200 нм.) ( D ) ПЭМ-изображение эталонных кристаллов апатита. (Бар = 100 нм.)

Образование апатита нанобактериями в среде SF.

Когда отмытые гранулы нанобактерий или нанобактерии SF субкультивировали в SF DMEM, прикрепляющиеся к дну кокковидные организмы наблюдались в течение 1 дня. ДИК-микроскопия выявила минеральный слой толщиной в несколько микрометров вокруг каждой нанобактерии, достигающий размера дрожжей в течение 1 недели (рис. А ). Их морфология сильно отличалась от коккоидных нанобактерий, но наблюдалась аналогичная окрашиваемость ДНК (рис. B ). Они производили биомассу примерно вдвое быстрее, чем в культурах, содержащих сыворотку. Метаболическое включение [ 35 S] метионина и [5- 3 H] уридина является доказательством их репликации (17). ДИК-микроскопия показала размножение нанобактерий внутри минеральных образований (Рис. C ). Эти апатитовые укрытия, которые, как было показано на сканирующем электронном микроскопе, имели полую внутреннюю часть, по-видимому, были местом обитания организмов (рис. E и F ). Размер полости, вероятно, зависит от количества содержащихся в ней нанобактерий (рис. F ). По-видимому, отверстия полостей были обращены ко дну культурального сосуда до соскабливания. Таким образом, апатитовые укрытия обеспечивали полную защиту организмов. Культуры можно было пересаживать ежемесячно в течение более 5 лет и всегда следовали аналогичной схеме роста. После добавления γ-FBS эти нанобактериальные образования вернулись к формам, обнаруженным в сывороточных культурах (см.рис. D ). EDX доказал, что укрытия были апатитовыми по своей природе. FTIR определила, что это карбонат-апатит. Изолят человека образовывал аналогичные образования.

Нанобактерии, культивируемые в условиях СФ, и их взаимодействие с клетками. ( A ) Микрофотография светового микроскопа. ( B ) Окрашивание ДНК той же области модифицированным методом окрашивания Hoechst. ( C ) ДИК-изображения нанобактерий внутри обычного апатитового укрытия. ( D ) Частично деминерализованная группа нанобактерий ( A – D , × 860).( E и F ) СЭМ-микрофотографии жилищ нанобактерий, отделенных от культурального сосуда. (Полосы = 1 мкм.) ( G ) IIFS интернализованных минерализованных нанобактерий (белые стрелки) в клетках 3T6. ( H ) Окрашивание ДНК той же области стандартным методом Hoechst. (× 540.) ( I – L ) ПЭМ-микрофотографии внутриклеточных кальцификаций в клетках 3T6, вызванных нанобактериями SF. (Столбики: I и K = 2 мкм; J = 500 нм; L = 200 нм.)

Внутри- и внеклеточная кальцификация в культурах фибробластов.

Клетки 3T6, инфицированные в течение 48 часов нанобактериями SF, показали измененную морфологию клеток, например, большую вакуолизацию интернализованными нанобактериями SF (рис. G ). Контрольные клетки были отрицательными (не показаны). Стандартное окрашивание ДНК инфицированных нанобактериями клеток не выявило обычного загрязнения (рис. H ). ПЭМ иногда выявляла нанобактерии SF, прикрепленные к поверхности клетки, но в основном они находились в различных компартментах внутри клеток (рис. I – L ), включая ядро ​​(не показано). Окрашивание по фон Косса выявило внутри- и внеклеточную кальцификацию в этих клетках (рис. D и E ). В сильно инфицированных клетках наблюдались ядерные аномалии, например, макронуклеусы, как показано на фиг. E , и аномальная форма ядра (фиг. G , H , K и L ). Контрольные клетки были отрицательными по фон Коссу и не имели ядерных аномалий (фиг. F ).

Примеры внеклеточной и внутриклеточной кальцификации нанобактериями.Микрофотография ПЭМ культивированных нанобактерий (полоса = 200 нм) из FBS ( A ) и бактерии в почечном камне после деминерализации ( B ; полоса = 50 нм). ( C ) IIFS того же почечного камня с mAb против нанобактерий. ( D и E ) результаты окрашивания по фон Коссы клеток 3T6, подвергнутых воздействию нанобактерий SF в течение 24 часов. ( F ) Отрицательный контроль. (× 270.)

Обнаружение нанобактериальных антигенов в почечных камнях.

Мы провели пилотное исследование 30 камней в почках человека, чтобы определить, можно ли найти нанобактерии.Специфичные для нанобактерий mAb, обнаруживающие белковый эпитоп (5), выявили положительные кокки размером с нанобактерии в различных концентрациях во всех 30 деминерализованных камнях с использованием IIFS. Изображение соответствующего образца показано на Рис. C . Результаты могут быть повторены с другим специфическим для нанобактерий mAb, Nb 5/2, которое обнаруживает углеводный эпитоп, и связывание может быть отменено обработкой боргидратом натрия, который разрушает углеводные антигены. Специфичность была дополнительно подтверждена отрицательными результатами окрашивания четырьмя различными mAb (класс IgG 1 ), обнаруживающими нерелевантные антигены (данные не показаны).Бактерии такого же размера и морфологии (рис. B ), что и нанобактерии (рис. A ), были обнаружены в строго положительных камнях с помощью ПЭМ (рис. B и C ). В условиях культивирования нанобактерий стерильно отфильтрованные экстракты всех камней выявили микроорганизмы, обладающие скоростью роста, морфологией, минерализацией и окрашивающими свойствами нанобактерий.

ОБСУЖДЕНИЕ

Мы обнаружили системы культивирования нанобактерий, которые позволяют воспроизводимо производить кальцификацию апатита in vitro .В зависимости от условий культивирования могут образовываться крошечные частицы размером с наноколлоид, покрытые апатитом или биопленкой, песком, камнями и опухолевидными наростами апатита (таблица). Основным условием минерализации был низкий уровень неповрежденной сыворотки в культуральной среде. Сыворотка содержит мощные белковые ингибиторы образования кристаллов апатита, остеопонтин, остеокальцин (1) и фетуин (18), что может объяснить наблюдаемое ингибирование и даже растворение образующихся минералов после пополнения FBS.В случае культур нанобактерий в среде, содержащей сыворотку, ингибиторы допускали только краевую минерализацию. Минерализация увеличивалась параллельно с разбавлением сыворотки в среде для культивирования клеток. Наконец, в среде SF образование апатита было обширным и быстрым. Хотя модифицированная среда Лёффлера содержит 75% сыворотки, белки сыворотки были денатурированы на этапах стерилизации. Таким образом, образование апатита не ингибировалось, в результате чего за 6 недель образовывались твердые колонии апатита диаметром около 1–5 мм.Живые нанобактерии необходимы для производства апатита в модели нанобактерий. γ-Облученные нанобактерии не размножались, и, хотя они могли собирать на себе апатит, заметного кальцификации не производилось даже после 6-месячной инкубации.

Таблица 1

Культурность нанобактерий и образование апатита

Условия культивирования Репликация Размер Апатит и его форма
S
10–50% сыворотки в DMEM + S ++, наноколлоид
DMEM + L +++, песок
50% моча + L +++, песок
Моча +/− n.е. н.э.
Модифицированная среда Лёффлера + L +++, похожая на опухоль

Химический анализ показал, что общий состав биопленки и образования твердых минералов аналогичен составу кости, за исключением карбонатного апатита образовался, как и в большинстве кальцификаций внескелетных тканей и камней, тогда как в костях гидроксиапатит является преобладающей формой. Для изучения апатитовой минерализации in vitro (19–21), e.g.,: ( i ) Бактериальные модели (почечных) камней с использованием бактерий, обладающих уреазной и часто AP-активностью (22, 23). ( ii ) Культуры остеобластных клеток для изучения образования кости. Как правило, образование апатита требует повышенных уровней P i и / или Ca 2+ и активности АР (24). ( iii ) Гелевые и другие неорганические модели кристаллизации, которые обычно использовали насыщенные или перенасыщенные растворы Ca 2+ и P i с макромолекулярными компонентами или без них для кристаллизации (19, 20).В модели нанобактерий апатит образовывался при [Ca] 1,8 мМ и [P i ] 0,9 мМ или менее без пополнения среды.

Нанобактерии могут вызывать кальцификацию и камнеобразование in vivo потому, что: ( i ) Нанобактерии были обнаружены в крови человека (10). ( ii ) Было показано, что нанобактерии переносятся из крови в мочу как живые организмы (6). ( iii ) Нанобактериальные антигены были обнаружены в камнях в почках человека.( iv ) Было показано, что нанобактерии инфицируют фагоцитирующие клетки (фибробласты), что приводит к внутри- и внеклеточной кальцификации, видимой при окрашивании по фон Косса, и с внешним видом концентрического слоя, аналогичным кальцосферу Михаэлиса – Гутмана, обнаруживаемой при малакоплакии.

Малакоплакия — редкое хроническое воспалительное заболевание неизвестной причины, но в нем участвует бактериальный фактор. Заболевание возникает в виде опухолевых разрастаний в мочеполовой системе (мочевой пузырь, почки, мочеточник и уретра), характеризующихся интенсивным инфильтратом гистиоцитов, содержащих внутри- и внеклеточные кальцосферы, состоящие из апатита.Их размер и структура в ПЭМ (25) очень напоминают наши кальцифицированные нанобактерии. Возможная роль нанобактерий в формировании тел Михаэлиса – Гутмана требует дальнейшего изучения.

Апатит может играть ключевую роль в образовании всех камней в почках. Кристаллическими компонентами камней мочевыводящих путей являются оксалат кальция, фосфат кальция, струвит, пурины или цистин. Большинство мочевых камней представляют собой смесь двух или более компонентов, причем первичной примесью являются оксалат кальция и апатит (26).Кроме того, исследования на моделях ферментера показали, что очаги фосфата кальция всегда образуются изначально и впоследствии могут быть покрыты оксалатом кальция или другими компонентами (27). СЭМ показывает большое сходство по размеру и морфологии SF нанобактерий и камней в почках человека (ссылка 28; http://www.herringlab.com/sems/sems 2.html), которые образованы из небольших единиц апатита.

Нанобактерии были обнаружены во всех 30 исследованных нами камнях в почках. В экспериментах на животных нанобактерии с радиоактивной меткой эффективно выводились из крови в мочу (6).Ранее считалось, что бактериальным происхождением являются только струвитные камни (4–15% всех камней в почках), состоящие из фосфата магния-аммония и небольшого количества апатита. Они образуются in vitro и, вероятно, in vivo за счет Proteus , стафилококков и Escherichia coli , которые продуцируют уреазу (29), повышая местный pH до более литогенных уровней. AP может увеличить литогенность. Нанобактерии не продуцируют уреазу или АР, но образуют ядра карбонат-апатита непосредственно на своей поверхности при pH 7.4, предполагая наличие зародышевых молекул. Поскольку нанобактерии культивируются в физиологических условиях в средах, аналогичных по составу клубочковому фильтрату, нанобактерии предлагают уникальную модель образования камней в почках.

Кальцификация тканей карбонат-апатита в природе является обычным явлением при других заболеваниях, например, в атеросклеротических бляшках накапливается фосфат кальция. У пациентов, находящихся на гемодиализе, могут развиваться обширные метастатические и опухолевые кальцификации, механизмы которых не совсем понятны (30).Острый периартрит — это апатитовая артропатия, связанная с интрандинозными кальцификациями. Также известно, что кристаллы апатита вызывают воспаление при попадании в синовиальное пространство (31). Кальцификация тканей обнаруживается при нескольких злокачественных заболеваниях (25). Многие злокачественные клетки имеют рецепторы для прикрепления нанобактерий (5), которые могут вводить нанобактерии в опухоль с последующей кальцификацией, как показано здесь при окрашивании трансформированных фибробластов по фон Коссу.

Человеческие и коровьи нанобактерии растут одинаково, имеют одинаковые поверхностные антигены и другие особенности, и оба производят карбонат-апатит.Возможная роль нанобактерий в различных патологических состояниях кальцификации изучается. Тем временем нанобактерии представляют собой уникальную модель для оценки кальцификации in vitro в физиологических условиях.

Предварительная оценка нанобактерий по удерживанию кристаллов, CaSR и экспрессии клаудина-14 в клетках HK-2

Для оценки морфологии клеток, адгезии кристаллов, повреждения клеток, кальциевого рецептора (CaSR) и белка Клаудина-14 (Claudin- 14) экспрессия в разные промежутки времени и изучить роль нанобактерий в образовании мочевых камней.В этом эксперименте клетки HK-2 совместно культивировали с нанобактериями (NB) в отсутствие или в присутствии тетрациклина (Tet). Клетки, обработанные кристаллами моногидрата оксалата кальция (COM), использовали в качестве положительного контроля повреждения клеток, вызванного мочевыми камнями. После этого морфологию клеток оценивали путем окрашивания гематоксилин-эозином по сравнению с необработанными клетками HK-2 (отрицательный контроль). Используйте разные методы для оценки повреждения клеток, адгезии кристаллов и экспрессии белка. (Степень повреждения клеток, адгезии кристаллов и экспрессии белка оценивали различными методами).Было обнаружено, что степень повреждения клеток, наблюдаемая в клетках, обработанных Tet + NB, была значительно ниже, чем в клетках, обработанных NB. Утечка лактатдегидрогеназы (ЛДГ) была выше в клетках, подвергшихся воздействию COM, чем в контрольных клетках (). Однако высвобождение ЛДГ из клеток, обработанных как NB-, так и Tet + NB, было значительно ниже, чем из клеток, обработанных COM (). Относительная экспрессия белков CaSR и Claudin-14 была выше в клетках NB, COM и TET + NB, чем в контрольных клетках (), и была ниже в клетках Tet + NB, чем в клетках NB ().И означает, что разница была статистически значимой, и означает, что между обоими значениями была значительная разница. Судя по морфологии клеток, повреждение клеток в группе COM было больше, чем в группе NB, а маркеры повреждения клеток в группе COM и группе NB были повышены. NB вызывал повреждение клеток HK-2, индуцируя перекисное окисление липидов, и степень повреждения увеличивалась во время обработки. Адгезия клеток HK-2 к кристаллам COM увеличивалась после повреждения и была пропорциональна продолжительности сокультивирования NB.NB усиливал экспрессию CaSR и Claudin-14 в клетках HK-2.

1. Введение

Образование мочевых камней — обычное явление во всем мире. Средняя распространенность в Китае составляет 6,5%, а в некоторых регионах — 11,6%. Камни в моче — одно из самых распространенных урологических состояний в Китае [1]. Камни в почках — самый распространенный тип мочевых камней. Мочекаменная болезнь — очень сложный процесс. В последние годы появилась важная роль нанобактерий (НБ) в патогенезе мочевых камней [2–4].NB имеют диаметр около 80–500 нм и являются грамотрицательными бактериями. Форма их в основном сферическая или палочковидная, с более толстой клеточной стенкой. Частота обнаружения NB в крови, моче и камнях у пациентов с камнями в почках превышает 90% [5–7]. NB обладают уникальной способностью производить минералы гидроксиапатита в организме человека и откладывать их в тканях и органах. Следовательно, они могут прилипать к эпителиальным клеткам собирательных протоков и сосочковых клеток, разрушать мембранную структуру клеток и образовывать кристаллы апатита в качестве реакционных центров, дополнительно вызывая образование камней [8].

Сообщалось, что после лечения традиционной экстракорпоральной литотрипсией частота рецидивов в течение 5 лет у пациентов с мочевыми камнями по-прежнему составляет 41,8% [9], что вызывает страдания пациентов и увеличивает социально-экономические издержки [10]. Поэтому выяснение механизмов, ответственных за образование мочевых камней, и разработка новых методов лечения являются насущной необходимостью. Тетрациклин — один из немногих антибиотиков, которые могут убивать NB в физиологических концентрациях. Shoskes et al.показали, что 3-месячное лечение Tet значительно облегчило симптомы у 80% пациентов [11]. Однако в настоящее время мы не знаем точно, как NB играют свою уникальную роль в образовании камней в почках, не говоря уже о лечении NB.

Гиперкальциурия — еще один фактор риска образования кальциевых камней. Сообщается, что примерно у 33% пациентов с камнями в почках развиваются нарушения реабсорбции кальция в моче. Активация рецептора, воспринимающего кальций, играет важную роль в этом процессе, регулируя в толстой восходящей конечности (TAL) нижележащую молекулу Claudin-14, которая, в свою очередь, ингибирует резорбцию кальция.

Целью данного исследования было изучить механизм удержания кристаллов, индуцированного NB, в эпителиальных клетках HK-2 почечных канальцев. Интересный вопрос, который необходимо решить, заключается в том, вносят ли кальциевые сигнальные пути вклад в развитие NB-индуцированных камней в почках. Поэтому было исследовано влияние NB на экспрессию CaSR и Claudin-14.

2. Материалы и методы
2.1. Клинические данные пациентов

пациентов ( n = 10) (средний возраст 49.2-14) с нефролитиазом были зарегистрированы для сбора образцов (моча с большей вероятностью отражает среду, в которой возникают мочевые камни, вызванные NB, и более способствует росту бактерий NB). Они не лечились лекарствами и не подвергались хирургическому вмешательству. Критерии включения: (1) диагноз камней верхних мочевых путей; (2) пациенты мужского пола; (3) перед операцией не применялись антибиотики. Я объединил диагноз отобранных пациентов с критериями включения, и все пациенты были из отделения урологии Первой дочерней больницы медицинского факультета Университета Шихэцзы.От каждого пациента было получено предварительное письменное и информированное согласие, и исследование было одобрено наблюдательным советом по этике Первой аффилированной больницы медицинского факультета Университета Шихэцзы.

2.2. Культивирование и идентификация NB

Образцы мочи (2 мл) были собраны у пациентов с нефролитиазом и разбавлены в пять раз физиологическим раствором в асептических условиях. После центрифугирования при 4 ° C в течение 45 мин (14000 ×) осадок ресуспендировали в 2 мл физиологического раствора и фильтровали с 0.45 мкм м фильтр. Отфильтрованный образец разбавляли 5 раз физиологическим раствором и центрифугировали при 4 ° C в течение 45 минут (14000 × g ). Затем осадок ресуспендировали в 1 мл физиологического раствора и фильтровали через фильтр 0,22 мкм мкм. Затем 1 мл отфильтрованного образца, содержащего NB, собирали и переносили в колбу для культивирования клеток, содержащую среду Игла, модифицированную Дульбекко (DMEM) (GIBCO, США), 10% γ -FBS (Hyclone, США) и 1 мл. % HEPES (Hyclone, США). NB культивировали при 37 ° C и 5% CO 2 в течение 5-7 дней.Для наблюдения за ростом NB использовалась микроскопия с обращенным фазовым контрастом. NB собирали центрифугированием при 14000 × в течение 20 мин при 4 ° C и трижды промывали стерильной водой. Кальций-специфическое окрашивание по фон Коссе и сканирующая просвечивающая электронная микроскопия были использованы для идентификации NB.

2.3. Культура клеток и методы лечения

Клетки HK-2 были получены из Центра сбора Уханьского университета и культивированы в среде 1640 с 10% -ной фетальной бычьей сывороткой при 37 ° C, 5% CO 2 . Клетки были разделены на четыре различные субпопуляции, соответствующие следующим видам обработки: контроль, NB, COM и Tet + NB.Контрольные клетки культивировали только со средой. Для воздействия NB клетки HK-2 культивировали с суспензией NB (OD = 0,7) и питательной средой. Клетки COM (положительный контроль) культивировали с 5 ммоль / л суспензией кристаллов моногидрата оксалата кальция (COM) (Sigma, США) и питательной средой. Клетки Tet (тетрациклин) + NB обрабатывали 5 мг / л Tet и суспензией NB (OD = 0,7). Клетки культивировали 6 ч, 12 ч и 24 ч.

2.4. Окрашивание HE

После обработки предметные стекла в 12-луночных планшетах удаляли, промывали 3 раза PBS и фиксировали 95% спиртом в течение 20 мин.После 3-кратной промывки PBS клетки окрашивали гематоксилином Харриса в течение 1 мин, а затем промывали водопроводной водой в течение 2 мин. Затем его дифференцировали в течение 5 с в 1% -ной соляной кислоте и окрашивали эозином в течение 5 мин. Наконец, после градиентной дегидратации спирта и прозрачности ксилола для герметизации слайдов использовали нейтральную смолу и наблюдали морфологию клеток под оптическим микроскопом.

2,5. Обнаружение H
2 O 2 , MDA, LDH, Na + / K + АТФазы и Ca 2+ / Mg 2+ Активность АТФазы

После обработок собирали супернатанты клеток и содержание H 2 O 2 , малонового диальдегида (MDA) и LDH измеряли согласно инструкциям, приведенным в соответствующих наборах (H 2 O 2 / MDA / LDH наборов для анализа, Nanjing Jiancheng Institute биологической инженерии, Нанкин, Китай).

Активность АТФазы Na + / K + и АТФазы Ca 2+ / Mg 2+ измеряли с помощью набора АТФазы (колориметрический метод; Нанкинский институт биологической инженерии Цзянчэн, Нанкин, Китай).

2.6. Лазерная конфокальная микроскопия для обнаружения удерживания кристаллов.
Клетки

HK-2 высевали в 24-луночный планшет, содержащий чистые покровные стекла. Через 6, 12 и 24 ч сокультивирования добавляли суспензию COM до конечной концентрации 200 мг / л на лунку и осторожно встряхивали в течение 5–10 с, чтобы обеспечить надлежащий контакт между кристаллами COM и дном. клетки.Через 3 мин жидкость над покровным стеклом перемещали и покровные стекла трижды промывали насыщенным раствором оксалата натрия. Покровные стекла удаляли из лунок, фиксировали в 4% параформальдегиде в течение 20 мин, дважды промывали PBS по 5 мин и встряхивали на качалке. Затем добавляли 50 мкл л 5 мг / л фаллоидин-FITC и проводили инкубацию при 20 ° C в темноте в течение 20 минут. После 2 промывок PBS, по 5 мин каждое, предметные стекла наблюдали с помощью микроскопа LSM800 (Carl Zeiss, Германия) с возбуждающим светом 488 нм и 633 нм с последующим получением изображения.

2.7. Наблюдение за удержанием клеточных кристаллов.

Клетки высевали в 24-луночные планшеты, содержащие чистые покровные стекла, в среде RPMI 1640 с добавлением FBS и EGF, а затем обрабатывали NB или COM в среде. После 6, 12 и 24 часов обработки суспензию COM добавляли в каждую лунку (200 мг / л) и инкубации продолжали в течение 3 минут. Затем клетки промывали 3 раза насыщенным раствором оксалата кальция. После фиксации 4% параформальдегидом в течение 20 минут и инкубации с фаллоидином-FITC в течение 20 минут покровные стекла исследовали с помощью лазерного сканирующего конфокального микроскопа с возбуждающим светом 488 нм и 633 нм для оценки удерживания кристаллов клетками.

2,8. Обнаружение экспрессии мРНК CaSR и Claudin-14 в клетках HK-2 с помощью количественной ПЦР в реальном времени

Клетки HK-2 высевали в 6-луночные планшеты, и суммарную РНК экстрагировали методом Trizol после совместного культивирования в течение 6, 12 лет. и 24 часа, и были определены чистота и концентрация. Извлеченную РНК подвергали обратной транскрипции в кДНК, а затем подвергали CaSR и Claudin-14 и ПЦР-детекции гена GAPDH. Условия реакции устанавливали в соответствии с инструкциями к набору. Относительные уровни экспрессии генов CaSR и Claudin-14 были получены с помощью коррекции GAPDH.Последовательности праймеров показаны в таблице 1.

5
GAPDH

Ген п.н. 5’TTCCAGCGGAAATACTCGAT3 ‘ 122

Claudin-14 5’CTACCTGAAAGGGCTCTGGA3′ 132
5’AGGCAGGAGATGACCATGAG3 ‘ 132

5’ACGGCAAGTTCAACGGCACAG3 ‘ 129
5’CGACATACTCAGCACCAGCATCAC3′ 129

9. Вестерн-блоттинг.
Лизаты

получали из обработанных клеток с использованием буфера для лизиса RIPA. Образцы белка разделяли с помощью 10% SDS-PAGE и затем переносили на мембраны из PVDF. Затем использовали 5% обезжиренное сухое молоко для блокирования участков неспецифического связывания при 20 ° C. Затем мембрану инкубировали с первичным антителом в течение ночи при 4 ° C. После четырех 5-минутных промываний TBST мембрану инкубировали со вторичным антителом, конъюгированным с пероксидазой хрена, в течение 2 часов при 20 ° C.Сигналы регистрировались с помощью усовершенствованной системы ECL. Полосы были количественно определены с помощью программного обеспечения Quantity One и нормализованы по GAPDH.

3. Статистический анализ

Для статистического анализа использовали статистическое программное обеспечение SPSS 24.0 (SPSS Inc., Чикаго, Иллинойс). Измеренные данные были выражены как среднее значение ± стандартное отклонение (SD). Односторонний дисперсионный анализ ANOVA использовался для сравнения эффектов различных методов лечения с последующим тестом LSD-t. Для количественного сравнения между несколькими группами использовался односторонний дисперсионный анализ, а для попарного сравнения — метод S-N-K.Уровень тестирования α = 0,05, а статистический график построен с помощью GraphPad Prism 6.

4. Результаты
4.1. Влияние обработок на морфологию клеток
Окрашивание

HE проводили для оценки морфологии клеток HK-2 после различных обработок. Результаты окрашивания HE показаны на фиг. 1. Контрольные клетки демонстрировали однородную морфологию, чистые ядра, плотную цитоплазму и никаких явных аномалий. Количество обработанных COM клеток было значительно уменьшено, и ядра были рыхлыми.Некоторые из ядерных мембран растворились, и ядрышки не были видны. После 6 часов совместного культивирования с NB некоторые клетки демонстрировали увеличенные тела, рыхлые ядра и размытые ядерные мембраны. Наконец, большинство клеток, подвергшихся действию Tet + NB, были морфологически правильными, плотными и имели прозрачные ядра. Некоторые клетки показали набухание тела и рыхлое ядро.


4.2. Активность АТФазы, LDH, H
2 O 2 и MDA в среде клеток HK-2

Как показано в таблице 2, через 12 и 24 часа инкубации в присутствии NB и COM активности АТФазы Na + / K + и Са 2+ / Mg 2+ АТФазы в клетках HK-2 были значительно ниже, чем в контрольных клетках ().Примечательно, что активность обоих ферментов была значительно выше в клетках, обработанных Tet + NB, по сравнению с клетками, обработанными NB, во все моменты времени ().

6,56 8,22 ± 2,52
#

Группы Na + / K + ATP Ca 2+ / Mg 2+ ATP 24 часа 6 часов 12 часов 24 часа

Контроль 13.74 ± 3,50 12,88 ± 1,80 3,40 ± 1,43 9,91 ± 2,80 11,84 ± 2,38 6,26 ± 1,26
NB 9,73 ± 1,90 3,78 ± 0,78 1,45 ± 1,50
COM 7,16 ± 2,03 2,01 ± 1,07 0,45 ± 0,30 5,25 ± 1,86 2,48 ± 1,61 0,25
TET + NB 11.37 ± 2,08 10,45 ± 2,04 # 2,85 ± 0,60 # 7,81 ± 2,86 7,31 ± 2,70 # 3,85 ± 0,75 # 3,85 ± 0,75 #
Примечание. По сравнению с контрольными ячейками,. # По сравнению с клетками, обработанными NB,.

Как показано в таблице 3, в каждый момент времени высвобождение ЛДГ из клеток, подвергшихся воздействию COM, было значительно выше, чем из контрольных клеток ().Уровень ЛДГ, высвобожденный из клеток, подвергнутых воздействию NB- и Tet + NB, был ниже, чем из клеток, обработанных COM (). Через 12 и 24 часа содержание H 2 O 2 и MDA во внеклеточной среде клеток, обработанных NB и COM, было значительно выше, чем в контрольных клетках в соответствующие моменты времени (). С другой стороны, высвобождение H 2 O 2 и MDA из клеток, обработанных Tet + NB, было значительно ниже, чем из клеток, обработанных NB ().


Группы H 2 O 2 MDA LDH
6 h 12 h 9048 9048 9048 12 h ч 24 ч 6 ч 12 ч 24 ч

Контроль 17.85 ± 6,11 11,67 ± 1,71 8,31 ± 3,33 7,73 ± 0,27 8,21 ± 0,29 7,99 ± 0,31 972 0,01 ± 207,51 597,40 ± 124,4
20,86 ± 3,25 17,30 ± 2,49 22,13 ± 5,70 18,40 ± 0,73 16,47 ± 2,28 25,70 ± 1,47 1363,00 ± 441,30 1124,35 ± 292,89 15.60 ± 2,39 17,88 ± 3,27 20,60 ± 3,40 25,46 ± 4,29 29,50 ± 5,72 61,74 ± 13,50 1581,23 ± 279,00 2392,08 ± 734,78 2009ET + 13,59 ± 3,54 10,72 ± 1,79 # 10,81 ± 1,38 # 8,46 ± 2,09 # 9,27 ± 1,36 # 9,41 9,4136 ± 388,01 # 738,81 ± 410,49 809,98 ± 196,22

Примечание . По сравнению с контрольными ячейками. # По сравнению с клетками, обработанными NB,.
4.3. Оценка адгезии кристаллов с помощью лазерной сканирующей конфокальной микроскопии

Для наблюдения за адгезией кристаллов к клеткам использовали конфокальный микроскоп. Как показано на Фигуре 2, после совместного культивирования в течение 6 часов наблюдалась небольшая адгезия кристаллов в группе NB и группе COM, и не наблюдалась адгезия кристаллов в группе контроля.После 12 часов совместного культивирования адгезия кристаллов группы NB и группы COM значительно увеличилась по сравнению с 6 часами, и в контрольной группе не было значительных изменений. После 24 часов совместного культивирования адгезия кристаллов NB-группы и COM-группы еще больше увеличилась, чем 12-часовая, и не было значительных изменений в контрольной группе. Во все времена адгезия кристаллов, обработанных Tet + NB, была значительно снижена по сравнению с клетками, обработанными NB.


4.4. Экспрессия CaSR и Claudin-14 в клетках HK-2. Для обнаружения CaSR и Claudin-14 в клетках HK-2 использовали

qRT-PCR и вестерн-блоттинг.Относительные уровни мРНК показаны на рисунке 3. Через 6, 12 и 24 часа обработка как NB, так и COM привела к значительному увеличению мРНК CaSR и Claudin-14 по сравнению с контрольными клетками (). Как показано на рисунке 4, вестерн-блоттинг подтвердил значительно более высокий уровень обоих белков при обработке как NB, так и COM (24;). Оба уровня белка были ниже в клетках, обработанных TET + NB, чем в клетках, обработанных NB ().



5. Обсуждение

Этиология мочевых камней очень сложна и включает, среди прочего, генетические, экологические и диетические факторы.Сообщалось, что кальцийсодержащие камни составляют большинство мочевых камней, и около 33% пациентов имеют аномальный метаболизм кальция в моче [12]. В последние годы сообщалось о повреждающем действии моногидрата оксалата кальция (COM) на эпителиальные клетки почечных канальцев животных [13, 14]. Например, Ли и др. [15] обнаружили, что после добавления кристаллов моногидрата оксалата кальция (COM) с концентрацией 5 ммоль / л к культивированным эпителиальным клеткам почечных канальцев крыс Wistar можно было наблюдать большое количество прикрепленных к клеткам кристаллов.Поэтому в этом исследовании в качестве положительного контроля использовалась обработка моногидратом оксалата кальция (COM) (5 ммоль / л). Нанобактерии (NB) обычно встречаются в крови, моче, тканях и органах человека и образуют оболочку из фосфата кальция.

Результаты этого исследования согласуются с предыдущими отчетами [16], демонстрируя, что кристаллы моногидрата оксалата кальция (COM) вызывают больше повреждений клеточных мембран, чем другие группы. Окрашивание НЕ показало, что степень повреждения клеток, вызванная нанобактериями (NB), была выше, чем степень повреждения клеток TET + NB.Хотя, в клетках HK-2, по оценке с помощью просвечивающей электронной микроскопии и обнаружения маркеров повреждения клеток. После повреждения клетки степень адгезии кристаллов была намного выше в клетках HK-2, совместно культивируемых с NB, чем в клетках, обработанных Tet + NB. Tet предотвращает влияние нанобактерий (NB) на этот процесс, предполагая, что доминирующую роль в повреждении клеток и последующей адгезии кристаллов может играть само бактериальное тело, а не оболочка из фосфата кальция.

Повреждение клеток является ключевым фактором образования камней, а обнажение базальных мембран может привлечь адгезию кристаллов.Остатки некротических клеток могут еще больше усугубить образование камней, что приведет к развитию камней в почках [17, 18]. Сообщалось, что кристаллы моногидрата оксалата кальция (COM) вызывают повреждение эпителиальных клеток почечных канальцев, вызывая реакции перекисного окисления липидов, которые генерируют большое количество активных форм кислорода [16, 19]. Тамилсельван и др. [20] наблюдали, что внеклеточная концентрация ЛДГ и МДА значительно увеличивалась после культивирования клеток LLC-PK1 с кристаллами моногидрата оксалата кальция (COM) 500 мг / л в течение 4 часов.Однако антиоксиданты в определенном диапазоне концентраций могут эффективно ингибировать перекисное окисление липидов [20], тем самым уменьшая повреждение клеток, вызванное активными формами кислорода. В этом исследовании высвобождение H 2 O 2 и MDA увеличивалось после воздействия на клетки COM и NB. С другой стороны, высвобождение малонового диальдегида (MDA) и H 2 O 2 существенно не увеличивалось при обработке наноразмерным гидроксиапатитом (nHAP) и было ниже в клетках, обработанных Tet + NB, чем в клетках, обработанных NB.Таким образом, перекисное окисление липидов может быть одним из механизмов, с помощью которого NB повреждает клетки HK-2, а Tet ингибирует этот процесс.

Tet — одно из немногих антибактериальных агентов, которые могут убивать NB в физиологических концентрациях. Он проникает через кальциевую корку NB и тем самым оказывает антибактериальное действие. Сообщалось об эффективности Tet в лечении NB-ассоциированного хронического простатита и интерстициального цистита [20]. Ху Вэйгуо и др. [3] создали модель камней в почках крыс с помощью инъекции NB в хвостовую вену и обнаружили, что через желудочный зонд Tet снижается уровень лактатдегидрогеназы (ЛДГ) в моче и количество кристаллов почечных канальцев, что указывает на ингибирующий эффект на образование камней в почках. .Однако до сих пор нет доказательств такого эффекта из экспериментов in vitro . В этом исследовании in vitro при совместном культивировании клеток NB и HK-2 показало, что Tet ингибирует NB-индуцированное повреждение клеток HK-2 и снижает удерживание кристаллов после повреждения. Эти результаты дополнительно подтвердили эффективность Tet в профилактике и лечении камней в почках и подчеркнули его потенциальную значимость как для диагностики, так и для лечения нефролитиаза в клинической практике.

Кальций-чувствительный рецептор (CaSR), член семейства рецепторов, связанных с G-белком, обычно экспрессирующийся в таких органах, как паращитовидная железа, желудочно-кишечный тракт и почки, играет важную роль в регуляции секреции кальция в почках [21 ].Парацеллюлярная реабсорбция кальция в TAL жестко регулируется рецепторами, чувствительными к кальцию (CaSR) в ответ на уровни циркулирующего кальция [22]. Повышение уровня кальция в моче как следствие гиперкальциурии может активировать рецепторы, чувствительные к кальцию (CaSR), чтобы подавить чувствительные к кальцию калиевые каналы и снизить реабсорбцию кальция [23]. Сверхэкспрессия кальций-чувствительных рецепторов (CaSR) увеличивает чувствительность к внеклеточному кальцию и нарушает метаболизм кальция, что в конечном итоге приводит к образованию камней в почках.Кальций-чувствительный рецептор (CaSR) и белок Клаудин-14 (Клаудин-14).

Недавнее крупное когортное исследование пациентов с камнями в почках выявило белок Claudin-14 (Claudin-14) как ген основного риска для гиперкальциурии с помощью анализа ассоциации по всему геному [24]. Gong et al. [25] продемонстрировали, что кальций-чувствительный рецептор (CaSR) регулирует экспрессию белка Claudin-14 (Claudin-14) в TAL посредством подавления гена, опосредованного микроРНК (miR-9 и miR-374). Белок Клаудин-14 (Клаудин-14) подавляет проницаемость параклеточных катионных каналов, состоящих из Клаудина-16 и Клаудина-19, которые, в свою очередь, регулируют метаболизм кальция в моче.Когда уровень кальция в моче увеличивается, активируется ось рецепторов, чувствительных к кальцию (CaSR) и белка Клаудина-14 (Claudin-14), что препятствует реабсорбции кальция и, в конечном итоге, приводит к гиперкальциурии. Другое исследование той же группы дополнительно описало сигнальный путь CaSR-NFATc1-microRNA-Claudin protein-14 (Claudin-14), который сильно модулирует метаболизм кальция в почках. Примечательно, что нокаут белка Claudin-14 (Claudin-14) отменяет транспорт кальция, индуцированный кальциево-чувствительным рецептором (CaSR), что указывает на то, что белок Claudin-14 (Claudin-14) необходим для регулируемого кальциевого рецептора (CaSR). метаболизм кальция в почках [26].Предыдущее исследование, проведенное в нашей лаборатории, также продемонстрировало, что кальций-чувствительный рецептор (CaSR) индуцирует образование камней путем активации Claudin-14 на модели крыс с оксалатом кальция [27]. Повышенная активность регуляторных каналов кальциевого рецептора (CaSR) и белка Claudin-14 (Claudin-14) может играть важную роль в образовании камней нанобактериями [28].

Однако до настоящего времени связь между NB и осью CaSR-Claudin-14 не исследовалась. В этом исследовании клетки HK-2 были совместно культивированы с NB или подвергнуты воздействию кристаллов моногидрата оксалата кальция (COM), что показало, что и мРНК, и экспрессия белка CaSR и Claudin-14 были значительно повышены в обоих условиях по сравнению с контрольными клетками, что указывает на то, что что ось CaSR-Claudin-14 может участвовать в процессе индуцированной NB адгезии кристаллов в клетках HK-2.

Таким образом, NB может повреждать клетки HK-2, вызывая окисление липидов. Степень повреждения и удержания кристаллов пропорциональна продолжительности действия NB. NB может привести к образованию камней в почках по следующему механизму: после повреждения эпителиальных клеток канальцев инфекцией NB кристаллы прилипают к обнаженной базальной мембране. Ось CaSR-Claudin-14 может участвовать в процессе адгезии кристаллов, что приводит к образованию камней в сочетании с NB и остатками некротических клеток.В некоторой степени, один эксперимент должен судить о том, оказывает ли тетрациклин определенные положительные и отрицательные эффекты на клетки HK-2 на основе предыдущих исследований, и результаты показывают, что тетрациклин может уменьшить повреждение NB для клеток HK-2 [29].

Список сокращений
8 моногидрат MD
CaSR: Чувствительный к кальцию рецептор
Клаудин-14: Белок клаудин-14
Tet66 оксид кальция
LDH: Лактатдегидрогеназа
TAL: толстая восходящая конечность
DMEM: Среда Игла, модифицированная Дульбекко
Malde48
Доступность данных

Наборы данных, использованные или проанализированные в ходе текущего исследования, доступны у соответствующего автора по разумному запросу.

Этическое одобрение

Это исследование было этически одобрено Комитетом по медицинской этике Первой аффилированной больницы Медицинского колледжа Университета Шихэцзы (A-2019-037-01).

Раскрытие информации

Ган Сюй и Бяо Цянь должны считаться соавторами.

Конфликт интересов

Авторы заявляют об отсутствии конфликта интересов.

Вклад авторов

Два первых автора внесли равный вклад в эту работу.

Благодарности

Авторы выражают признательность всем, кто внес свой вклад в статью, но не соответствует критериям авторства, включая всех, кто предоставил профессиональные письменные услуги или материалы. Эта работа была поддержана исследованием роли и механизма селективной регуляции пути CaSR-Claudin-14 в экспериментальном образовании камней в почках крыс (ZD201909).

(PDF) Что такое нанобактерии?

[27] Ciftcioglu N, McKay DS, Mathew G, et al.Нанобактерии:

факт или вымысел? характеристики, обнаружение и медицина

важность новых самовоспроизводящихся, кальцифицирующих наночастиц —

частиц. J Investig Med. 2006; 54 (7): 385–394.

[28] Дун Ся. Ужас нанобактерий. [Интернет]. [цитировано 14 июня 2013 г.,

]. Доступно по адресу: http://zhan.renren.com/h5/

entry / 3602888498040307841

[29] Каяндер Э. Нанобактерии — распространяющиеся кальцифицирующие наночастицы

. Lett Appl Microbiol.2006; 42 (6): 549–552.

[30] ¸Cift¸cioglu N, Bj €

orklund M, Kuorikoski K, et al. Nanobac-

teria: инфекционная причина образования камней в почках.

Почки, внутр. 1999; 56 (5): 1893–1898.

[31] Cift¸cio

glu N, Vejdani K, Lee O, et al. Связь между

зубного налета Рэндалла и кальцифицирующими наночастицами. Int J

Nanomed. 2008; 3 (1): 105–115.

[32] Chen L, Huang X, Xu Q, et al. Культивирование и морфология

нанобактерий в сыворотках крови больных с камнями в почках.

J Peking Univ Health Sci. 2010; 42 (4): 443–446.

[33] Ху В., Ван Х, Сюй Т. и др. Установление почечнокаменной болезни

на модели крысы, индуцированной нанобактериями, и анализ

камнеобразования. J Peking Univ Health Sci. 2010; 42 (4):

433–435.

[34] Торрес В.Е., Уилсон Д.М., Хэттери Р.Р. и др. Почечно-каменная болезнь

легкость при аутосомно-доминантной поликистозной болезни почек. Am

J почек. 1993; 22 (4): 513–519.

[35] Шоскес Д.А., Томас К.Д., Гомес Э.Анти-нанобактериальная терапия

для мужчин с хроническим простатитом / хроническим тазовым

болевой синдром и камни простаты: предварительный опыт

ence. J Urol. 2005; 173 (2): 474–477.

[36] Zhou Z, Hong L, Shen X и др. Обнаружение инфекции нанобактерий

при простатите III типа. Урология. 2008; 71 (6):

10911095.

[37] Шен X, Мин А., Ли X и др. Нанобактерии: возможный этиол-

йоги простатита III типа. J Urol.2010; 184 (1): 364–369.

[38] Zhang QH, Shen XC, Zhou ZS, et al. Снижение уровней нанобактерий

и симптомы интерстициального цистита / синдрома болезненного мочевого пузыря, ассоциированного с нанобактериями, после лечения тетрациклином

. Int Urogynecol J. 2010; 21 (1): 103–109.

[39] Zhang QH, Lu GS, Shen XC и др. Нанобактерии могут быть связаны с микролитиазом яичек при бесплодии. Дж. Андрол.

2010; 31 (2): 121–125.

[40] Bratos-P

erez MA, S

anchez PL, de Cruz SG, et al.Ассоциация

между самовоспроизводящимися кальцифицирующими наночастицами и

стенозом аорты: возможная связь с кальцификацией клапана. Eur

Heart J. 2008; 29 (3): 371–376.

[41] Кандемир Б., Эртас Ф.С., Кая С.Т. и др. Связь

между антителами против кальцифицирующих наночастиц и кальцификацией митрального кольца

. J Heart Valve Dis. 2010; 19

(6): 745–752.

[42] Пушкаш Л., Тиславич Л., R

azga Z, et al.Обнаружение нано-

бактериоподобных частиц в атеросклеротических бляшках человека.

Acta Biol Hung. 2005; 56 (3): 233–245.

[43] Манискалько Б.С., Тейлор К.А. Кальцификацию при коронарной болезни

можно обратить вспять с помощью длительной химиотерапии с ЭДТА-тетрациклином

. Патофизиология. 2004; 11 (2):

95-101.

[44] Кая CT, Эртас Ф.С., Хасан Т. и др. Титр антикальцинирующих наночастиц

является независимым фактором риска кальцификации нарной артерии.Coron Artery Dis. 2011;

22 (6): 394400.

[45] Седиви Р., Баттистутти ВБ. Нанобактерии способствуют кристаллизации тел псаммомы при раке яичников. APMIS.

2003; 111 (10): 951–954.

[46] Hudelist G, Singer C, Kubista E, et al. Присутствие бактерий нано-

в телах псаммомы рака яичников: свидетельство

патогенетической роли во внутриопухолевой биоминерализации.

Гистопатология. 2004; 45 (6): 633–637.

[47] Ван Л., Шен В., Вен Дж. И др.Животная модель пигментных желчных камней

черного цвета, вызванных нанобактериями. Dig Dis Sci.

2006; 51 (6): 1126–1132.

[48] Шэн-фу Х., Цзин Э., Цифтциогиу Н. Обнаружение нанобактерий

ria в сыворотке, желчи и слизистой оболочке желчного пузыря пациентов с холецистолитиазом

. Чин Мед Дж. 2005; 118 (5): 421–424.

[49] Агабабов Р., Абашина Т., Сузина Н. и др. Связь между

ранним отложением кальция в плаценте и нанобактериальной

-подобной инфекцией.J Biosci. 2007; 32 (2): 1163–1168.

[50] Преториус А.М., Соммер А., Ахо К. и др. ВИЧ и нанобак —

терия. HIV Med. 2004; 5 (6): 391–393.

[51] Болотный ПД. Зубной налет как биопленка и микробное сообщество — последствия для здоровья и болезней. BMC Oral

Здоровье. 2006; 6 (Приложение 1): S14

[52] Socransky SS, Haffajee AD. Стоматологические биопленки: сложные апевтические мишени. Пародонтология. 2002; 28 (1): 12–55.

[53] Марш П.Зубной налет как микробная биопленка. Caries Res.

2004; 38 (3): 204–211.

[54] Мандель И.Д., Гаффар А. Возвращение к исчислению. J Clin Periodon-

тол. 1986; 13 (4): 249–257.

[55] Бейсвангер Б., Сегрето В., Маллатт М. и др. Распространенность

и частота зубного камня у взрослых. J Clin Dent.

1988; 1 (3): 55–58.

[56] Hjelle JT, Miller-Hjelle MA, Poxton IR, et al. Эндотоксин

и нанобактерии при поликистозе почек.Kidney Int.

2000; 57 (6): 2360–2374.

[57] Ших Ф.А., Кхуллар М., Сингх С. Литогенез: индукция

почечных кальцификаций нанобактериями. Urol Res. 2006;

34 (1): 5357.

[58] Kajander EO, ​​Ciftcioglu N, Miller-Hjelle MA, et al. Бактерии Nano-

: спорные возбудители нефролитиаза и

поликистоз почек. Curr Opin Nephrol Hypertens.

2001; 10 (3): 445–452.

[59] Bigelow MW, Wiessner JH, Kleinman JG, et al.Воздействие поверхностного

фосфатидилсерина увеличивает прикрепление кристаллов оксалата кальция

к клеткам IMCD. Am J Physiol Renal

Physiol. 1997; 272 (1): F55F62.

[60] Айхара К., Байер К.Дж., Хан С.Р. Вызванное фосфатом кальция

Повреждение почечного эпителия и камнеобразование: Участие

активных форм кислорода. Kidney Int. 2003;

64 (4): 1283-1291.

[61] Чжан С.М., Тиан Ф., Цзян XQ и др. Доказательства кальцификации

наночастиц в жидкости десневой борозды и зубных расчетов

лус при пародонтите.J Clin Periodontol. 2009; 80

(9): 1462–1470.

[62] Ян Ф., Цзэн Дж., Чжан В. и др. Оценка взаимодействия между кальцифицирующими наночастицами и зубными

клетками пульпы человека: предварительное исследование. Int J Nanomed.

2011; 15 (6): 13–18.

[63] Цзэн Дж., Ян Ф., Чжан В. и др. Связь между ден-

камнями пульпы и кальцифицирующими наночастицами. Int J

Nanomed. 2011; 6: 109–118.

[64] Jing J, Lu J, Hao Y и др.Потенциальное участие нанобактерий —

в восстановлении эмали при кариесе. Мед-гипотезы. 2009; 73

(3): 359–360.

[65] Дакворт Р.М., Хантингтон Э. Доказательства того, что исчисление

: обратная зависимость кариеса работает. Сообщество

Dent Oral Epidemiol. 2005; 33 (5): 349–356.

[66] Колахи Дж., Шахморади М., Садрешкавари М. Нанобактерии

и стоматологическая практика. Роли: Lulu Press, Inc; 2012

[67] Линь И, Чжэн Р., Хе Х и др.Применение биомиметика

минерализация: профилактическое лечение трещин на зубах?

Med Hypotheses. 2009; 73 (4): 493–494.

Биотехнология и биотехнологическое оборудование 7

Загружено пользователем [5.52.23.55] в 11:35 22 июня 2015

Электронные и световые микроскопические изображения частиц, подобных нанобактериям …

Контекст 1

… sub — культуры слюны, осажденные центрифугированием и промытые PBS для удаления остаточных компонентов слюны.Сканирующую электронную микроскопию (SEM) выполняли с использованием сканирующего электронного микроскопа Hitachi S-3500N с переменным давлением, оборудованного системой PGT-IMIX-PC EDS. Просвечивающая электронная микроскопия (ПЭМ) выполнялась с использованием JEOL 100-CXII как для отрицательного окрашивания, так и для наблюдений в тонких срезах. Биопленочный материал был залит смолой Spurr для получения тонких срезов. Связанные с биопленкой макромолекулы получали диализом промытого материала биопленки против изменений 0,5 М EDTA с последующим введением PBS с использованием небольших диализных кассет Slide-A-Lyzer 10K (Pierce).Platinum PCR SuperMIX (GIBCO ͞ BRL), праймеры (Genosys, The Woodlands, TX) и Ultra Pure Water (Advanced Bio-technologies, Columbia, MD) использовали для ПЦР, которую обычно проводили в течение 30 или 35 циклов с отжигом грунтовки на 40 сек при 55 ° C и удлинение в течение 1 мин при 72 ° C. Продукты ПЦР в контрольных реакциях без добавленной матрицы последовательно отмечались после 35 циклов ПЦР с различными парами праймеров, созданными из предполагаемых последовательностей нанобактериальной рДНК 16S (т.е. X98418 или X98419).Такие продукты, являющиеся результатом амплификации контаминирующей матрицы, были обнаружены даже тогда, когда все экспериментальные манипуляции проводились в CleanSpot PCR ͞ UV Workstation (Coy Laboratory Products, Ann Arbor, MI) либо со свежеоткрытыми реагентами от производителей, перечисленных выше, либо сопоставимые реагенты закуплены у разных производителей. Продукты ПЦР выделяли после электрофореза в агарозном геле с использованием набора для экстракции геля (Qiagen, Chatsworth, CA) и секвенировали с помощью автоматического секвенатора ДНК ABI.В контрольных исследованиях DMEM, с 10% (об.) ␥ -FBS или без него, инкубировали с выбранными фосфолипидами или апатитом и периодически исследовали с помощью SEM и энергодисперсионного рентгеновского микроанализа (EDX) для подтверждения минерализации. Фосфатидилинозит (Sigma) добавляли либо в хлороформе (14), либо в виде водной дисперсии (15) до конечных концентраций от 10 до 200 мкг на мл в DMEM. Азид натрия был добавлен к диспергированным фосфолипидам в конечной концентрации 0,1% в DMEM для сохранения стерильности.Процедура Eanes et al. (16) использовали для получения апатита в DMEM. Вкратце, концентрации ионов кальция и фосфата в DMEM были увеличены до 10 мМ добавлением стерильных исходных растворов CaCl 2 и NaHPO 4, доведенных до pH 7,4 с помощью HCl. Эти добавления приводили к быстрому осаждению аморфного фосфата кальция, который инкубировали в течение ночи для последующего превращения в апатит (16). Пять последовательных переносов 1:10 суспензии DMEM апатита в свежую DMEM выполняли в течение приблизительно 1 месяца (т.е.е., что эквивалентно последовательному переносу субкультур), что приводит к продолжающемуся образованию апатита из концентраций растворимых ионов кальция и фосфата, присутствующих в DMEM. Нанобактерии ранее культивировались из более чем 80% исследованных коммерческих партий FBS, но не из FBS после воздействия высокой дозы β-облучения (6, 7). Чтобы проверить эти наблюдения, мы инкубировали образцы FBS и ␥ -FBS в отдельных колбах с DMEM в условиях культивирования клеток и периодически исследовали эти культуры на предмет появления нанобактерий.Наши наблюдения были удивительно похожи на наблюдения Каяндера и Чифта Чиоглу (6). После инкубации в течение примерно 3 недель микроскопические частицы, осевшие на дно культурального сосуда, были отмечены в колбах с DMEM, которые содержали 10% (об.) FBS, но не в тех, которые содержали 10% (об.) ␥ -FBS. Более того, способность образовывать такие частицы передавалась разведением 1:10 FBS-содержащих культур в колбы со свежей DMEM, как описано (6). Аналогичные наблюдения были сделаны с культурами DMEM фильтрованных через мембрану (0.22 или 0,45 мкм) экстракты зубных отложений у 8 из 27 пациентов и образцы слюны у каждого из 11 человек. Фактически, очевидное культивирование нанобактерий происходило с большей готовностью из человеческой слюны, чем из FBS. В соответствии с предыдущими описаниями роста нанобактерий (6), периоды инкубации для инициации биоминерализации обычно варьировались от нескольких дней в бессывороточных культурах (т. Е. Слюна или фильтрат бляшек в одной среде DMEM) до нескольких недель в ␥ -FBS. -содержащие культуры [т.е., слюна или фильтрат зубного налета в DMEM с 10% (об.) ␥ -FBS]. Развитие минерализованных агрегатов или биопленок обычно наблюдалось независимо от условий инкубации (рис. 1). Шесть серийных переносов отобранных культур в свежую среду DMEM в соотношении 1:10 были успешно проведены в течение 6-месячного периода, чтобы продемонстрировать реалистичную переносимость биоминерализации. СЭМ материала биопленки, соскобленного из субкультур слюны, отфильтрованной через мембрану, полученной после трех или четырех последовательных переносов в свежую среду DMEM, выявила кластеры мелких кокковидных частиц, а также более крупные куполообразные структуры (рис.2 а) аналогично тем, которые ранее были идентифицированы как нанобактерии (6). Более того, основные пики кальция и фосфора были обнаружены с помощью EDX отдельных частиц из наших культур, а присутствие микрокристаллического апатита, аналогичного тому, что обнаруживается в кости человека, было установлено с помощью рентгеноструктурного анализа промытого материала биопленки (результаты не показаны. ). ПЭМ тонких срезов (рис. 2b) выявила структуры, похожие на кокковидные клетки, сопоставимые с теми, которые ранее были идентифицированы как нанобактерии (6), внутри более крупных минерализованных частиц и форм, ранее обозначенных как D-формы (7).Небольшие кокковидные частицы (рис. 2c), которые напоминали предполагаемые нанобактерии (6), также наблюдались с помощью ПЭМ отрицательно окрашенного материала биопленки. Однако следует проявлять осторожность при идентификации этих частиц как нанобактерий, поскольку они также напоминают типичные неодушевленные структуры, ранее наблюдавшиеся либо в аморфном фосфате кальция, образованном из стерильных растворов неорганических солей (16), либо в кальците, образованном в присутствии органического материала (17 ). Окрашивание биопленочного материала Hoechst 33258 в концентрации 5 мкг / мл происходило, как описано (6), но флуоресценция была диффузной (рис.2 г) и не был принят как убедительное доказательство присутствия нуклеиновой кислоты. Нуклеиновая кислота также не была обнаружена в образцах промытого материала биопленки (≥0,5 г), которые были экстрагированы либо 0,1% SDS, либо 1 M фосфатом натрия (pH 7,5) или декальцинированы диализом против 0,5 M EDTA. Аналогичным образом, после декальцификации и диализа бактерии не осаждались (14000 мкг в течение 30 мин), а в УФ-спектре того же препарата отсутствовал пик поглощения при 260 нм, типичный для нуклеиновой кислоты (рис. 3а).Попытки сконцентрировать нуклеиновую кислоту осаждением этанолом из этого и других растворимых препаратов биопленочного материала также не увенчались успехом; Материал, окрашенный бромидом этидия, не выпадал в осадок. Растворимый белок присутствовал в этих диализованных препаратах, о чем свидетельствует пик поглощения около 280 нм в УФ-спектре (рис. 3 а), но профиль этого материала, выявленный с помощью SDS ͞ PAGE (рис. 3 b), не показал широкого Диапазон M r полипептидов, ожидаемых от микробной протеосомы.Скорее, электрофоретическая картина предполагала присутствие ограниченного числа компонентов слюны, предположительно тех, которые сильно адсорбируются на апатите. ПЦР, выполненная с праймерами, созданными на основе последовательностей 16S рДНК, описанных для нанобактерий (EMBL X98418 и X98419; ссылка 6), использовалась в дальнейших попытках обнаружения ДНК нанобактерий. Амплификацию фрагмента ДНК ожидаемого размера (0,5 килобактерий) легко обнаружить после 35 циклов ПЦР, независимо от того, декальцинировали ли образцы предполагаемых нанобактерий, культивируемых из слюны, диализом против ЭДТА с последующим применением PBS.Однако продукт ПЦР идентичного размера амплифицировали до эквивалентной степени в контрольных реакциях, проводимых без добавления матрицы, что позволяет предположить обнаружение рДНК 16S из загрязнителя окружающей среды. Эта возможность была подтверждена нуклеотидной последовательностью продукта ПЦР, выделенного из контрольных образцов реакции, которая была идентична соответствующей последовательности 16S рДНК Pseudomonas sp. (Номер доступа в GenBank AF195876), но только на 85,6% идентичен соответствующему участку любой предполагаемой последовательности нанобактерий (таблица 1).Сравнение последовательностей показало, что последовательности 16S рДНК, описанные для нанобактерий, тем не менее, очень гомологичны 16S рДНК Phyllobacterium myrsinacearum, другого микроорганизма, идентифицированного как источник загрязнения 16S рДНК в исследованиях ПЦР (18). Таким образом, как показано в таблице 1, последовательность X98418 Nanobacterium sanguineum и X98419 Nanobacterium sp., Которые идентичны друг другу на 98,6%, также идентичны на 99,0% и 97,8%, соответственно, последовательности D12789 P. myrsinacearum ( штамм ИАМ 13584).В качестве контроля мы обнаружили, что последовательность, амплифицированная из P. myrsinacearum ATCC 43590 с нашими праймерами (то есть N1 и N2, определенные в таблице 1), была почти идентична предполагаемым нанобактериальным последовательностям (то есть X98418 и X98419), а также последовательности P. myrsinacearum (т.е. D12789) депонирован в GenBank в 1992 году. Эти результаты предполагают повышенную значимость, поскольку опубликованные ПЦР-исследования Kajander и C ift ioglu (6) не включают результаты экспериментальных контролей или критерии выбора праймеров.В соответствии с нашей интерпретацией, другие исследователи (19) также недавно предположили, что последовательности 16S рДНК нанобактерий могут быть артефактами ПЦР. Хотя были описаны «культуральные свойства» нанобактерий (6), достоверных бактериологических доказательств культивирования крайне не хватает, поскольку не были продемонстрированы индивидуальный рост клеток и подсчет нанобактерий. Предполагаемые нанобактерии были обнаружены с помощью моноклональных антител, приготовленных против минерализованных препаратов (8), но иммунохимическая специфичность этих реагентов не установлена ​​(8, 10).Появление минерализованных колоний нанобактерий на …

Контекст 2

… и наблюдения шлифов. Биопленочный материал был залит смолой Spurr для получения тонких срезов. Связанные с биопленкой макромолекулы получали диализом промытого материала биопленки против изменений 0,5 М EDTA с последующим введением PBS с использованием небольших диализных кассет Slide-A-Lyzer 10K (Pierce). Platinum PCR SuperMIX (GIBCO ͞ BRL), праймеры (Genosys, The Woodlands, TX) и Ultra Pure Water (Advanced Bio-technologies, Columbia, MD) использовали для ПЦР, которую обычно проводили в течение 30 или 35 циклов с отжигом грунтовки на 40 сек при 55 ° C и удлинение в течение 1 мин при 72 ° C.Продукты ПЦР в контрольных реакциях без добавленной матрицы последовательно отмечались после 35 циклов ПЦР с различными парами праймеров, созданными из предполагаемых последовательностей нанобактериальной рДНК 16S (т.е. X98418 или X98419). Такие продукты, являющиеся результатом амплификации контаминирующей матрицы, были обнаружены даже тогда, когда все экспериментальные манипуляции проводились в CleanSpot PCR ͞ UV Workstation (Coy Laboratory Products, Ann Arbor, MI) либо со свежеоткрытыми реагентами от производителей, перечисленных выше, либо сопоставимые реагенты закуплены у разных производителей.Продукты ПЦР выделяли после электрофореза в агарозном геле с использованием набора для экстракции геля (Qiagen, Chatsworth, CA) и секвенировали с помощью автоматического секвенатора ДНК ABI. В контрольных исследованиях DMEM, с 10% (об.) ␥ -FBS или без него, инкубировали с выбранными фосфолипидами или апатитом и периодически исследовали с помощью SEM и энергодисперсионного рентгеновского микроанализа (EDX) для подтверждения минерализации. Фосфатидилинозит (Sigma) добавляли либо в хлороформе (14), либо в виде водной дисперсии (15) до конечных концентраций от 10 до 200 мкг на мл в DMEM.Азид натрия был добавлен к диспергированным фосфолипидам в конечной концентрации 0,1% в DMEM для сохранения стерильности. Процедура Eanes et al. (16) использовали для получения апатита в DMEM. Вкратце, концентрации ионов кальция и фосфата в DMEM были увеличены до 10 мМ добавлением стерильных исходных растворов CaCl 2 и NaHPO 4, доведенных до pH 7,4 с помощью HCl. Эти добавления приводили к быстрому осаждению аморфного фосфата кальция, который инкубировали в течение ночи для последующего превращения в апатит (16).Пять последовательных переносов суспензии DMEM апатита в соотношении 1:10 в свежую среду DMEM были выполнены в течение примерно 1 месяца (т. Е. Эквивалентно последовательному переносу субкультур), что привело к продолжающемуся образованию апатита из концентраций растворимого кальция и фосфора. — фат-ионы, присутствующие в DMEM. Нанобактерии ранее культивировались из более чем 80% исследованных коммерческих партий FBS, но не из FBS после воздействия высокой дозы β-облучения (6, 7). Чтобы проверить эти наблюдения, мы инкубировали образцы FBS и ␥ -FBS в отдельных колбах с DMEM в условиях культивирования клеток и периодически исследовали эти культуры на предмет появления нанобактерий.Наши наблюдения были удивительно похожи на наблюдения Каяндера и Чифта Чиоглу (6). После инкубации в течение примерно 3 недель микроскопические частицы, осевшие на дно культурального сосуда, были отмечены в колбах с DMEM, которые содержали 10% (об.) FBS, но не в тех, которые содержали 10% (об.) ␥ -FBS. Более того, способность образовывать такие частицы передавалась разведением 1:10 FBS-содержащих культур в колбы со свежей DMEM, как описано (6). Аналогичные наблюдения были сделаны с культурами DMEM фильтрованных через мембрану (0.22 или 0,45 мкм) экстракты зубных отложений у 8 из 27 пациентов и образцы слюны у каждого из 11 человек. Фактически, очевидное культивирование нанобактерий происходило с большей готовностью из человеческой слюны, чем из FBS. В соответствии с предыдущими описаниями роста нанобактерий (6), периоды инкубации для инициации биоминерализации обычно варьировались от нескольких дней в бессывороточных культурах (т. Е. Слюна или фильтрат бляшек в одной среде DMEM) до нескольких недель в ␥ -FBS. -содержащие культуры [т.е., слюна или фильтрат зубного налета в DMEM с 10% (об.) ␥ -FBS]. Развитие минерализованных агрегатов или биопленок обычно наблюдалось независимо от условий инкубации (рис. 1). Шесть серийных переносов отобранных культур в свежую среду DMEM в соотношении 1:10 были успешно проведены в течение 6-месячного периода, чтобы продемонстрировать реалистичную переносимость биоминерализации. СЭМ материала биопленки, соскобленного из субкультур слюны, отфильтрованной через мембрану, полученной после трех или четырех последовательных переносов в свежую среду DMEM, выявила кластеры мелких кокковидных частиц, а также более крупные куполообразные структуры (рис.2 а) аналогично тем, которые ранее были идентифицированы как нанобактерии (6). Более того, основные пики кальция и фосфора были обнаружены с помощью EDX отдельных частиц из наших культур, а присутствие микрокристаллического апатита, аналогичного тому, что обнаруживается в кости человека, было установлено с помощью рентгеноструктурного анализа промытого материала биопленки (результаты не показаны. ). ПЭМ тонких срезов (рис. 2b) выявила структуры, похожие на кокковидные клетки, сопоставимые с теми, которые ранее были идентифицированы как нанобактерии (6), внутри более крупных минерализованных частиц и форм, ранее обозначенных как D-формы (7).Небольшие кокковидные частицы (рис. 2c), которые напоминали предполагаемые нанобактерии (6), также наблюдались с помощью ПЭМ отрицательно окрашенного материала биопленки. Однако следует проявлять осторожность при идентификации этих частиц как нанобактерий, поскольку они также напоминают типичные неодушевленные структуры, ранее наблюдавшиеся либо в аморфном фосфате кальция, образованном из стерильных растворов неорганических солей (16), либо в кальците, образованном в присутствии органического материала (17 ). Окрашивание биопленочного материала Hoechst 33258 в концентрации 5 мкг / мл происходило, как описано (6), но флуоресценция была диффузной (рис.2 г) и не был принят как убедительное доказательство присутствия нуклеиновой кислоты. Нуклеиновая кислота также не была обнаружена в образцах промытого материала биопленки (≥0,5 г), которые были экстрагированы либо 0,1% SDS, либо 1 M фосфатом натрия (pH 7,5) или декальцинированы диализом против 0,5 M EDTA. Аналогичным образом, после декальцификации и диализа бактерии не осаждались (14000 мкг в течение 30 мин), а в УФ-спектре того же препарата отсутствовал пик поглощения при 260 нм, типичный для нуклеиновой кислоты (рис. 3а).Попытки сконцентрировать нуклеиновую кислоту осаждением этанолом из этого и других растворимых препаратов биопленочного материала также не увенчались успехом; Материал, окрашенный бромидом этидия, не выпадал в осадок. Растворимый белок присутствовал в этих диализованных препаратах, о чем свидетельствует пик поглощения около 280 нм в УФ-спектре (рис. 3 а), но профиль этого материала, выявленный с помощью SDS ͞ PAGE (рис. 3 b), не показал широкого Диапазон M r полипептидов, ожидаемых от микробной протеосомы.Скорее, электрофоретическая картина предполагала присутствие ограниченного числа компонентов слюны, предположительно тех, которые сильно адсорбируются на апатите. ПЦР, выполненная с праймерами, созданными на основе последовательностей 16S рДНК, описанных для нанобактерий (EMBL X98418 и X98419; ссылка 6), использовалась в дальнейших попытках обнаружения ДНК нанобактерий. Амплификацию фрагмента ДНК ожидаемого размера (0,5 килобактерий) легко обнаружить после 35 циклов ПЦР, независимо от того, декальцинировали ли образцы предполагаемых нанобактерий, культивируемых из слюны, диализом против ЭДТА с последующим применением PBS.Однако продукт ПЦР идентичного размера амплифицировали до эквивалентной степени в контрольных реакциях, проводимых без добавления матрицы, что позволяет предположить обнаружение рДНК 16S из загрязнителя окружающей среды. Эта возможность была подтверждена нуклеотидной последовательностью продукта ПЦР, выделенного из контрольных образцов реакции, которая была идентична соответствующей последовательности 16S рДНК Pseudomonas sp. (Номер доступа в GenBank AF195876), но только на 85,6% идентичен соответствующему участку любой предполагаемой последовательности нанобактерий (таблица 1).Сравнение последовательностей показало, что последовательности 16S рДНК, описанные для нанобактерий, тем не менее, очень гомологичны 16S рДНК Phyllobacterium myrsinacearum, другого микроорганизма, идентифицированного как источник загрязнения 16S рДНК в исследованиях ПЦР (18). Таким образом, как показано в таблице 1, последовательность X98418 Nanobacterium sanguineum и X98419 Nanobacterium sp., Которые идентичны друг другу на 98,6%, также идентичны на 99,0% и 97,8%, соответственно, последовательности D12789 P. myrsinacearum ( штамм ИАМ 13584).В качестве контроля мы обнаружили, что последовательность, амплифицированная из P. myrsinacearum ATCC 43590 с нашими праймерами (то есть N1 и N2, определенные в таблице 1), была почти идентична предполагаемым нанобактериальным последовательностям (то есть X98418 и X98419), а также последовательности P. myrsinacearum (т.е. D12789) депонирован в GenBank в 1992 году. Эти результаты предполагают повышенную значимость, поскольку опубликованные ПЦР-исследования Kajander и C ift ioglu (6) не включают результаты экспериментальных контролей или критерии выбора праймеров.В соответствии с нашей интерпретацией, другие исследователи (19) также недавно предположили, что последовательности 16S рДНК нанобактерий могут быть артефактами ПЦР. Хотя были описаны «культуральные свойства» нанобактерий (6), достоверных бактериологических доказательств культивирования крайне не хватает, поскольку не были продемонстрированы индивидуальный рост клеток и подсчет нанобактерий. Предполагаемые нанобактерии были обнаружены с помощью моноклональных антител, приготовленных против минерализованных препаратов (8), но иммунохимическая специфичность этих реагентов не установлена ​​(8, 10).Также описано появление минерализованных колоний нанобактерий на модифицированной среде Лёффлера, приготовленной в среде DMEM (6), но наши попытки культивировать или подсчитывать нанобактерии на стандартной среде Леффлера, в среде DMEM, не содержащей Ca 2 ϩ, или в других бактериологических бульонах или агаризованных средах. были неудачными (данные не показаны). Примечательно, что многие сообщили о свойствах нанобактерий, в том числе об их устойчивости к нескольким антибиотикам и к высокому …

Контекст 3

… с помощью PBS с использованием небольших диализных кассет Slide-A-Lyzer 10K (Pierce).Platinum PCR SuperMIX (GIBCO ͞ BRL), праймеры (Genosys, The Woodlands, TX) и Ultra Pure Water (Advanced Bio-technologies, Columbia, MD) использовали для ПЦР, которую обычно проводили в течение 30 или 35 циклов с отжигом грунтовки на 40 сек при 55 ° C и удлинение в течение 1 мин при 72 ° C. Продукты ПЦР в контрольных реакциях без добавленной матрицы последовательно отмечались после 35 циклов ПЦР с различными парами праймеров, созданными из предполагаемых последовательностей нанобактериальной рДНК 16S (т.е. X98418 или X98419).Такие продукты, являющиеся результатом амплификации контаминирующей матрицы, были обнаружены даже тогда, когда все экспериментальные манипуляции проводились в CleanSpot PCR ͞ UV Workstation (Coy Laboratory Products, Ann Arbor, MI) либо со свежеоткрытыми реагентами от производителей, перечисленных выше, либо сопоставимые реагенты закуплены у разных производителей. Продукты ПЦР выделяли после электрофореза в агарозном геле с использованием набора для экстракции геля (Qiagen, Chatsworth, CA) и секвенировали с помощью автоматического секвенатора ДНК ABI.В контрольных исследованиях DMEM, с 10% (об.) ␥ -FBS или без него, инкубировали с выбранными фосфолипидами или апатитом и периодически исследовали с помощью SEM и энергодисперсионного рентгеновского микроанализа (EDX) для подтверждения минерализации. Фосфатидилинозит (Sigma) добавляли либо в хлороформе (14), либо в виде водной дисперсии (15) до конечных концентраций от 10 до 200 мкг на мл в DMEM. Азид натрия был добавлен к диспергированным фосфолипидам в конечной концентрации 0,1% в DMEM для сохранения стерильности.Процедура Eanes et al. (16) использовали для получения апатита в DMEM. Вкратце, концентрации ионов кальция и фосфата в DMEM были увеличены до 10 мМ добавлением стерильных исходных растворов CaCl 2 и NaHPO 4, доведенных до pH 7,4 с помощью HCl. Эти добавления приводили к быстрому осаждению аморфного фосфата кальция, который инкубировали в течение ночи для последующего превращения в апатит (16). Пять последовательных переносов 1:10 суспензии DMEM апатита в свежую DMEM выполняли в течение приблизительно 1 месяца (т.е.е., что эквивалентно последовательному переносу субкультур), что приводит к продолжающемуся образованию апатита из концентраций растворимых ионов кальция и фосфата, присутствующих в DMEM. Нанобактерии ранее культивировались из более чем 80% исследованных коммерческих партий FBS, но не из FBS после воздействия высокой дозы β-облучения (6, 7). Чтобы проверить эти наблюдения, мы инкубировали образцы FBS и ␥ -FBS в отдельных колбах с DMEM в условиях культивирования клеток и периодически исследовали эти культуры на предмет появления нанобактерий.Наши наблюдения были удивительно похожи на наблюдения Каяндера и Чифта Чиоглу (6). После инкубации в течение примерно 3 недель микроскопические частицы, осевшие на дно культурального сосуда, были отмечены в колбах с DMEM, которые содержали 10% (об.) FBS, но не в тех, которые содержали 10% (об.) ␥ -FBS. Более того, способность образовывать такие частицы передавалась разведением 1:10 FBS-содержащих культур в колбы со свежей DMEM, как описано (6). Аналогичные наблюдения были сделаны с культурами DMEM фильтрованных через мембрану (0.22 или 0,45 мкм) экстракты зубных отложений у 8 из 27 пациентов и образцы слюны у каждого из 11 человек. Фактически, очевидное культивирование нанобактерий происходило с большей готовностью из человеческой слюны, чем из FBS. В соответствии с предыдущими описаниями роста нанобактерий (6), периоды инкубации для инициации биоминерализации обычно варьировались от нескольких дней в бессывороточных культурах (т. Е. Слюна или фильтрат бляшек в одной среде DMEM) до нескольких недель в ␥ -FBS. -содержащие культуры [т.е., слюна или фильтрат зубного налета в DMEM с 10% (об.) ␥ -FBS]. Развитие минерализованных агрегатов или биопленок обычно наблюдалось независимо от условий инкубации (рис. 1). Шесть серийных переносов отобранных культур в свежую среду DMEM в соотношении 1:10 были успешно проведены в течение 6-месячного периода, чтобы продемонстрировать реалистичную переносимость биоминерализации. СЭМ материала биопленки, соскобленного из субкультур слюны, отфильтрованной через мембрану, полученной после трех или четырех последовательных переносов в свежую среду DMEM, выявила кластеры мелких кокковидных частиц, а также более крупные куполообразные структуры (рис.2 а) аналогично тем, которые ранее были идентифицированы как нанобактерии (6). Более того, основные пики кальция и фосфора были обнаружены с помощью EDX отдельных частиц из наших культур, а присутствие микрокристаллического апатита, аналогичного тому, что обнаруживается в кости человека, было установлено с помощью рентгеноструктурного анализа промытого материала биопленки (результаты не показаны. ). ПЭМ тонких срезов (рис. 2b) выявила структуры, похожие на кокковидные клетки, сопоставимые с теми, которые ранее были идентифицированы как нанобактерии (6), внутри более крупных минерализованных частиц и форм, ранее обозначенных как D-формы (7).Небольшие кокковидные частицы (рис. 2c), которые напоминали предполагаемые нанобактерии (6), также наблюдались с помощью ПЭМ отрицательно окрашенного материала биопленки. Однако следует проявлять осторожность при идентификации этих частиц как нанобактерий, поскольку они также напоминают типичные неодушевленные структуры, ранее наблюдавшиеся либо в аморфном фосфате кальция, образованном из стерильных растворов неорганических солей (16), либо в кальците, образованном в присутствии органического материала (17 ). Окрашивание биопленочного материала Hoechst 33258 в концентрации 5 мкг / мл происходило, как описано (6), но флуоресценция была диффузной (рис.2 г) и не был принят как убедительное доказательство присутствия нуклеиновой кислоты. Нуклеиновая кислота также не была обнаружена в образцах промытого материала биопленки (≥0,5 г), которые были экстрагированы либо 0,1% SDS, либо 1 M фосфатом натрия (pH 7,5) или декальцинированы диализом против 0,5 M EDTA. Аналогичным образом, после декальцификации и диализа бактерии не осаждались (14000 мкг в течение 30 мин), а в УФ-спектре того же препарата отсутствовал пик поглощения при 260 нм, типичный для нуклеиновой кислоты (рис. 3а).Попытки сконцентрировать нуклеиновую кислоту осаждением этанолом из этого и других растворимых препаратов биопленочного материала также не увенчались успехом; Материал, окрашенный бромидом этидия, не выпадал в осадок. Растворимый белок присутствовал в этих диализованных препаратах, о чем свидетельствует пик поглощения около 280 нм в УФ-спектре (рис. 3 а), но профиль этого материала, выявленный с помощью SDS ͞ PAGE (рис. 3 b), не показал широкого Диапазон M r полипептидов, ожидаемых от микробной протеосомы.Скорее, электрофоретическая картина предполагала присутствие ограниченного числа компонентов слюны, предположительно тех, которые сильно адсорбируются на апатите. ПЦР, выполненная с праймерами, созданными на основе последовательностей 16S рДНК, описанных для нанобактерий (EMBL X98418 и X98419; ссылка 6), использовалась в дальнейших попытках обнаружения ДНК нанобактерий. Амплификацию фрагмента ДНК ожидаемого размера (0,5 килобактерий) легко обнаружить после 35 циклов ПЦР, независимо от того, декальцинировали ли образцы предполагаемых нанобактерий, культивируемых из слюны, диализом против ЭДТА с последующим применением PBS.Однако продукт ПЦР идентичного размера амплифицировали до эквивалентной степени в контрольных реакциях, проводимых без добавления матрицы, что позволяет предположить обнаружение рДНК 16S из загрязнителя окружающей среды. Эта возможность была подтверждена нуклеотидной последовательностью продукта ПЦР, выделенного из контрольных образцов реакции, которая была идентична соответствующей последовательности 16S рДНК Pseudomonas sp. (Номер доступа в GenBank AF195876), но только на 85,6% идентичен соответствующему участку любой предполагаемой последовательности нанобактерий (таблица 1).Сравнение последовательностей показало, что последовательности 16S рДНК, описанные для нанобактерий, тем не менее, очень гомологичны 16S рДНК Phyllobacterium myrsinacearum, другого микроорганизма, идентифицированного как источник загрязнения 16S рДНК в исследованиях ПЦР (18). Таким образом, как показано в таблице 1, последовательность X98418 Nanobacterium sanguineum и X98419 Nanobacterium sp., Которые идентичны друг другу на 98,6%, также идентичны на 99,0% и 97,8%, соответственно, последовательности D12789 P. myrsinacearum ( штамм ИАМ 13584).В качестве контроля мы обнаружили, что последовательность, амплифицированная из P. myrsinacearum ATCC 43590 с нашими праймерами (то есть N1 и N2, определенные в таблице 1), была почти идентична предполагаемым нанобактериальным последовательностям (то есть X98418 и X98419), а также последовательности P. myrsinacearum (т.е. D12789) депонирован в GenBank в 1992 году. Эти результаты предполагают повышенную значимость, поскольку опубликованные ПЦР-исследования Kajander и C ift ioglu (6) не включают результаты экспериментальных контролей или критерии выбора праймеров.В соответствии с нашей интерпретацией, другие исследователи (19) также недавно предположили, что последовательности 16S рДНК нанобактерий могут быть артефактами ПЦР. Хотя были описаны «культуральные свойства» нанобактерий (6), достоверных бактериологических доказательств культивирования крайне не хватает, поскольку не были продемонстрированы индивидуальный рост клеток и подсчет нанобактерий. Предполагаемые нанобактерии были обнаружены с помощью моноклональных антител, приготовленных против минерализованных препаратов (8), но иммунохимическая специфичность этих реагентов не установлена ​​(8, 10).Также описано появление минерализованных колоний нанобактерий на модифицированной среде Лёффлера, приготовленной в среде DMEM (6), но наши попытки культивировать или подсчитывать нанобактерии на стандартной среде Леффлера, в среде DMEM, не содержащей Ca 2 ϩ, или в других бактериологических бульонах или агаризованных средах. были неудачными (данные не показаны). Примечательно, что многие сообщаемые свойства нанобактерий, включая их устойчивость к нескольким антибиотикам и к высокой температуре (6), основаны на предположении, что инициирование или перенос биоминерализации является индикатором роста микробов.Точно так же очевидная чувствительность нанобактерий к тетрациклину и особенно к цитрату …

Контекст 4

… (т.е. X98418 или X98419). Такие продукты, являющиеся результатом амплификации контаминирующей матрицы, были обнаружены даже тогда, когда все экспериментальные манипуляции проводились в CleanSpot PCR ͞ UV Workstation (Coy Laboratory Products, Ann Arbor, MI) либо со свежеоткрытыми реагентами от производителей, перечисленных выше, либо сопоставимые реагенты закуплены у разных производителей.Продукты ПЦР выделяли после электрофореза в агарозном геле с использованием набора для экстракции геля (Qiagen, Chatsworth, CA) и секвенировали с помощью автоматического секвенатора ДНК ABI. В контрольных исследованиях DMEM, с 10% (об.) ␥ -FBS или без него, инкубировали с выбранными фосфолипидами или апатитом и периодически исследовали с помощью SEM и энергодисперсионного рентгеновского микроанализа (EDX) для подтверждения минерализации. Фосфатидилинозит (Sigma) добавляли либо в хлороформе (14), либо в виде водной дисперсии (15) до конечных концентраций от 10 до 200 мкг на мл в DMEM.Азид натрия был добавлен к диспергированным фосфолипидам в конечной концентрации 0,1% в DMEM для сохранения стерильности. Процедура Eanes et al. (16) использовали для получения апатита в DMEM. Вкратце, концентрации ионов кальция и фосфата в DMEM были увеличены до 10 мМ добавлением стерильных исходных растворов CaCl 2 и NaHPO 4, доведенных до pH 7,4 с помощью HCl. Эти добавления приводили к быстрому осаждению аморфного фосфата кальция, который инкубировали в течение ночи для последующего превращения в апатит (16).Пять последовательных переносов суспензии DMEM апатита в соотношении 1:10 в свежую среду DMEM были выполнены в течение примерно 1 месяца (т. Е. Эквивалентно последовательному переносу субкультур), что привело к продолжающемуся образованию апатита из концентраций растворимого кальция и фосфора. — фат-ионы, присутствующие в DMEM. Нанобактерии ранее культивировались из более чем 80% исследованных коммерческих партий FBS, но не из FBS после воздействия высокой дозы β-облучения (6, 7). Чтобы проверить эти наблюдения, мы инкубировали образцы FBS и ␥ -FBS в отдельных колбах с DMEM в условиях культивирования клеток и периодически исследовали эти культуры на предмет появления нанобактерий.Наши наблюдения были удивительно похожи на наблюдения Каяндера и Чифта Чиоглу (6). После инкубации в течение примерно 3 недель микроскопические частицы, осевшие на дно культурального сосуда, были отмечены в колбах с DMEM, которые содержали 10% (об.) FBS, но не в тех, которые содержали 10% (об.) ␥ -FBS. Более того, способность образовывать такие частицы передавалась разведением 1:10 FBS-содержащих культур в колбы со свежей DMEM, как описано (6). Аналогичные наблюдения были сделаны с культурами DMEM фильтрованных через мембрану (0.22 или 0,45 мкм) экстракты зубных отложений у 8 из 27 пациентов и образцы слюны у каждого из 11 человек. Фактически, очевидное культивирование нанобактерий происходило с большей готовностью из человеческой слюны, чем из FBS. В соответствии с предыдущими описаниями роста нанобактерий (6), периоды инкубации для инициации биоминерализации обычно варьировались от нескольких дней в бессывороточных культурах (т. Е. Слюна или фильтрат бляшек в одной среде DMEM) до нескольких недель в ␥ -FBS. -содержащие культуры [т.е., слюна или фильтрат зубного налета в DMEM с 10% (об.) ␥ -FBS]. Развитие минерализованных агрегатов или биопленок обычно наблюдалось независимо от условий инкубации (рис. 1). Шесть серийных переносов отобранных культур в свежую среду DMEM в соотношении 1:10 были успешно проведены в течение 6-месячного периода, чтобы продемонстрировать реалистичную переносимость биоминерализации. СЭМ материала биопленки, соскобленного из субкультур слюны, отфильтрованной через мембрану, полученной после трех или четырех последовательных переносов в свежую среду DMEM, выявила кластеры мелких кокковидных частиц, а также более крупные куполообразные структуры (рис.2 а) аналогично тем, которые ранее были идентифицированы как нанобактерии (6). Более того, основные пики кальция и фосфора были обнаружены с помощью EDX отдельных частиц из наших культур, а присутствие микрокристаллического апатита, аналогичного тому, что обнаруживается в кости человека, было установлено с помощью рентгеноструктурного анализа промытого материала биопленки (результаты не показаны. ). ПЭМ тонких срезов (рис. 2b) выявила структуры, похожие на кокковидные клетки, сопоставимые с теми, которые ранее были идентифицированы как нанобактерии (6), внутри более крупных минерализованных частиц и форм, ранее обозначенных как D-формы (7).Небольшие кокковидные частицы (рис. 2c), которые напоминали предполагаемые нанобактерии (6), также наблюдались с помощью ПЭМ отрицательно окрашенного материала биопленки. Однако следует проявлять осторожность при идентификации этих частиц как нанобактерий, поскольку они также напоминают типичные неодушевленные структуры, ранее наблюдавшиеся либо в аморфном фосфате кальция, образованном из стерильных растворов неорганических солей (16), либо в кальците, образованном в присутствии органического материала (17 ). Окрашивание биопленочного материала Hoechst 33258 в концентрации 5 мкг / мл происходило, как описано (6), но флуоресценция была диффузной (рис.2 г) и не был принят как убедительное доказательство присутствия нуклеиновой кислоты. Нуклеиновая кислота также не была обнаружена в образцах промытого материала биопленки (≥0,5 г), которые были экстрагированы либо 0,1% SDS, либо 1 M фосфатом натрия (pH 7,5) или декальцинированы диализом против 0,5 M EDTA. Аналогичным образом, после декальцификации и диализа бактерии не осаждались (14000 мкг в течение 30 мин), а в УФ-спектре того же препарата отсутствовал пик поглощения при 260 нм, типичный для нуклеиновой кислоты (рис. 3а).Попытки сконцентрировать нуклеиновую кислоту осаждением этанолом из этого и других растворимых препаратов биопленочного материала также не увенчались успехом; Материал, окрашенный бромидом этидия, не выпадал в осадок. Растворимый белок присутствовал в этих диализованных препаратах, о чем свидетельствует пик поглощения около 280 нм в УФ-спектре (рис. 3 а), но профиль этого материала, выявленный с помощью SDS ͞ PAGE (рис. 3 b), не показал широкого Диапазон M r полипептидов, ожидаемых от микробной протеосомы.Скорее, электрофоретическая картина предполагала присутствие ограниченного числа компонентов слюны, предположительно тех, которые сильно адсорбируются на апатите. ПЦР, выполненная с праймерами, созданными на основе последовательностей 16S рДНК, описанных для нанобактерий (EMBL X98418 и X98419; ссылка 6), использовалась в дальнейших попытках обнаружения ДНК нанобактерий. Амплификацию фрагмента ДНК ожидаемого размера (0,5 килобактерий) легко обнаружить после 35 циклов ПЦР, независимо от того, декальцинировали ли образцы предполагаемых нанобактерий, культивируемых из слюны, диализом против ЭДТА с последующим применением PBS.Однако продукт ПЦР идентичного размера амплифицировали до эквивалентной степени в контрольных реакциях, проводимых без добавления матрицы, что позволяет предположить обнаружение рДНК 16S из загрязнителя окружающей среды. Эта возможность была подтверждена нуклеотидной последовательностью продукта ПЦР, выделенного из контрольных образцов реакции, которая была идентична соответствующей последовательности 16S рДНК Pseudomonas sp. (Номер доступа в GenBank AF195876), но только на 85,6% идентичен соответствующему участку любой предполагаемой последовательности нанобактерий (таблица 1).Сравнение последовательностей показало, что последовательности 16S рДНК, описанные для нанобактерий, тем не менее, очень гомологичны 16S рДНК Phyllobacterium myrsinacearum, другого микроорганизма, идентифицированного как источник загрязнения 16S рДНК в исследованиях ПЦР (18). Таким образом, как показано в таблице 1, последовательность X98418 Nanobacterium sanguineum и X98419 Nanobacterium sp., Которые идентичны друг другу на 98,6%, также идентичны на 99,0% и 97,8%, соответственно, последовательности D12789 P. myrsinacearum ( штамм ИАМ 13584).В качестве контроля мы обнаружили, что последовательность, амплифицированная из P. myrsinacearum ATCC 43590 с нашими праймерами (то есть N1 и N2, определенные в таблице 1), была почти идентична предполагаемым нанобактериальным последовательностям (то есть X98418 и X98419), а также последовательности P. myrsinacearum (т.е. D12789) депонирован в GenBank в 1992 году. Эти результаты предполагают повышенную значимость, поскольку опубликованные ПЦР-исследования Kajander и C ift ioglu (6) не включают результаты экспериментальных контролей или критерии выбора праймеров.В соответствии с нашей интерпретацией, другие исследователи (19) также недавно предположили, что последовательности 16S рДНК нанобактерий могут быть артефактами ПЦР. Хотя были описаны «культуральные свойства» нанобактерий (6), достоверных бактериологических доказательств культивирования крайне не хватает, поскольку не были продемонстрированы индивидуальный рост клеток и подсчет нанобактерий. Предполагаемые нанобактерии были обнаружены с помощью моноклональных антител, приготовленных против минерализованных препаратов (8), но иммунохимическая специфичность этих реагентов не установлена ​​(8, 10).Также описано появление минерализованных колоний нанобактерий на модифицированной среде Лёффлера, приготовленной в среде DMEM (6), но наши попытки культивировать или подсчитывать нанобактерии на стандартной среде Леффлера, в среде DMEM, не содержащей Ca 2 ϩ, или в других бактериологических бульонах или агаризованных средах. были неудачными (данные не показаны). Примечательно, что многие сообщаемые свойства нанобактерий, включая их устойчивость к нескольким антибиотикам и к высокой температуре (6), основаны на предположении, что инициирование или перенос биоминерализации является индикатором роста микробов.Точно так же очевидная чувствительность нанобактерий к тетрациклину и особенно к цитрату (10) может отражать ингибирующее действие этих соединений на кальцификацию, а не на рост микробов. Использование биоминерализации в качестве индикатора роста и минерализованного появления предполагаемых нанобактерий (см. Рис. 2) привело к предположению, что нанобактерии обитают в защитных кальцифицированных оболочках или «жилищах» (6). В сопоставлении с этими интерпретациями мы обнаружили, что биоминерализация, хотя обычно инициируется или переносится разведением 1:10 слюны или культивированного материала биопленки в свежую среду DMEM, соответственно, была…

Контекст 5

… также напоминают типичные неодушевленные структуры, ранее наблюдавшиеся либо в аморфном фосфате кальция, образованном из стерильных растворов неорганических солей (16), либо в кальците, образованном в присутствии органического материала (17). Окрашивание материала биопленки Hoechst 33258 при 5 мкг / мл происходило, как сообщалось (6), но флуоресценция была диффузной (рис. 2d) и не была принята как убедительное доказательство присутствия нуклеиновой кислоты. Нуклеиновая кислота также не была обнаружена в образцах промытого материала биопленки (0.5 г), которые экстрагировали либо 0,1% SDS, либо 1 M фосфатом натрия (pH 7,5), или декальцинировали диализом против 0,5 M EDTA. Аналогичным образом, после декальцификации и диализа бактерии не осаждались (14000 мкг в течение 30 мин), а в УФ-спектре того же препарата отсутствовал пик поглощения при 260 нм, типичный для нуклеиновой кислоты (рис. 3а). Попытки сконцентрировать нуклеиновую кислоту осаждением этанолом из этого и других растворимых препаратов биопленочного материала также не увенчались успехом; Материал, окрашенный бромидом этидия, не выпадал в осадок.Растворимый белок присутствовал в этих диализованных препаратах, о чем свидетельствует пик поглощения около 280 нм в УФ-спектре (рис. 3 а), но профиль этого материала, выявленный с помощью SDS ͞ PAGE (рис. 3 b), не показал широкого Диапазон M r полипептидов, ожидаемых от микробной протеосомы. Скорее, электрофоретическая картина предполагала присутствие ограниченного числа компонентов слюны, предположительно тех, которые сильно адсорбируются на апатите. ПЦР, выполняемая с праймерами, созданными на основе последовательностей 16S рДНК, описанных для нанобактерий (EMBL X98418 и X98419; исх.6), был использован в дальнейших попытках обнаружения ДНК нанобактерий. Амплификацию фрагмента ДНК ожидаемого размера (0,5 килобактерий) легко обнаружить после 35 циклов ПЦР, независимо от того, декальцинировали ли образцы предполагаемых нанобактерий, культивируемых из слюны, диализом против ЭДТА с последующим применением PBS. Однако продукт ПЦР идентичного размера амплифицировали до эквивалентной степени в контрольных реакциях, проводимых без добавления матрицы, что позволяет предположить обнаружение рДНК 16S из загрязнителя окружающей среды.Эта возможность была подтверждена нуклеотидной последовательностью продукта ПЦР, выделенного из контрольных образцов реакции, которая была идентична соответствующей последовательности 16S рДНК Pseudomonas sp. (Номер доступа в GenBank AF195876), но только на 85,6% идентичен соответствующему участку любой предполагаемой последовательности нанобактерий (таблица 1). Сравнение последовательностей показало, что последовательности 16S рДНК, описанные для нанобактерий, тем не менее, очень гомологичны 16S рДНК Phyllobacterium myrsinacearum, другого микроорганизма, идентифицированного как источник загрязнения 16S рДНК в исследованиях ПЦР (18).Таким образом, как показано в таблице 1, последовательность X98418 Nanobacterium sanguineum и X98419 Nanobacterium sp., Которые идентичны друг другу на 98,6%, также идентичны на 99,0% и 97,8%, соответственно, последовательности D12789 P. myrsinacearum ( штамм ИАМ 13584). В качестве контроля мы обнаружили, что последовательность, амплифицированная из P. myrsinacearum ATCC 43590 с нашими праймерами (то есть N1 и N2, определенные в таблице 1), была почти идентична предполагаемым нанобактериальным последовательностям (то есть X98418 и X98419), а также последовательности П.myrsinacearum (т.е. D12789), депонированный в GenBank в 1992 году. Эти результаты имеют повышенную значимость, поскольку опубликованные ПЦР исследования Kajander и C ift ioglu (6) не включают результаты экспериментальных контролей или критерии выбора праймеров. В соответствии с нашей интерпретацией, другие исследователи (19) также недавно предположили, что последовательности 16S рДНК нанобактерий могут быть артефактами ПЦР. Хотя были описаны «культуральные свойства» нанобактерий (6), достоверных бактериологических доказательств культивирования крайне не хватает, поскольку не были продемонстрированы индивидуальный рост клеток и подсчет нанобактерий.Предполагаемые нанобактерии были обнаружены с помощью моноклональных антител, приготовленных против минерализованных препаратов (8), но иммунохимическая специфичность этих реагентов не установлена ​​(8, 10). Также описано появление минерализованных колоний нанобактерий на модифицированной среде Лёффлера, приготовленной в среде DMEM (6), но наши попытки культивировать или подсчитывать нанобактерии на стандартной среде Леффлера, в среде DMEM, не содержащей Ca 2 ϩ, или в других бактериологических бульонах или агаризованных средах. были неудачными (данные не показаны).Примечательно, что многие сообщаемые свойства нанобактерий, включая их устойчивость к нескольким антибиотикам и к высокой температуре (6), основаны на предположении, что инициирование или перенос биоминерализации является индикатором роста микробов. Точно так же очевидная чувствительность нанобактерий к тетрациклину и особенно к цитрату (10) может отражать ингибирующее действие этих соединений на кальцификацию, а не на рост микробов. Использование биоминерализации как индикатора роста и минерализации предполагаемых нанобактерий (см.Рис. 2) привели к предположению, что нанобактерии обитают в защитных кальцинированных оболочках или «жилищах» (6). В сочетании с этими интерпретациями мы обнаружили, что биоминерализация, хотя обычно инициируется или переносится разведением 1:10 слюны или культивированного материала биопленки в свежую среду DMEM, соответственно, не была инициирована в течение 8-недельного инкубационного периода после 1: 100 или 1: 1000 разведений этих посевных материалов. Можно было бы разумно ожидать, что повторный рост бактерий после последних разведений вызовет биоминерализацию.Кроме того, мы обнаружили, что биоминерализация не только устойчива к присутствию нескольких антибиотиков (100 мкг / мл хлорамфеникола, рифампицина, канамицина или эритромицина) и тепла (например, смесь слюны и DMEM, нагретой до 90 ° C в течение 1 часа). ч до мембранной фильтрации), как ожидалось (20), но также не зависит от постоянного присутствия легко диффундирующего 0,1% азида натрия, который ингибирует дыхание. Эти наблюдения не только ставят под сомнение связь биоминерализации с ростом бактерий, но также, что более важно, исключают присутствие зависимых от дыхания сущностей в предполагаемых культурах нанобактерий.Активность образования ядер Са 2 ϩ, обнаруженная ранее в FBS, не только была чувствительна к высокой дозе -облучения (30 кГр), но и терялась после 0,05 мкм мембранной фильтрации (6, 7). Точно так же мы наблюдали предполагаемых нанобактерий из FBS, но не из -FBS, и обнаружили, что нуклеирующая активность слюны теряется после 0,1 мкм мембранной фильтрации. Вместо того, чтобы влиять на жизнеспособность или присутствие нанобактерий, ионизирующее излучение (21) и мембранная фильтрация могут вместо этого повредить или удалить неживые макромолекулярные нуклеаторы биоминерализации, например, фосфолипидные комплексы в сыворотке (22) или липид-белковые комплексы. в слюне (23, 24).Зародышеобразующая активность фосфолипидов (25, 26) была ранее продемонстрирована образованием кальцифицированных шариков диаметром примерно 0,2 мкм в результате взаимодействия фосфатидилинозитола или фосфатидилсерина с ионами кальция и фосфата в неполярной среде (14). После инкубации фосфатидилинозитола в DMEM в течение примерно 2 недель мы также наблюдали мелкие минерализованные частицы (рис. 4 а) и продемонстрировали значительное присутствие кальция и фосфата в таких препаратах с помощью EDX (рис.4 б). Эти результаты можно объяснить относительно высокими концентрациями ионов кальция и фосфата в DMEM (т.е. 1,8 мМ и 0,9 мМ соответственно), которые являются метастабильными и сопоставимы с теми, которые используются в исследованиях биоминерализации in vitro (26). Компоненты сыворотки или слюны, которые являются потенциальными нуклеаторами биоминерализации в первичных культурах нанобактерий, в конечном итоге будут разбавлены при субкультивировании, и, таким образом, эти компоненты могут не учитывать возможность долгосрочного переноса биоминерализации в свежую среду.Однако апатит также является зародышеобразователем (27). Фактически, мы обнаружили, что этот минерал, образованный из стерильных растворов CaCl 2 и NaHPO 4 в DMEM, способствовал дальнейшему образованию апатита даже после многократного разбавления (т.е. 1:10) суспензии DMEM апатита до свежего DMEM. Кроме того, сканирующая электронная микроскопия апатита, образовавшегося в таких условиях и соскобленного из культуральной колбы, выявила скопления мелких кокковидных частиц (рис. 4 c — e) и жилые структуры (рис. 4 f), которые очень напоминали предполагаемые нанобактерии. культивировали либо из слюны (рис.2 а), FBS (6) или камни в почках человека (9). Таким образом, влияние апатита на метастабильные концентрации ионов кальция и фосфата в DMEM является достаточным, чтобы объяснить как устойчивую жизнеспособность биоминерализации, так и широкий спектр морфологических форм, ранее приписываемых нанобактериям (6). Наши исследования нанобактерий были начаты с целью подтверждения и расширения молекулярных и бактериологических свойств этих необычных мелких микроорганизмов. Мы рассудили, что если нанобактерии настолько широко распространены, как предполагалось (исх.6–11 и 20; т.е. присутствуют в 80% коммерческих партий FBS, большинстве камней в почках и камнях пульпы зуба), то эти микроорганизмы должны существовать в FBS, доступном в США, и в образцах ротовой полости человека. Действительно, предполагаемые нанобактерии были выращены из таких образцов методами, идентичными методам, описанным Kajander и C ift ioglu (6). Дальнейшее подробное исследование нанобактерий, полученных в основном из образцов слюны человека, выявило все ожидаемые свойства, включая переносимость биоминерализации.Окончательные доказательства в поддержку живого существа как причинного фактора биоминерализации, наблюдаемого в таких культурах, однако, не были получены с помощью молекулярных и бактериологических анализов. Примечательно, что последовательности 16S рДНК, однозначно приписываемые нанобактериям (6, 8), оказались практически идентичными последовательностям, описанным в 1992 г. для P. mysinacearum, тем самым указывая на то, что они были неправильно отнесены к новому роду Kajander и C. Чиоглу (6, 8). Отсутствие других хорошо…

Контекст 6

… ioglu (6) не включают результаты экспериментальных контролей или критерии для выбора праймера. В соответствии с нашей интерпретацией, другие исследователи (19) также недавно предположили, что последовательности 16S рДНК нанобактерий могут быть артефактами ПЦР. Хотя были описаны «культуральные свойства» нанобактерий (6), достоверных бактериологических доказательств культивирования крайне не хватает, поскольку не были продемонстрированы индивидуальный рост клеток и подсчет нанобактерий.Предполагаемые нанобактерии были обнаружены с помощью моноклональных антител, приготовленных против минерализованных препаратов (8), но иммунохимическая специфичность этих реагентов не установлена ​​(8, 10). Также описано появление минерализованных колоний нанобактерий на модифицированной среде Лёффлера, приготовленной в среде DMEM (6), но наши попытки культивировать или подсчитывать нанобактерии на стандартной среде Леффлера, в среде DMEM, не содержащей Ca 2 ϩ, или в других бактериологических бульонах или агаризованных средах. были неудачными (данные не показаны).Примечательно, что многие сообщаемые свойства нанобактерий, включая их устойчивость к нескольким антибиотикам и к высокой температуре (6), основаны на предположении, что инициирование или перенос биоминерализации является индикатором роста микробов. Точно так же очевидная чувствительность нанобактерий к тетрациклину и особенно к цитрату (10) может отражать ингибирующее действие этих соединений на кальцификацию, а не на рост микробов. Использование биоминерализации как индикатора роста и минерализации предполагаемых нанобактерий (см.Рис. 2) привели к предположению, что нанобактерии обитают в защитных кальцинированных оболочках или «жилищах» (6). В сочетании с этими интерпретациями мы обнаружили, что биоминерализация, хотя обычно инициируется или переносится разведением 1:10 слюны или культивированного материала биопленки в свежую среду DMEM, соответственно, не была инициирована в течение 8-недельного инкубационного периода после 1: 100 или 1: 1000 разведений этих посевных материалов. Можно было бы разумно ожидать, что повторный рост бактерий после последних разведений вызовет биоминерализацию.Кроме того, мы обнаружили, что биоминерализация не только устойчива к присутствию нескольких антибиотиков (100 мкг / мл хлорамфеникола, рифампицина, канамицина или эритромицина) и тепла (например, смесь слюны и DMEM, нагретой до 90 ° C в течение 1 часа). ч до мембранной фильтрации), как ожидалось (20), но также не зависит от постоянного присутствия легко диффундирующего 0,1% азида натрия, который ингибирует дыхание. Эти наблюдения не только ставят под сомнение связь биоминерализации с ростом бактерий, но также, что более важно, исключают присутствие зависимых от дыхания сущностей в предполагаемых культурах нанобактерий.Активность образования ядер Са 2 ϩ, обнаруженная ранее в FBS, не только была чувствительна к высокой дозе -облучения (30 кГр), но и терялась после 0,05 мкм мембранной фильтрации (6, 7). Точно так же мы наблюдали предполагаемых нанобактерий из FBS, но не из -FBS, и обнаружили, что нуклеирующая активность слюны теряется после 0,1 мкм мембранной фильтрации. Вместо того, чтобы влиять на жизнеспособность или присутствие нанобактерий, ионизирующее излучение (21) и мембранная фильтрация могут вместо этого повредить или удалить неживые макромолекулярные нуклеаторы биоминерализации, например, фосфолипидные комплексы в сыворотке (22) или липид-белковые комплексы. в слюне (23, 24).Зародышеобразующая активность фосфолипидов (25, 26) была ранее продемонстрирована образованием кальцифицированных шариков диаметром примерно 0,2 мкм в результате взаимодействия фосфатидилинозитола или фосфатидилсерина с ионами кальция и фосфата в неполярной среде (14). После инкубации фосфатидилинозитола в DMEM в течение примерно 2 недель мы также наблюдали мелкие минерализованные частицы (рис. 4 а) и продемонстрировали значительное присутствие кальция и фосфата в таких препаратах с помощью EDX (рис.4 б). Эти результаты можно объяснить относительно высокими концентрациями ионов кальция и фосфата в DMEM (т.е. 1,8 мМ и 0,9 мМ соответственно), которые являются метастабильными и сопоставимы с теми, которые используются в исследованиях биоминерализации in vitro (26). Компоненты сыворотки или слюны, которые являются потенциальными нуклеаторами биоминерализации в первичных культурах нанобактерий, в конечном итоге будут разбавлены при субкультивировании, и, таким образом, эти компоненты могут не учитывать возможность долгосрочного переноса биоминерализации в свежую среду.Однако апатит также является зародышеобразователем (27). Фактически, мы обнаружили, что этот минерал, образованный из стерильных растворов CaCl 2 и NaHPO 4 в DMEM, способствовал дальнейшему образованию апатита даже после многократного разбавления (т.е. 1:10) суспензии DMEM апатита до свежего DMEM. Кроме того, сканирующая электронная микроскопия апатита, образовавшегося в таких условиях и соскобленного из культуральной колбы, выявила скопления мелких кокковидных частиц (рис. 4 c — e) и жилые структуры (рис. 4 f), которые очень напоминали предполагаемые нанобактерии. культивировали либо из слюны (рис.2 а), FBS (6) или камни в почках человека (9). Таким образом, влияние апатита на метастабильные концентрации ионов кальция и фосфата в DMEM является достаточным, чтобы объяснить как устойчивую жизнеспособность биоминерализации, так и широкий спектр морфологических форм, ранее приписываемых нанобактериям (6). Наши исследования нанобактерий были начаты с целью подтверждения и расширения молекулярных и бактериологических свойств этих необычных мелких микроорганизмов. Мы рассудили, что если нанобактерии настолько широко распространены, как предполагалось (исх.6–11 и 20; т.е. присутствуют в 80% коммерческих партий FBS, большинстве камней в почках и камнях пульпы зуба), то эти микроорганизмы должны существовать в FBS, доступном в США, и в образцах ротовой полости человека. Действительно, предполагаемые нанобактерии были выращены из таких образцов методами, идентичными методам, описанным Kajander и C ift ioglu (6). Дальнейшее подробное исследование нанобактерий, полученных в основном из образцов слюны человека, выявило все ожидаемые свойства, включая переносимость биоминерализации.Окончательные доказательства в поддержку живого существа как причинного фактора биоминерализации, наблюдаемого в таких культурах, однако, не были получены с помощью молекулярных и бактериологических анализов. Примечательно, что последовательности 16S рДНК, однозначно приписываемые нанобактериям (6, 8), оказались практически идентичными последовательностям, описанным в 1992 г. для P. mysinacearum, тем самым указывая на то, что они были неправильно отнесены к новому роду Kajander и C. Чиоглу (6, 8). Отсутствие других четко определенных биохимических, иммунохимических или молекулярных критериев для идентификации нанобактерий серьезно ограничивало дальнейшие сравнения наших результатов с данными Kajander et al.(6–11, 20), а также подчеркнули важную проблему. Потенциальное существование необычных микроорганизмов, таких как нанобактерии, не может быть формально исключено на основании отрицательных данных; скорее, их наличие должно быть установлено с помощью определяющего набора однозначных критериев. Накопленные доказательства, в том числе наша интерпретация того, что загрязнение окружающей среды является причиной предполагаемых последовательностей 16S рДНК нанобактерий, о которых сообщалось (6), ограниченное количество и неоднозначный характер определяющих свойств нанобактерий, а также отсутствие бактериологических доказательств культивирования — все это не соответствует действительности. обеспечивают разумное подтверждение существования мелких микроорганизмов, называемых нанобактериями.Более того, наши результаты показывают, что биоминерализация, подобная той, которая приписывается росту нанобактерий в DMEM (6), может запускаться биологическими макромолекулами, включая фосфолипиды, как описано (14, 25, 26), и может продолжаться при разбавлении до свежей среды апатитом. сам. Эти наблюдения свидетельствуют в пользу альтернативной интерпретации биоминерализации, вызванной нанобактериями (6), но не умаляют важности дальнейших усилий по определению основной основы патологической внескелетной кальцификации.Действительно, необходимы дальнейшие исследования для выявления и характеристики первичных нуклеаторов этих важных клинических состояний, независимо от того, являются ли рассматриваемые молекулы хозяином и ͞ или микробами …

A Search for the Small Metabolizing Bacterium

Аннотация

Об очень малых формах бактерий сообщалось в морских и пресноводных системах, а также в почвах, подземных земных средах, а в последнее время — в образцах камней в почках.Кроме того, такие маленькие клетки можно было получить в лаборатории во время экспериментов с голоданием, что указывает на то, что бактерии, которые выживают в периоды нехватки питательных веществ, демонстрируют уменьшение размера клеток. Несмотря на то, что различные отчеты привели к плохо определенным обозначениям для мелких бактерий, они стимулировали дискуссию о том, насколько маленькой может быть живая бактерия. Информация, полученная из литературы о голодных формах, ультрамикробактериях и нанобактериях, анализируется в свете собственных полевых и лабораторных наблюдений.Можно показать, что, несмотря на концептуальные недостатки и проблемы с определениями того, что подразумевается под «малыми», голодные формы и ультрамикробактерии четко различимы по физиологическим характеристикам, чего нельзя было достичь для нанобактерий или нанобактерий. Кроме того, документально подтверждено, что ультрамикробактерии не являются самыми маленькими прокариотами и что размер бактериальных голодных форм намного ближе к расчетным минимальным размерам, необходимым для обеспечения независимой жизнеспособной жизни.Растущая и делящаяся бактериальная клетка должна быть достаточно большой для размещения ДНК и РНК, ферментов для репликации, транскрипции и трансляции, растворителя для состояний, а также минимального набора белков и плазменного пространства для выполнения операций. Многие авторы предполагают, что для этого требуется ячейка диаметром не менее 200 нм и объемом от 0,014 до 0,06 мкм 3 . Большинство клеток с диаметром, равным или меньшим 0,2 мкм, представляют собой палочки, в то время как кокки в численном отношении имеют второстепенное значение в естественных водных системах.Кажется, что морфотип палочки имеет больший потенциал для продуцирования жизнеспособных клеток с минимальными объемами, чем сферические морфотипы. Это подтверждает предположение, что не только размер, но и форма клеток важны для достижения минимальных функциональных объемов клеток. Многие параметры ячейки можно оценить с относительно высокой точностью, но следует помнить, что абсолютная калибровка по-прежнему невозможна. Даже если мы предположим, что в большинстве биометрических измерений присутствуют ошибки, все же существует тенденция, указывающая на то, что клетки в форме палочек могут функционировать с диаметрами ниже 0.2 мкм и объемы клеток значительно меньше 0,02 мкм 3 . Такие размеры могут указывать на то, что нижний предел размера жизнеспособной бактерии может быть близок к размеру наименьшей гипотетической живой клетки, указывая на то, что еще многое предстоит узнать о минимально необходимых клеточных компонентах, позволяющих бактерии оставаться жизнеспособной.

границ | Микробные богатые магнием карбонаты в чрезвычайно щелочном озере (Лас-Эрас, Центральная Испания)

Введение

Сложный комплекс гидратированных метастабильных минеральных фаз Mg-карбоната, преимущественно гидромагнезита [Mg 5 (CO 3 ) 4 (OH) 2 ⋅4H 2 O], распространен в современных прибрежных и континентальных эвапоритовых месторождениях. и / или щелочная среда (Pueyo and Inglés, 1987; Last, 1992; Renaut, 1993; Wright, 1999; Coshell et al., 1998; Перес-Риварес и др., 2002; Desir et al., 2003; Power et al., 2007; Лусон и др., 2009; Last et al., 2010; Couradeau et al., 2013). Хотя древние осадочные толщи состоят из магнезита (MgCO 3 ), который считается стабильным Mg-карбонатным минералом (Zachmann and Johannes, 1989; Ordóñez and García del Cura, 1994; Salvany and Ortí, 1994; Sanz-Montero, 1996; Cañaveras et al., 1998, Melezhik et al., 2001; Sanz-Rubio et al., 2002; Sanz-Montero et al., 2006; Sanz-Montero and Rodríguez-Aranda, 2012).Как и в случае с доломитом [CaMg (CO 3 ) 2 ], абиотическое осаждение магнезита при низких температурах кинетически подавляется (Vasconcelos et al., 1995; Vasconcelos and McKenzie, 1997; Sánchez-Román et al., 2009a, 2011a) как следствие сильной гидратации ионов Mg 2+ (Slaughter, Hill, 1991). Напротив, гидратированные фазы Mg-карбоната часто обнаруживаются связанными с микробными матами в современных солевых системах (Renaut, 1993; Braithwaite and Zedef, 1996; Coshell et al., 1998; Эдвардс и др., 2006; Power et al., 2007, 2009, 2017; Кабестреро и Санс-Монтеро, 2018). В этом направлении экспериментальные исследования осаждения минералов с использованием микроорганизмов, выделенных из природных озер (Thompson, Ferris, 1990; Power et al., 2007; Shirokova et al., 2013), показали важность цианобактерий в стимулировании образования гидратированных Mg-карбонаты. Биологически индуцированное осаждение Mg-карбонатов может происходить при pH выше 8,5 в водной среде с повышенными концентрациями магния (Thompson and Ferris, 1990).Осаждению богатых Mg карбонатов благоприятствует создание микросреды вокруг бактериальных клеток за счет изменения карбонатной щелочности и доступности Mg 2+ , которые действуют как центры зародышеобразования (Thompson and Ferris, 1990; Pontoizeau et al. , 1997; Sánchez-Román et al., 2008, 2009b, 2011b; García Del Cura et al., 2014). Хотя известно, что микробы опосредуют образование гидромагнезита в щелочных условиях, процессы и микроорганизмы, участвующие в его осаждении, все еще плохо ограничены.Еще менее изучено образование минеральной ассоциации, состоящей из обогащенных магнием карбонатов, включая доломит и магнезит. Еще больше усложняет ситуацию то, что физические, химические и биологические условия в эфемерных озерах значительно различаются в разные сезоны.

Озеро Лас-Эрас в Центральной Испании представляет собой эвапоритовое высокощелочное внутреннее озеро, в котором осаждаются гидромагнезиты и доломиты, а также другие карбонаты (Sanz-Montero E. et al., 2013; Cabestrero and Sanz-Montero, 2018; Cabestrero et al. ., 2018). Озеро — одна из немногих современных сред, где гидромагнезит является доминирующим осаждающим минералом на поверхности микробиалита в сочетании с доломитом. Данная работа направлена ​​на изучение механизмов образования гидромагнезита и связанных с ним богатых магнием карбонатов в сложной и динамичной среде, в которой микроорганизмы подвергаются различным стрессовым условиям (высыхание и истощение). Для дальнейшего изучения микроорганизмов, участвующих в осаждении минерального комплекса, встречающегося в микробиалитах Лас-Эрас, из карбонатных слоев внутри микробного мата была выделена карбонатообразующая бактерия и идентифицирована с помощью секвенирования гена 16S рРНК как Desemzia incerta из филума Firmicutes. D. incerta Эксперименты с культивированием были проведены в условиях осадочных отложений на поверхности Земли. Минералогический (XRD) и микроскопический (SEM / EDS) анализы подтвердили, что осадки Mg-карбоната в экспериментах с лабораторными культурами D. incerta аналогичны тем, которые связаны с естественными микробиалитами как из современных, так и из древних сред. В этой работе мы расширили текущие знания о культурном разнообразии карбонатогенных бактерий, таких как Firmicutes, предоставив доказательства осаждения богатых Mg карбонатов в щелочных озерных средах, которые, возможно, существовали со времен архея, а также в геологическом прошлом других планет. например Марс.Более того, осаждение богатых Mg карбонатов бактериями может иметь важное значение для биоремедиации CO 2 и Mg в экстремально засоленных и щелочных средах.

Геологическая обстановка

Лас-Эрас — эфемерное озеро, расположенное в зоне закрытого дренажа в бассейне Дуэро, Центральная Испания (41 ° 12′1,04 ″ с.ш., 4 ° 34′55,73 ″ з.д.). Лас-Эрас с максимальной площадью 0,1 км 2 — это неглубокий бассейн с грунтовыми водами (глубиной менее 0,6 м), подверженный сезонным изменениям температуры и количества осадков.Обычно с июня по октябрь, что соответствует периодам малого количества осадков, дно озера высыхает, и Лас-Эрас превращается в пляж (Sanz-Montero E. et al., 2013; Cabestrero and Sanz-Montero, 2018).

Гидрохимия

Лас-Эрас — щелочное (pH до 11,3), солоноватое или солоноватое (0,4–15,1 г⋅л -1 ) озеро с водами Na + -Cl — (SO 4 2-) — (HCO 3 ) типа (Sanz-Montero E. et al., 2013). Относительное содержание основных катионов в воде следовало тенденции Mg 2+ > Na + > Ca 2+ с соотношением Mg 2+ / Ca 2+ до 93 (Кабестреро и Санс-Монтеро, 2018). Анализ воды, проведенный Cabestrero et al. (2018) показали, что поровая вода растущих микробных матов была обогащена Mg 2+ , Cl и карбонат-ионами. Кроме того, окислительно-восстановительный потенциал (ОВП) в вышележащей воде был отрицательным и составлял от -177 до -61 мВ.

Карбонатные микробиалиты

Появление активно минерализующихся микробных матов на дне озера Лас-Эрас было впервые задокументировано Sanz-Montero E. et al. (2013). Дальнейшие исследования показали, что состав как микробных сообществ, так и аутигенных минералов сезонно меняется в ответ на колебания водной пластинки и геохимии (Cabestrero and Sanz-Montero, 2018; Cabestrero et al., 2018).

Микробные маты служат убежищем для сложного и сезонно меняющегося микробного сообщества (Cabestrero et al., 2018), который состоит в основном из фотосинтетических цианобактерий, преимущественно Oscillatoria-like и Phormidium-like , диатомовых водорослей Aneumastus sp . и Navicula sp ., и харофит Chara canescens вместе с четырьмя основными типами (Firmicutes, Chloroflexi, Planctomycetes и Actinobacteria) и четырьмя основными классами протеобактерий (Alphaproteobacteria, Gammaproteobacteria, Deltaproteobacteria, Deltaproteobacteria, Betaproteobacteria, Betaproteobacteria, Betaproteobacteria, Betaproteobacteria, Betaproteobacteria,

Полученные микробиалиты состоят до 45% по массе из водных карбонатов Mg и 10% из доломита (Sanz-Montero M.E. et al., 2013). Эти аутигенные карбонаты с высоким содержанием магния (гидромагнезит, несквегонит MgCO 3 ⋅3H 2 O и доломит) откладываются в основном в сухой сезон, когда вода испаряется, образуя белую минеральную корку, покрывающую разлагающиеся микробные маты на земле (Sanz -Montero E. et al., 2013; Cabestrero and Sanz-Montero, 2018; Cabestrero et al., 2018; Рисунок 1). Помимо обломочных зерен (глины, полевые шпаты, кварц и карбонаты), которые составляют до 70%, и вышеупомянутых Mg-содержащих карбонатов, микробиалиты состоят из аутигенных минералов, которые состоят из мелкозернистого кальцита (CaCO 3 ), натрон (Na 2 CO 3 ⋅10H 2 O), трона (Na 3 (CO 3 ) (HCO 3 ) 2H 2 O), сульфаты [тенардит Na 2 SO 4 , гексагидрит MgSO 4 ⋅ 6H 2 O, блодит Na 2 Mg (SO 4 ) 2 ⋅4H 2 O, гипс CaSO 4 ⋅2H 2 O, среди прочего], сера и хлориды.

Рис. 1. Общий вид поверхности озера Лас-Эрас, на которой расположены обширные микробные маты. Обратите внимание на минерализованные микробиалиты (черные точки) и зарождающиеся трещины высыхания (черные стрелки) в иссушенной литоральной зоне и матовые холмы (белые стрелки) во влажной зоне. Белая пунктирная линия разделяет водонасыщенные и ненасыщенные маты.

Материалы и методы

Полевые работы в бассейне Лас-Эрас (рис. 1) проводились в течение 17 дней в период 2012–2017 гг. Для проведения седиментологических наблюдений и отбора проб, а также для проведения гидрохимических определений.

Температура воды, проводимость (соленость) и pH были немедленно измерены в полевых условиях с помощью пробоотборника Hanna HI 9828. Пробы воды были собраны в двух экземплярах прямо из озера. Все образцы хранили при 4 ° C. Чтобы изучить химический состав воды, основные ионы были проанализированы в отфильтрованных образцах с помощью ионной хроматографии в CAI of Geological Techniques, Факультет геологических наук, Мадридский университет Комплутенсе, Испания, с использованием хроматографов Dionex DX 500 Ion и METROHM 940 Professional IC Vario.Концентрации карбонатных (CO 3 2-) и бикарбонатных (HCO 3 ) ионов в воде определяли титрованием (Rice et al., 2012).

Анализ минералогии, петрографии и морфологии

Пробы (глубиной 0–10 см), содержащие биомассу и минералы, были собраны после трансекты от края к центру озера, когда оно было сухим и покрыто водной пластиной. Минералогический состав образцов определяли с помощью рентгеноструктурного анализа порошкообразных образцов на рентгеновской дифракционной системе Philips PW-1710, работающей при 40 кВ и 30 мА, при 2 ° мин -1 , с монохроматизированным CuKα радиация.Спектры XRD были получены от 2θ до 66 ° 2q. Рентгеноструктурный анализ выполнен в программе EVA Bruker с автоматическим поиском-сопоставлением кристаллических фаз с использованием базы данных PDF2. Это программное обеспечение также использовалось для полуколичественного определения массовой доли минеральных смесей.

Для изготовления шлифов образцы микробиалита сушили, заливали и пропитывали смолой Epofix. Оптические исследования шлифов проводили с помощью микроскопа Olympus BX51.

Для текстурного анализа с высоким разрешением тонкие срезы и свежие сломанные поверхности образцов без покрытия наблюдались с помощью растрового электронного микроскопа (SEM-ESEM) FEI INSPECT в Службе неразрушающих методов в Музее естественных наук Мадрида (MNCN), работающей в 30 кв на расстоянии 10 мм, работа в режиме высокого вакуума, с использованием детекторов вторичных электронов и обратного рассеяния. Кроме того, образцы с золотым покрытием анализировали с помощью растрового электронного микроскопа с полевой эмиссией (FE-SEM) JSM 7600F в Centro Nacional de Microscopía Electrónica (UCM, Мадрид, Испания), работающего также при 30 кв.Оба микроскопа были снабжены рентгеновской энергодисперсионной системой (EDS) Oxford Analytical-Inca.

Анализ стабильных изотопов (C, O)

Восемь репрезентативных образцов карбонатов были проанализированы на их изотопный состав (δ 13 C и δ 18 O). В пяти из этих образцов также был определен изотопный состав углерода органического вещества, связанного с карбонатными минеральными слоями. Значения δ 18 O и δ 13 C приведены в промилле относительно белемнита Венского Пи Ди (VPDB).Измельченные образцы подвергали выделению при 70 ° C с использованием 100% фосфорной кислоты в течение 40 часов. Все образцы были подготовлены и проанализированы, по крайней мере, в двух экземплярах. Аналитическая точность обычно составляет ± 0,10 ‰ для углерода и ± 0,15 для кислорода. Составы δ 18 O карбонатов магния корректировали с использованием процедуры, описанной Das Sharma et al. (2002).

Анализ популяции бактерий

Доказательства микробного образования гидромагнезита и связанных с ним карбонатов также получены из лабораторных анализов проб, содержащих микробные сообщества.Образцы собирали в пробирки со дна озера, где образовывались тонкие маты.

Питательная среда

Питательная среда (LE-1, модифицированная из Sánchez-Román et al., 2007), используемая в наших лабораторных экспериментах, имеет следующий состав (%, мас. / Об.): 1% дрожжевой экстракт; 0,5% протеозный пептон; 0,1% глюкозы; и 2% NaCl. В эту среду добавляли ацетат кальция и магния для доведения молярного отношения Mg / Ca до 11. Для получения полутвердой среды 1 бакто-агар (Difco) добавляли 20 г · л -1 .После доведения pH до 7,0 0,1 М КОН, среду стерилизовали при 121 ° C в течение 20 мин. Во все эксперименты были включены контроли, состоящие из неинокулированной культуральной среды и среды, инокулированной автоклавированными бактериальными клетками.

Микроорганизмы

Бактериальный штамм LE1, использованный для этого исследования, был выделен из самой верхней части микробного мата в озере Лас-Эрас. Этот штамм является грамположительной алкалифильной ферментативной микроаэрофильной бактерией (Stackebrandt et al., 1999). Чтобы получить чистые культуры отдельных штаммов, серии разведений из изолированных образцов, взятых из микробного мата, инокулировали в чашки Петри, содержащие культуральную среду, описанную выше, и инкубировали в аэробных условиях при 30 ° C. Чашки Петри периодически исследовали, чтобы определить, способны ли колонии вызывать осаждение минералов.

Были выделены колонии, образующие видимую концентрическую корону карбонатных минералов. Эти чистые штаммы были отобраны для филогенетического анализа 16S рибосомальной дезоксирибонуклеиновой кислоты (рДНК) (Centro de Astrobiología, INTA-CSIC, Madrid).Полученные последовательности (от 794 до 802 пар оснований) сравнивали с базой данных Национального центра биотехнологической информации (NCBI). Результаты приблизительной филогенетической принадлежности показали, что ближайшим родственником штамма LE1 является Desemzia incerta (Y17300) с гомологией 99,8%. Эта бактерия принадлежит к отряду Lactobacillales фирмы Firmicutes (Stackebrandt et al., 1999) и была идентифицирована в нескольких образцах окружающей среды, таких как компост (Ntougias et al., 2004), биопленки золотых приисков (Drewniak et al., 2008) и образцы холодных пустынных почв (Ядав и др., 2015).

Геохимическое исследование

Активность растворенных веществ и степень насыщения исследуемых природных и культурных растворов определяли с использованием геохимической компьютерной программы PHREEQC (Parkhurst and Appelo, 1999). Результаты PHREEQC представлены в виде индекса насыщения (SI) для каждого прогнозируемого минерала. SI определяется как SI = log (IAP / Ksp), где IAP — это произведение ионной активности растворенных минеральных компонентов в произведении растворимости (Ksp) для минерала.Таким образом, SI> 0 означает пересыщение по отношению к минералу, тогда как SI <0 означает недостаточное насыщение.

Расчет естественного раствора проводился с учетом физико-химических значений, зарегистрированных в поле, вместе с количеством основных ионов (Mg 2+ , Ca 2+ , Na + , K + , HCO 3 , CO 3 2-, SO 4 2-, Cl ).

Расчет культуральной среды

проводили с использованием значений добавленных ионов в среде, описанной выше (g⋅L -1 ): Mg 2+ = 3; Ca 2+ = 0.45; Na + = 11, Cl = 12, P = 0,15 (PO 4 3- = 0,46) и NH 4 + = 1,73. Общий азот в культуральной среде определяли методом Кьельдаля, тогда как общий фосфор определяли колориметрически в азотных перевариваемых продуктах, образуя фосфомолибденовый комплекс (Page et al., 1982). Ни бикарбонат, ни другие источники неорганического углерода не добавлялись. Следовательно, растворение неорганического углерода (DIC) регулируется обменом воздух-раствор.Количество доступного C регулировали, уравновешивая раствор до атмосферного значения pCO 2 , равного 400 ppm.

Результаты

Характеристика микробиалитов

Осаждение карбонатных минеральных фаз происходит в верхних слоях (толщиной до 2 см) обширных литифицирующих микробных матов ранней весной и в начале лета, когда высыхание озера вызывает сильное увеличение концентрации катионов и анионов и массовое и быстрое разрушение биоты (рис. 1).

Минералогия

Результаты рентгеноструктурного анализа репрезентативных образцов микробиалитов за 5-летний период, 2012–2017 гг., Указывают на присутствие смеси гидромагнезита и дипингита (далее именуемой Hmg) вместе с различными пропорциями несквегонита, доломита, магнезита, эителита [ Na 2 Mg (CO 3 ) 2 ], трона, натрон, кальцит и магнезиальный кальцит (рис. 2). Карбонаты, богатые магнием, составляют до 70% основной минералогии микробиалитов, которые также состоят из набора сульфатов, хлоридов, фосфатов и серы.Гидромагнезит с соотношением H 2 O / Mg 0,8 является наименее гидратированным из гидратированных метастабильных карбонатов Mg и доминирующим минералом. С другой стороны, наиболее гидратированной фазой является минерал несквехонит (отношение H 2 O / Mg, равное 2). Отношение H 2 O / Mg в дипингите составляет 1–1,6.

Рис. 2. XRD, показывающий пики ассоциации гидромагнезит-дипингит (Hmg), доломита (Dol), магнезита (Mgs) и магнезиального кальцита (Mg-Cc) как основных аутигенных Mg-карбонатов микробиалита.Остальные пики соответствуют кварцу (Qz), кальциту (Cc) и глинам. Образцы, использованные из базы данных PDF2: Гидромагнезит = 00-025-0513, Дипингит = 00-023-1218, Слюда (глины) = 01-070-1869, Cc = 01-083-1762, Qz = 01-079-1910 , Dol = 01-074-1687, Mgs = 01-086-2344, Mg-Cc = 01-086-2336, Hl = 01-075-0306.

Гидрогеохимическое моделирование

Результаты геохимического моделирования, выполненного с помощью PHREEQC (таблица 1), показывают, что вода озера с положительными показателями насыщенности всегда была пересыщенной по отношению к безводным карбонатам доломита (SI> 3.48), хунтит (SI> 2,45), магнезит (SI> 1,18), кальцит (SI> 0,41) и арагонит (SI> 0,26). Эти жидкости большую часть времени были пересыщены гидромагнезитом и моногидрокальцитом (среднее насыщение 3,32 и 0,35 соответственно). Напротив, индексы насыщения для несквегонита (SI <-0,5) и связанных с ним эвапоритов (не показаны) всегда были отрицательными.

Таблица 1. Индексы насыщения для выбранных минералов, рассчитанные PHREEQC, для 17 водного столба (W.Col.) и поровой воды (Pore W.), взятых в течение 5-летнего периода (2012–2017 гг.), А также для питательной среды.

Изотопы

Изотопный состав (δ 13 C V PDB и δ 18 O V PDB ) восьми ключевых образцов микробиалитов с пятью различными ассоциациями карбонатов (таблица 2), указывает на то, что карбонаты обеднены δ 13 Значения C варьируются от -3,56 ‰ до -1,22 ‰ (средн. -2,71 ‰) и обогащены 18 O, со значениями δ 18 O, равными 1.От 34 до 6,37 (среднее 4,56). Сопутствующие органические вещества имеют более низкие значения δ 13 C org (от -23,15 ‰ до -21,02 ‰) (Таблица 2). Изотопный состав образцов несущего несквегонита имеет тенденцию быть обогащен 13 C (δ 13 C ср. -2,48 ‰) и 18 O (δ 18 O средн. 5,08 ‰) относительно ассоциации без этого минерала (δ 13 C ср. -3.08 ‰, δ 18 O ср. 3.68 ‰).

Таблица 2. Значения стабильных изотопов (C, O) карбонатов и органического углерода, составляющих микробиалит.

Микробиалитовые микроткани из отложений озера Лас-Эрас

Донные отложения состоят из карбонатных микробиалитов, которые перекрывают погребенные микробные маты с большой фенестральной пористостью (рис. 3). Основная часть производства карбоната связана с тремя самыми верхними слоями микробиалита, которые расположены горизонтально или в многослойных карманах, каждый из которых имеет отличительную внутреннюю ткань (Рисунки 3A, B). С поверхности вниз карбонатов становится все больше.Самый поверхностный слой содержит гидромагнезитовые сферолиты, покрывающие землю, обогащенную пенополистиролом, окрашенную желтыми пигментами (рис. 3D). Внизу зеленый слой с покрытыми карбонатом пучками нитчатых цианобактерий (Рисунки 3B, E) перекрывает пурпурный и массивный слой (Рисунки 3B, F). Этот слой спускается вниз до серого слоя, содержащего остракод, остатки харофитов и фенестральную пористость из-за газов и биотурбации (Рисунки 3A, B). Самый верхний слой состоит из столбиков карбоната с шаровидным верхом, выступающих на 1 мм вверх от поверхности (Рисунки 3B, D), демонстрирующих тромболитическую микроткань со сгустками (Рисунок 3B).Зарождающиеся четко очерченные сгустки карбоната образуются на верхних поверхностях разлагающегося мата, когда агрегаты гидромагнезита осаждаются на обломочных зернах и микроорганизмах, заключенных в их внеклеточный матрикс (EPS), предпочтительно вблизи оконных пор (Рисунок 3G). Местами призматические кристаллы несквегонита растут на поверхности, связанные с агрегатами гидромагнезита (рис. 3B, C). Этот верхний слой состоит из сети бесцветных нитей и зеленых нитчатых цианобактерий, в некоторых местах также многочисленны наземные популяции коккоидов и диатомовых водорослей.Зеленый слой представляет собой ламинированную микроткань (рис. 3B, E), образованную оболочками цианобактерий, покрытыми гидромагнезитом, ориентированными параллельно поверхности. Осаждение карбоната происходит внутри EPS между опорожненными оболочками нитчатых цианобактерий, некоторые из которых имеют видимые признаки разложения (рис. 3H). Ламинированная микроткань постепенно превращается в массивную ткань, в которой тугоплавкие, плохо выраженные ризоиды харофитов и оогонии окружены пурпурными осадками карбоната (Рисунки 3F, I).Отчетливая пурпурная пигментация этого слоя обусловлена ​​обилием пурпурных несерных бактерий на этой стадии (Cabestrero et al., 2018).

Рис. 3. Осадочные и микроскопические особенности карбонатных микробиалитов. (A) Поперечное сечение микробиалита, показывающее карбонатную корку, сформированную на двух зеленых и пурпурных микробных слоях, которые покрывают погребенные микробные маты с большой фенестральной пористостью из-за газов и биотурбации. Наконечник молотка для шкалы 1 см. (B) Микрофотография тонкого сечения, показывающая внутреннюю структуру микробиалита с тремя отдельными микротканями, расположенными горизонтально или в многослойных карманах: (1) тромболитическая (узловая) микроткань; (2) ламинированная микроткань с карбонатными волокнами зеленых цианобактерий; (3) пурпурно-пигментированная массивная ткань, которая постепенно опускается к более старому слою, содержащему остракод (о), остатки харофитов и фенестральную пористость. (C) Призматические кристаллы несквехонита (Nes) на поверхности мата. (D) Вид сверху сферолитовых структур гидромагнезита, сформированных на желтом поверхностном слое мата. (E) Ламинарная микроткань, произведенная из покрытых гидромагнезитом нитей зеленых цианобактерий. (F) Остатки тугоплавкого харофита, заключенные в пурпурные карбонаты. (G) Узелки кристаллов гидромагнезита с альвеолярной текстурой встречаются как на детритовых зернах, так и на кокковидных микробных клетках, заключенных во внеклеточный матрикс (EPS), рядом с фенестральными порами. (H) Агрегаты гидромагнезита осаждаются в деградированных цианобактериальных нитях и EPS. (I) Остатки харофитов (Cha) частично минерализованы гидромагнезитом. Обратите внимание, что (D – F) — микрофотографии, сделанные с помощью бинокулярного микроскопа; и (C, G, H, I), — изображения SEM.

Осаждение карбонатов сопровождается постепенной деградацией биомассы первичных продуцентов гетеротрофами (рис. 4). Первоначальные отложения гидромагнезита-дипингита возникают в виде пластинчатых кристаллов, которые исходят от деградированных диатомовых водорослей, оболочки цианобактерий и бактерий, а также от EPS, вмещающего их всех (рис. 4A).Постепенное отложение кристаллов карбоната на клетках приводит к захоронению бактерий и образованию гантелей и сферолитовых кластеров гидромагнезита (Рисунки 4B, C). Бактерии и EPS содержат большое количество Mg, а также Ca, Si и другие второстепенные элементы (см. Спектры EDS на рисунке 4). Гидромагнезитовые покрытия, за исключением Mg, обеднены всеми этими элементами. Точно так же гидромагнезит, осажденный на поверхности EPS, образует кластеры пластинчатых кристаллов, которые являются немного или очень плотными, что приводит к изменчивой и совпадающей морфологии, такой как розетка, гантель, случайная и веерообразная форма (рис. 4D).Хорошо выраженные агрегаты гидромагнезита диаметром до 30 мкм обычно имеют альвеолярную текстуру (рис. 4). Связанные с водными карбонатами магния разреженные микрокристаллы доломита и магнезита покоятся на EPS, окруженные агрегатами гидромагнезита (Рисунки 4D, E). Доломит и магнезит состоят из сложных кристаллов, образовавшихся в результате агрегации кристаллических наночастиц (рис. 4E).

Рис. 4. Снимки карбонатной минерализации СЭМ. (A) Постепенный переход между минерализованной и неминерализованной частями микробных матов. Ассоциация гидромагнезит-дипингит (Hmg) происходит в виде тромбоцитов, исходящих от EPS, диатомовых водорослей (Dia) и бактерий (красная стрелка). (B) Кристаллы Hmg прикреплены к минерализованным микробным клеткам (спектр 1), внедренным в матрицу EPS. Клетки, полностью минерализованные водными карбонатами магния (Hmg), имеют глобулярные формы, демонстрирующие ботриоидную морфологию (спектр 2). (C) Кластеры тромбоцитов Hmg в форме гантели, карандаша или звезды. (D) Очень плотные пластинки Hmg, осажденные на EPS, демонстрирующие сотовую структуру. Обратите внимание на субидиоморфные кристаллы доломита (Dol, спектр 3), внедренные кластерами Hmg. (E) Кластеры магнезита (спектр 4), покоящиеся на EPS, возникают в результате агрегации наночастиц.

Бактериально опосредованные карбонаты из культуральных экспериментов

Потенциал выделенных бактерий D. incerta вызывать карбонатное осаждение оценивали с использованием жидких и твердых сред.Геохимическое моделирование (таблица 1) показывает, что питательная среда была недосыщена карбонатами, за исключением доломита и магнезита, которые были слегка перенасыщены (1,76 и 0,41, соответственно). Гидромагнезит и несквегонит не должны выпадать в осадок из этого флюида, так как их состояние насыщения было сильно отрицательным (-6,16 и -2,63).

После 15 дней инкубации при 30 ° C в экспериментах с твердой и жидкой культурой наблюдалось осаждение минералов. Извлеченные минеральные осадки были охарактеризованы с помощью XRD (Таблица 3 и Рисунок 5) и FESEM-EDS (Рисунки 6, 7).Минералогический анализ осадков указывает на присутствие множества высокомагнезиальных карбонатов во всех образцах (таблица 3). Моногидратированный карбонат кальция, моногидрокальцит (CaCO 3 H 2 O), также присутствует в экспериментах с использованием жидкой среды (рис. 5A), в то время как незначительные количества Mg-кальцита регистрируются только в твердой культуре, содержащей более широкий набор карбонатов (рис. 5В). Различные количества магнезиальных фосфатов, характеризуемых как брадлеит, также присутствуют как в твердых, так и в жидких средах.Самыми распространенными минералами являются водные Mg-карбонаты, образованные ассоциацией дипингит-гидромагнезит (называемой Hmg), которая всегда связана с доломитом и, реже, с Mg-кальцитом и магнезитом. Нескегонит образуется в твердом эксперименте (Таблица 3 и Рисунок 5B). Напротив, хантит был обнаружен только в жидкой среде (рис. 5А).

Таблица 3. Средний полуколичественный анализ XRD минералов, осажденных в экспериментах с культивированием D. incerta (рентгеновская дифракция — XRD).

Рис. 5. XRD минералов, извлеченных из жидких (A) и твердых (B) образцов культур. Осадки представлены в основном гидромагнезит-дипингитовой ассоциацией (Hmg), моногидрокальцитом (Mhc), доломитом (Dol), кальцитом магния (Mg-Cc), хунтитом (Hun), несквехонитом (Nes), магнезитом (Mgs) и фосфатом магния (Brad). . См. Образцы, используемые для идентификации минералов на Рисунке 2.

Рис. 6. Изображения FE-SEM богатых Mg карбонатов, связанных с бактериальным штаммом, выделенным из Las Eras. (A) Неминерализованные группы бактерий, образующих EPS. Спектр EDS микробов показывает, что они богаты Mg и содержат Ca. (B) Наблюдается плавный переход между минерализованным и неминерализованным EPS и микробными тельцами. Минеральные пластинки состоят из водных карбонатов магния (Hmg, см. Спектр), которые имеют альвеолярное расположение. (C) Общий вид кристаллов Hmg, связанных с микробами и остатками EPS, которые имеют сферолитическую (шаровидную), гантелевую и щеточную морфологию (указано стрелкой). (D) Редкие сфероиды доломита (Dol) лежат на вершине очень плотных водных кристаллов Mg-карбоната.

Рис. 7. Изображения FE-SEM и EDS-спектры доломита (Dol), хунтита (Hun), кристаллов магнезита (Mgs) и магнезиального кальцита (Mg-CC), связанных с дипингитом / гидромагнезитом (Hmg). (A) Доломитовый сфероид, внедренный пластинками Hmg. Обратите внимание, что доломит состоит из скопления нанокристаллов. Неминерализованные микробы на поверхности отмечены стрелками. (B) Сгустки пластинок хантита, лежащие на очень плотных агрегатах Hmg. Кристаллы Hun похожи по форме и размеру, а также по типу кластеризации на группу неминерализованных бактерий в непосредственной близости (двойные черные стрелки). (C) Составной кристалл магнезита, образованный наноглобулами с плохо очерченными кристаллическими краями. (D) Хорошо сформированные идиоморфные кристаллы Mg-кальцита, имеющие форму гантели с редкими наногранулами на поверхности.

FE-SEM-изображения культур (рис. 6, 7) показывают, что доминирующие карбонаты (Hmg) встречаются в основном в виде сферолитовых агрегатов, образованных плотноупакованными кристаллическими пластинками.Агрегаты Hmg встречаются с разной степенью роста и упаковки и обычно имеют альвеолярное расположение. В неминерализованных частях бактерии, образующие EPS, все еще сохраняются и содержат Mg и меньшие количества Ca (Рисунок 6A). Переход между минерализованной и неминерализованной частями постепенный (Рисунки 6B, C). Итак, наблюдается, что тромбоциты зарождаются радиально на бактериях и окружающем EPS (рис. 6B), создавая плохо плотные кристаллические кластеры с различной морфологией, такие как гантели, кисти и шарики (рис. 6C).Прогрессирующая агрегация тромбоцитов в эти начальные группы вызывает рост и слияние сферолитовых сгустков (рис. 6C). Некоторые бактерии и органические частицы сохраняются на внешних поверхностях пластинок Hmg, где они встречаются в связи с доломитом (Рисунки 6D, 7A), хунтитом (Рисунок 7B), магнезитом (Рисунок 7C) и магнезиальным кальцитом (Рисунок 7D). Каждый минерал был идентифицирован по их спектрам EDX и их характерным текстурам (рис. 7). Редкие глобулярные кристаллы доломикрита вкраплены в землю Hmg (рис. 7А).Магнезит представляет собой составные кристаллы с плохо очерченными кристаллическими краями (рис. 7C). Как и кристаллы доломита, магнезит состоит из наноглобул. Кристаллы хантита состоят из округло-чешуйчатых кристаллов, образующих на поверхности неправильные пластинки. Чешуйки хантита похожи по форме и размеру, а также по типу кластеризации на группу неминерализованных бактериоподобных тел, лежащих поблизости (рис. 7В). Напротив, Mg-кальцит в форме гантели характеризуется более крупными и хорошо сформированными кристаллами с редкими наногранулами на поверхности (рис. 7D).

Обсуждение

Сочетание различных минералогических, микроскопических и геохимических методов с независимыми от культивирования молекулярными методами показывает, что разложение микробных матов алкалифильной гетеротрофной бактерией D. incerta (phyllum Firmicutes) активно участвует в образовании карбонатов с высоким содержанием Mg. включая гидромагнезит, дипингит, доломит, магнезит и несквегонит в эфемерных щелочных озерах. Гидромагнезит, как наиболее стабильная фаза гидратированных карбонатов магния, является преобладающим аутигенным минералом.Осаждение происходит последовательно по мере испарения воды и разложения микробных матов, причем гидратированные минералы Mg осаждаются первыми, а безводные фазы (доломит и магнезит) — последними. Последовательность выпадения в осадок карбонатов с высоким содержанием магния представляет собой прогрессирующее сокращение органического вещества до его истощения.

Внутренняя структура образующихся гидромагнезитовых микробиалитов контролируется слоистой структурой микробного мата на стадии разложения, когда карбонатные минералы осаждаются.По глубине микроткани варьируются от сгустков (верхний слой, состоящий из диатомовых водорослей, кокков и т. Д.) До слоистых (зеленый слой с некоторыми пустыми оболочками цианобактерий), а затем и до массивных (слой с пигментами пурпурных несернистых бактерий).

Образование богатых магнием карбонатов в разлагающихся микробных матах

Лас-Эрас — одна из немногих современных сред, где гидромагнезит является доминирующим осаждающим минералом в микробиалитах (например, Renaut, 1993; Braithwaite and Zedef, 1996; Russell et al., 1999; Power et al., 2009; Kazmierczak et al., 2011; Sanz-Montero M. E. et al., 2013). Более того, микробиалиты Лас-Эрас представляют собой исключительную площадку для исследований, в которой неизменно встречается гидромагнезит, связанный с доломитом, наряду с переменным дипингитом, несквехонитом и небольшими количествами магнезита. Гидрохимия Лас-Эрас характеризуется чрезвычайно высокими отношениями pH и Mg / Ca (Cabestrero and Sanz-Montero, 2018). Такой химический состав воды создает условия высокой насыщенности природных растворов для тех карбонатов, богатых магнием, за исключением несквегонита (таблица 1).Несмотря на то, что воды перенасыщены карбонатными минеральными фазами, самопроизвольного выпадения осадков не происходит. Вместо этого образование карбоната магния, включая несквехонит, происходит только внутри микробных матов, в основном по мере высыхания озера и разложения первичных продуцентов в матах. Затем процессы выпадения осадков происходят быстро.

Петрографические наблюдения свидетельствуют о том, что карбонатная минерализация с преобладанием гидромагнезита и доломита происходит на разлагающемся органическом матриксе и на сообществах микроорганизмов, распределенных в этом матриксе, включая водоросли, оболочки цианобактерий и микробные клетки (рис. 3, 4).Четкое пространственное соотношение минералов в мате объясняет различия в минералогии и текстуре. Водный карбонат магния выпадает в осадок в виде излучающих пластинчатых кристаллов, демонстрирующих альвеолярную микроткань, вероятно, имитирующую сотово-альвеолярную структуру EPS (рис. 4). Это согласуется с предыдущими работами, показывающими, что распадающийся EPS реорганизуется в альвеолы, которые могут действовать как места зарождения минералов (DeFarge et al., 1996; Trichet et al., 2001). Наши наблюдения подтверждают, что поверхность EPS на гидратированной стадии имеет тенденцию быть гладкой, но приобретает альвеолярную структуру, поскольку она постепенно превращается в карбонат из деградированных зон (рис. 6B).Показано, что образование излучающих агрегатов кристаллов гидромагнезита является результатом постепенного осаждения пластинчатых кристаллов гидромагнезита на бактериальные клетки, которые вызывают погребение бактерий (рис. 4В). Осаждение доломита происходит в виде наноглобул в микродоменах кристаллов гидромагнезита, где также присутствуют бактериальные клетки. Кристаллы доломита являются результатом прогрессивной перегруппировки этих корпускул в более крупные субидиоморфные кристаллы.Неоднократно видно, что эти наноглобулы, называемые частицами, подобными нанобактериям, имеют большое значение в образовании карбонатов (Folk, 1993), поскольку их интерпретируют как частицы, продуцируемые бактериями, чтобы избежать захоронения клеток (Bontognali et al., 2008; Sánchez- Роман и др., 2008).

Последовательные отрицательные значения δ 13 C carb (от -1,33 до -3,56 ‰) и высокие значения δ 18 O carb (от 1,33 до 6,37 ‰) подтверждают, что осаждение богатого гидромагнезитом скопление связано с деградацией органического материала, поскольку вода в озере подвергается испарению при температуре окружающей среды.Одновременно значения δ 13 C org (среднее -21,90 ‰) подтверждают вклад водорослей и микробов в качестве источников углерода (Meyers, 1994). Высокие значения δ 18 O микробиалитов Eras аналогичны диапазону δ 18 O, описанному для богатых гидромагнезитом месторождений, связанных с бентосными микробными матами в современных щелочных озерах (Braithwaite and Zedef, 1996; Power et al., 2007). ), где также не наблюдалось прямого выпадения гидромагнезита из поверхностных вод.Поскольку одного испарения недостаточно, зародышеобразование гидромагнезита было интерпретировано как помощь микробов (Braithwaite, Zedef, 1996; Power et al., 2007; Cabestrero and Sanz-Montero, 2018). Напротив, биологическое образование несквегонита является более спорным. Его осадки объясняются процессами испарения на поверхности озерных отложений, где биопленки отсутствуют (Power et al., 2007) или обязательно присутствуют (McLean et al., 1997; Sanz-Montero E. et al., 2013; Cabestrero and Sanz-Montero). , 2018).В Лас-Эрас изотопно-изотопные ассоциации карбонатных комплексов, содержащих несквехонит, немного выше по 13 C и 18 O (среднее -2,48 и 5,08) по сравнению с другим карбонатным парагенезисом (среднее -3,08 и 3,68, соответственно. ), что подтверждает, что осаждение несквехонита совпадает с испарением воды, высокообогащенной 18 O, на последних стадиях процессов испарения. Это согласуется с недавним гидрохимическим моделированием озера Лас-Эрас (Cabestrero and Sanz-Montero, 2018), показывающим, что индекс насыщения несквехонита изменяется до положительных значений, когда растворы достигают очень высокой степени испарения.Различный сигнал 18 O между смесями несквехонита и hmg можно объяснить их различной структурой, гидромагнезитом, содержащим молекулярную воду и гидроксильные (ОН) группы, и молекулярной водой, состоящей только из несквегонита (Glasser et al., 2016). Несмотря на это, отрицательные значения δ 13 C carb и δ 13 C org парагенезиса, содержащего несквехонит, свидетельствуют об органическом источнике углерода и являются инструментом для определения биогенности этого минерала.Обогащение 13 C, наблюдаемое в минеральных ассоциациях, содержащих несквегонит, по сравнению с другими карбонатными ассоциациями, согласуется с различным присутствием основных минералов в микробных матах. Нескегонит неизменно встречается на границе микробного мат-воды, в то время как гидромагнезит более распространен в более глубоких слоях в зонах, подверженных деградации (рис. 3), где относительный вклад углерода, полученного из органического вещества, выше, чем на поверхности.

Фирмикутес, новичок в области осаждения богатых магнием карбонатных минералов

Ранее предполагалось, что фотосинтез цианобактерий играет важную роль в стимулировании образования гидратированных карбонатов магния в сильно щелочной водной среде (Power et al., 2007, 2009; Shirokova et al., 2013). Однако наши результаты не подтверждают этот механизм формирования в Лас-Эрас. Напротив, наблюдения природных образцов с помощью SEM показывают, что осаждение карбоната происходит на нефотосинтетически активных разложившихся цианобактериях в ассоциации с гетеротрофными бактериями (рис. 4).Кроме того, экспериментальная работа, проведенная с отдельными изолятами природных бактерий, показала способность бактерии (идентифицированной как бактерия Firmicutes D. incerta ) вызывать осаждение набора карбонатов (дипингит / гидромагнезит, доломит, несквегонит). , хунтит, магнезит, Mg-кальцит и моногидрокальцит) без влияния цианобактериальных механизмов / метаболизма. Как и в случае с природными образцами, экспериментальные результаты показывают, что минерализация распространяется в биопленках этой EPS-образующей бактерии из зон деградации.Осаждение гидромангезита-дипингита, несквегонита, моногидрокальцита, хунтита и кальцита происходит, несмотря на то, что эти минералы недонасыщены в культуральной среде (таблица 1). Преимущественное образование этих минералов над пересыщенным доломитом и магнезитом показывает, что бактерии могут осуществлять некоторый контроль в процессе осаждения (Sánchez-Román et al., 2007, 2011a, b). Микроорганизмы и ЭПС, вмещающие кристаллы карбоната, содержат Mg 2+ и в меньшей степени Ca 2+ и другие катионы (Рисунки 4, 6).Высвобождение Mg и Ca в результате бактериолиза биомассы может значительно увеличить уровни насыщения внутри матов, способствуя осаждению фаз, обогащенных Mg (Cabestrero et al., 2018). Создание микросреды вокруг бактериальных клеток за счет изменения карбонатной щелочности и доступности Mg 2+ , а также обеспечения сайтов зародышеобразования приводит к осаждению богатых Mg карбонатов (Thompson and Ferris, 1990; Pontoizeau et al. , 1997; Санчес-Роман и др., 2008, 2011b; Гарсия Дель Кура и др., 2014). Кроме того, органические лиганды на микробных клетках могут вызывать частичную дегидратацию адсорбированного Mg 2+ , что дополнительно облегчает образование Mg-содержащих минералов за счет привлечения противоионов (Power et al., 2009, 2017).

Минералы, выращенные в лабораторных бактериальных культурах с использованием чистых изолятов, очень похожи по морфологии и составу на те, которые образуются в природных микробиалитах, что подтверждает, что фирмы Firmicutes играют важную роль в производстве Mg-карбонатов в эфемерном щелочном озере Лас-Эрас.Способность Firmicutes осаждать карбонаты кальция была документально подтверждена Silva-Castro et al. (2015), но участие этого филума в образовании водных и безводных Mg-карбонатов пока не показано. Фирмикуты — одна из самых распространенных ветвей в щелочных озерах, включая озеро Лас-Эрас (Cabestrero et al., 2018 и ссылки в нем), что подчеркивает важную роль, которую некоторые алкалифные представители этого типа могли играть в образовании Mg- карбонаты, такие как доломит и магнезит, с самого раннего периода истории Земли.

Последовательность минерализации

Наблюдение за карбонатными минералами в природных и культурных образцах подтверждает, что водный и безводный магний-карбонатный минерал имеет разные пути минерализации. Во-первых, водные карбонаты магния (дипингит / гидромагнезит) массово образуются в разлагающихся микробных матах. На начальных этапах плохо плотные тромбоциты этой минеральной ассоциации осаждаются на альвеолярном внеклеточном органическом матриксе и микробных клетках. Осаждение карбонатов может привести к захоронению бактерий и образованию агрегатов, напоминающих гантели или розетки.Непрерывное осаждение гидромагнезита приводит к образованию сплошных и плотно упакованных агрегатов за счет органических субстратов, которые резко уменьшаются за счет гетеротрофов. Когда доступность органических субстратов снижается, гетеротрофы, как правило, уменьшают свое количество и свою метаболическую активность (остаются в состоянии покоя) и, вероятно, производят сгустки наноглобул в качестве стратегии уклонения. На этой заключительной стадии безводные фазы (доломит, магнезит, хантит и другие карбонаты) осаждаются либо непосредственно на разрушенных ячейках (в виде хунтита), либо в наноглобулах, которые они производят (доломит и магнезит).Такой механизм зародышеобразования свидетельствует о первичном и биологическом образовании магнезита, исключая быстрое превращение гидратированных фаз в магнезит. Как и в случае с другими типами бактерий и окружающей среды (Sánchez-Román et al., 2014, 2015), эти открытия подтверждают, что наноглобулы, вероятно, производимые Firmicutes, действуют как центры зародышеобразования для доломита и магнезита. Несколько попыток неорганического синтеза магнезита при низких температурах увенчались успехом (Deelman, 2012).Напротив, Power et al. (2017) задокументировали экспериментальное осаждение магнезита с помощью микросфер, аналогичных по размеру и составу бактериям, что подтверждает, что микроорганизмы способствуют образованию магнезита при низкой температуре.

Наши результаты показывают, что отдельные изоляты Firmicutes способны опосредовать образование различных богатых магнием карбонатов. Четкое микробное взаимодействие минералов в биопленке объясняет различия в минералогии и текстуре, поскольку безводные карбонаты минерализуют наиболее устойчивые микробные тельца.Более высокое содержание Са в этих корпускулах по сравнению с ЭПС (рис. 4, 6) может объяснить эти отличительные стили биоминерализации. Таким образом, химический состав клеточных стенок может играть важную роль в процессе минерализации, как предполагают Al Disi et al. (2017).

Кристаллические текстуры как биомаркеры: значение для геологической летописи

Текстурные особенности и микроткани гидромагнезита, образованные в микробных матах Лас-Эрас, аналогичны тем, о которых сообщается в других современных щелочных озерах (Braithwaite and Zedef, 1996; Power et al., 2007), что является надежным критерием оценки биогенности этих кристаллов. Рассел и его сотрудники в 1999 году предположили, что потенциал сохранения гидромагнезитовых микробиалитов в летописи горных пород может быть низким. Последний заметил, что в голоценовых толщах озера Салда-Гёлю (Турция) морфология гидромагнезитовых строматолитов была едва различима, поскольку они вскоре вырождались в пористые, плохо литифицированные породы. Эти авторы также предположили, что последующая диагенетическая дегидратация гидромагнезита до более стабильной фазы, магнезита, может иметь эффект уничтожения всех признаков жизни в более старых породах.Однако микроткань и кристаллическая морфология, сохранившаяся в миоценовых магнезитовых микробиалитах, описанная Санс-Монтеро и Родригес-Аранда (2012), свидетельствует о том, что разрушение микробных сигнатур не обязательно происходит. Напротив, весь набор морфологий кристаллов, описанный в современных аналогах, сохраняется в этих озерных породах, включая кристаллы в форме гантелей, агрегаты излучающих кристаллов, выращенных из сфероидального ядра, кластеры с альвеолярным расположением и т. Д., Как и в современных микробиалитах, миоценовые магнезитовые микробиалиты также представляют собой составные кристаллы, образованные путем самосборки стержней, пластинок, волокон и микрофоссилий, которые иногда связаны с биопленками (Sanz-Montero and Rodríguez-Aranda, 2012). Хорошая сохранность морфологических сигнатур в этом ископаемом аналоге подтверждает, что кристаллические особенности водных фаз магния не стираются диагенетическими преобразованиями и, таким образом, могут использоваться в качестве биосигнатур в летописи горных пород.

Заключение

В сильно щелочных озерах, где происходят циклы влажных и сухих условий, образование богатых магнием карбонатов (гидромагнезит, доломит, магнезит и гидратированные фазы) контролируется микробным разложением биомассы, поскольку осаждение карбоната происходит последовательно, пока она не истощится. . Водные метастабильные карбонаты магния образуются первыми, а безводные минералы осаждаются позже, связанные с устойчивыми и богатыми кальцием бактериальными тельцами. Водные и безводные карбонаты Mg имеют разные кристаллические текстуры, соответствующие различным путям их образования.Таким образом, наличие биомассы является важным фактором, который следует учитывать в процессах биоминерализации богатых магнием карбонатов в экстремальных условиях. Биогеохимические взаимодействия, которые контролируют осаждение богатых Mg карбонатов бактериями, могут иметь значение для биоремедиации CO 2 и Mg в экстремально щелочной среде.

Алкалифильные гетеротрофные Firmicutes играют важную роль в осаждении Mg-карбонатов в современных щелочных озерах, как это могло быть в древних средах.Таким образом, временные озера представляют собой современный аналог для использования в интерпретации древних щелочных и / или соленых сред, содержащих карбонаты магния. Уточнение того, как образуются и стабилизируются эти богатые Mg карбонатные фазы, может иметь более широкое значение для понимания процессов, связанных с микробной активностью на протяжении геологического времени. Наконец, это экспериментальное исследование также предоставляет потенциальные биосигнатуры, которые могут быть полезны для проверки поверхности Земли и внеземных сред обитания на наличие и активность биоминерализации бактерий, подобных D.Incerta.

Авторские взносы

MES-M руководил проектом, написал рукопись при поддержке двух соавторов и выполнил полевые поездки, а также микроскопические наблюдения с OC. Компания OC изготовила образцы и охарактеризовала их с помощью XRD, выполнила моделирование с помощью PHREEQC и построила чертежи. MS-R предложила и провела культуральные эксперименты при содействии ОК.

Финансирование

Авторы очень признательны за поддержку со стороны проекта CGL2015-66455-R (MINECO-FEDER) и проекта Центра происхождения 1

131, NWO и Национальной научной программы Нидерландов.Это часть научной деятельности исследовательской группы UCM-

4.

Заявление о конфликте интересов

Авторы заявляют, что исследование проводилось при отсутствии каких-либо коммерческих или финансовых отношений, которые могут быть истолкованы как потенциальный конфликт интересов.

Благодарности

Авторы благодарят заместителя редактора, доктора Гордона Тейлора, за его редакторскую работу. Они благодарны трем рецензентам, которые внесли свой вклад в улучшение рукописи.Д-р Гектор Диас Эрнандес очень признателен за филогенетический анализ 16S рибосомальной дезоксирибонуклеиновой кислоты (рДНК) и интерпретацию данных. Советы Пабло дель Буэя очень помогли улучшить минералогический анализ.

Список литературы

Аль Дизи, З.А., Джауа, С., Бонтогнали, Т. Р. Р., Аттиа, Э. С. М., Аль-Кувари, Х. А. С. и Зуари, Н. (2017). Доказательства роли аэробных бактерий в образовании высокого карбоната магния в эвапоритовой среде дохат фаишах сабха в Катаре. Фронт. Environ. Sci. 5: 1. DOI: 10.3389 / fenvs.2017.00001

CrossRef Полный текст | Google Scholar

Бонтогнали, Т. Р., Васконселос, К., Вартманн, Р. Дж., Дюпраз, К., Бернаскони, С. М., и Маккензи, Дж. А. (2008). Микробы создают структуры, подобные нанобактериям, избегая захвата клеток. Геология 36, 663–666. DOI: 10.1130 / G24755a.1

CrossRef Полный текст | Google Scholar

Брейтуэйт, К. Дж. Р. и Зедеф, В. (1996). Гидромагнезитовые строматолиты и осадки в щелочном озере, Салда Голу, Турция. J. Sediment. Res. 66, 991–1002.

Google Scholar

Кабестреро, О., и Санс-Монтеро, М. Э. (2018). Развитие рассола в двух внутренних испарительных средах: влияние микробных матов на минеральные осадки. J. Paleolimnol. 59, 139–157. DOI: 10.1007 / s10933-016-9908-0

CrossRef Полный текст | Google Scholar

Кабестреро, О., Санс-Монтеро, М. Э., Арреги, Л., Серрано, С., и Вишер, П. Т. (2018). Сезонная изменчивость минералообразования в микробных матах, подверженных циклам сушки и увлажнения в щелочных и гиперсоленых осадочных средах. Aquat. Геохим. 24, 79–105. DOI: 10.1007 / s10498-018-xyb9333-2

CrossRef Полный текст | Google Scholar

Каньяверас, Дж. К., Санчес-Мораль, С., Санс-Рубио, Э., и Ойос, М. (1998). Метеорная кальцификация магнезита в миоценовых озерных отложениях (бассейн Калатаюд, северо-восток Испании). Осадок. Геол. 119, 183–194. DOI: 10.1016 / S0037-0738 (98) 00063-3

CrossRef Полный текст | Google Scholar

Кошелл, Л., Розен, М. Р., Макнамара, К.Дж. (1998). Гидромагнезитовая замена биоминерализованного арагонита на новом месте голоценовых строматолитов, озеро Валюнгуп, Западная Австралия. Седиментология 45, 1005–1018. DOI: 10.1046 / j.1365-3091.1998.00187.x

CrossRef Полный текст | Google Scholar

Couradeau, E., Benzerara, K., Gérard, E., Estève, I., Moreira, D., Tavera, R., et al. (2013). Кальцификация цианобактерий в современных микробиалитах в субмикронном масштабе. Biogeosciences 10, 5255–5266.DOI: 10.5194 / bg-10-5255-2013

CrossRef Полный текст | Google Scholar

Дас Шарма, С., Патил, Д. Т., и Гопалан, К. (2002). Температурная зависимость фракционирования изотопов кислорода CO 2 в реакции магнезит-фосфорная кислота. Геохим. Космохим. Acta 66, 589–593. DOI: 10.1016 / S0016-7037 (01) 00833-X

CrossRef Полный текст | Google Scholar

Дилман, Дж. К. (2012). Способны ли бактерии осаждать магнезит? Период.Минеральная. 81, 225–235. DOI: 10.2451 / 2012PM0013

CrossRef Полный текст | Google Scholar

ДеФарж, К., Трише, Дж., Жоне, А. М., Роберт, М., Триббл, Дж., И Сансон, Ф. Дж. (1996). Текстура микробных отложений, выявленная методом крио-сканирующей электронной микроскопии. J. Sediment. Res. 66, 935–947.

Google Scholar

Дезир, Г., Гутьеррес Элорса, М. Ю., и Гутьеррес Сантолалла, Ф. (2003). Origen y evolución de playas en una zona semiárida con arenas eólicas (регион Кока, Куэнка-дель-Дуэро, Испания). Boletín Geol. Минеро 114, 395–407.

Google Scholar

Древняк Л., Стичек А., Майдер-Лопатка М. и Склодовска А. (2008). Бактерии, гипертолерантные к мышьяку в породах древнего золотого рудника, и их потенциальная роль в распространении загрязнения мышьяком. Environ. Загрязнение. 156, 1069–1074. DOI: 10.1016 / j.envpol.2008.04.019

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Эдвардс, Р. А., Родригес-Брито, Б., Wegley, L., Haynes, M., Breitbart, M., Peterson, D.M, et al. (2006). Использование пиросеквенирования, чтобы пролить свет на микробную экологию глубоких шахт. BMC Genomics 7:57. DOI: 10.1186 / 1471-2164-7-57

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Фолк, Р. Л. (1993). СЭМ-изображение бактерий и нанобактерий в карбонатных отложениях и горных породах. J. Sediment. Res. 63, 990–999.

Google Scholar

Гарсия Дель Кура, M. Á, Санс-Монтеро, M.Э., Де Лос Риос, М. А., Аскасо, К. (2014). Микробный доломит в пресноводных карбонатных отложениях. Седиментология 61, 41–55. DOI: 10.1111 / sed.12047

CrossRef Полный текст | Google Scholar

Глассер, Ф. П., Джауффрет, Г., Моррисон, Дж., Гальвез-Мартос, Дж. Л., Паттерсон, Н., и Имбаби, М. С. Е. (2016). Секвестрация CO2 путем минерализации в полезные продукты на основе несквехонита. Фронт. Energy Res. 4: 3. DOI: 10.3389 / fenrg.2016.00003

CrossRef Полный текст | Google Scholar

Казмерчак, Я., Кемпе, С., Кремер, Б., Лопес-Гарсия, П., Морейра, Д., и Тавера, Р. (2011). Гидрохимия и микробиалиты щелочного кратерного озера Альчичика, Мексика. Фации 57, 543–570. DOI: 10.1007 / s10347-010-0255-8

CrossRef Полный текст | Google Scholar

Ласт, Ф. М., Ласт, В. М., Халден, Н. М. (2010). Карбонатные микробиалиты и твердые грунты из озера Манито, щелочного и гиперсоленого озера на севере Великих равнин Канады. Осадочная геология 225, 34–49.DOI: 10.1016 / j.sedgeo.2010.01.006

CrossRef Полный текст | Google Scholar

Ласт, В. М. (1992). Петрология современных карбонатных грунтов из озера Восточного бассейна, соленого озера Маар, Южная Австралия. Осадок. Геол. 81, 215–229. DOI: 10.1016 / 0037-0738 (92) -X

CrossRef Полный текст | Google Scholar

Лусон, А., Майайо, М. Дж., И Перес, А. (2009). Характеристика стабильных изотопов сосуществующих карбонатов из голоценового озера Галлоканта (северо-восток Испании): палеолимнологические последствия. Внутр. J. Earth Sci. 98, 1129–1150. DOI: 10.1007 / s00531-008-0308-1

CrossRef Полный текст | Google Scholar

Маклин, Р. Дж. К., Джеймисон, Х. Э., и Каллимор, Д. Р. (1997). Образование несквегонита и других минералов в результате обезвоживания биопленок. World J. Microbiol. Biotechnol. 13, 25–28. DOI: 10.1007 / BF02770803

CrossRef Полный текст | Google Scholar

Мележик В.А., Фаллик А.Е., Медведев П.В., Макарихин В.В. (2001). Палеопротерозойский магнезит: литологические и изотопные свидетельства наличия плайи / сабхи. Седиментология 48, 379–397. DOI: 10.1046 / j.1365-3091.2001.00369.x

CrossRef Полный текст | Google Scholar

Мейерс, П. А. (1994). Сохранение элементарных и изотопных источников идентификации осадочного органического вещества. Chem. Геол. 114, 289–302. DOI: 10.1016 / 0009-2541 (94) -0

CrossRef Полный текст | Google Scholar

Нтугиас, С., Зервакис, Г. И., Кавроулакис, Н., Эалиотис, К., и Пападопулу, К. К. (2004). Разнообразие бактерий в компосте из использованных грибов оценивали с помощью рестрикционного анализа амплифицированной рДНК и секвенирования культивируемых изолятов. Syst. Прил. Microbiol. 27, 746–754. DOI: 10.1078 / 0723202042369857

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Ордоньес, С., и Гарсиа дель Кура, М.А. (1994). «Отложение и диагенез солей сульфата натрия и кальция в третичных соленых озерах Мадридского бассейна, Испания», в Седиментология и геохимия современных и древних соленых озер , Vol.50, ред. Р. В. Рено и В. М. Ласт (Саскатун: SEPM Spec. Publ.), 229–238.

Пейдж А. Л., Миллер Р. Х. и Кини Д. Р. (1982). Методы анализа почв, часть 2, химические и микробиологические свойства. Мэдисон, Висконсин: Американское общество агрономии и почвоведов Америки.

Google Scholar

Parkhurst, D. L., и Appelo, C. (1999). «Руководство пользователя PHREEQC (версия 2). Компьютерная программа для видообразования, периодической реакции, одномерного переноса и обратных геохимических расчетов », в U.S. Отчет геологической службы по исследованию водных ресурсов 99-4259 , (Рестон, Вирджиния: Геологическая служба США).

Google Scholar

Перес-Риварес, Ф., Гарсес, М., Аренас, К., и Пардо, Г. (2002). Magnetocronología de la sucesión miocena de la Sierra de Alcubierre (центральный сектор Куэнка-дель-Эбро). Rev. Soc. Геол. España 15, 217–231.

Google Scholar

Pontoizeau, P., Castanier, S., and Perthuisot, J. P. (1997). «Первое бактериальное производство магнезита MgCO 3 в анаэробных строго контролируемых условиях», in Microbial Mediation in Carbonate Diagenesis , Vol.26, изд. Г. Ф. Камуан (Париж: ASF), 57–58.

Google Scholar

Пауэр, И. М., Уилсон, С. А., Том, Дж. М., Диппл, Г. М., Габитес, Дж. Э. и Саутэм, Г. (2009). Гидромагнезитовые пласты Атлина, Британская Колумбия, Канада: биогеохимическая модель секвестрации CO 2 . Chem. Геол. 260, 286–300. DOI: 10.1016 / j.chemgeo.2009.01.012

CrossRef Полный текст | Google Scholar

Пауэр, И. М., Уилсон, С. А., Том, Дж. М., Диппл, Г.М., и Саутэм, Г. (2007). Биологически индуцированная минерализация дипингита цианобактериями из щелочных водно-болотных угодий недалеко от Атлина, Британская Колумбия, Канада. Geochem. Пер. 8:13. DOI: 10.1186 / 1467-4866-8-13

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Пуэйо Дж. И Инглес М. (1987). Минералогия субстрата, состав поровых солей и диагенетические процессы в прибрежных озерах Лос Монегрос и Бахо Арагон (Испания). Геохимия и минералообразование на поверхности Земли. Геохим. Космохим. Acta 52, 351–372.

Рено, Р. У. (1993). Морфология, распространение и потенциал сохранения микробных матов в гидромагнезит-магнезитовых пластах плато Карибу, Британская Колумбия, Канада. Hydrobiologia 267, 75–98. DOI: 10.1007 / Bf00018792

CrossRef Полный текст | Google Scholar

Райс, Э. У., Бриджуотер, Л., Федерация, У. Э. и Ассоциация, А. П. Х. (2012). Стандартные методы исследования воды и сточных вод. Вашингтон, округ Колумбия: Американская ассоциация общественного здравоохранения (APHA).

Google Scholar

Рассел М. Дж., Ингхэм Дж. К., Зедеф В., Мактав Д., Сунар Ф., Холл А. Дж. И др. (1999). Поиск признаков древней жизни на Марсе: ожидания от гидромагнезитовых микробиалитов, озеро Салда, Турция. J. Geol. Soc. 156, 869–888. DOI: 10.1144 / gsjgs.156.5.0869

CrossRef Полный текст | Google Scholar

Сальвани, Дж. М., и Орти, Ф. (1994). «Миоценовые глауберитовые месторождения Альканадре, бассейн Эбро, Испания: осадочные и диабетические процессы», в Седиментология и геохимия современных и древних соленых озер , Vol.50, ред. Р. В. Рено и В. М. Ласт (Саскатун: SEPM Spec. Publ.), 203–215. DOI: 10.2110 / pec.94.50.0203

CrossRef Полный текст

Санчес-Роман, М., Фернандес-Ремолар, Д., Амилс, Р., Санчес-Навас, А., Шмид, Т., Сан-Мартин-Урис, П. и др. (2014). Микробно-опосредованное образование Fe-карбонатных минералов в экстремальных кислых условиях. Sci. Отчет 4: 4767. DOI: 10.1038 / srep04767

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Санчес-Роман, М., Маккензи, Дж. А., Вагенер, А. Д. Л. Р., Риваденейра, М. А., и Васконселос, К. (2009a). Присутствие сульфата не препятствует низкотемпературному осаждению доломита. Планета Земля. Sci. Lett. 285, 131–139. DOI: 10.1016 / j.epsl.2009.06.003

CrossRef Полный текст | Google Scholar

Санчес-Роман, М., Маккензи, Дж. А., Вагенер, А. Д. Л. Р., Романек, К. С., Санчес-Навас, А., и Васконселос, К. (2011a). Экспериментально определенный коэффициент распределения Sr для доломита: значение и значение для природного доломита. Геохим. Космохим. Acta 75, 887–904. DOI: 10.1016 / j.gca.2010.11.015

CrossRef Полный текст | Google Scholar

Санчес-Роман, М., Пуэнте-Санчес, Ф., Парро, В. и Амилс, Р. (2015). Зарождение богатых железом фосфата и карбоната на микробных клетках и экзополимерных веществах. Фронт. Microbiol. 6: 1024. DOI: 10.3389 / fmicb.2015.01024

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Санчес-Роман, М., Риваденейра, М.А., Васконселос, К., и Маккензи, Дж. А. (2007). Биоминерализация карбонатов и фосфатов умеренно галофильными бактериями. FEMS Microbiol. Ecol. 61, 273–284. DOI: 10.1111 / j.1574-6941.2007.00336.x

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Санчес-Роман, М., Романек, К. С., Фернандес-Ремолар, Д. К., Санчес-Навас, А., Маккензи, Дж. А., Пибернат, Р. А. и др. (2011b). Аэробная биоминерализация карбонатов с высоким содержанием магния: последствия для окружающей среды. Chem. Геол. 281, 143–150. DOI: 10.1016 / j.chemgeo.2010.11.020

CrossRef Полный текст | Google Scholar

Санчес-Роман, М., Васконселос, К., Шмид, Т., Диттрих, М., Маккензи, Дж. А., Зеноби, Р. и др. (2008). Доломит с аэробными микробами в нанометровом масштабе: значение для геологической летописи. Геология 36, 879–882. DOI: 10.1130 / G25013a.1

CrossRef Полный текст | Google Scholar

Санчес-Роман, М., Васконселос, К., Вартманн, Р., Риваденейра, М., и Маккензи, Дж. А. (2009b). Осаждение микробного доломита в аэробных условиях: результаты из лагуны Брежо-ду-Эспинью (Бразилия) и культуральные эксперименты. Перспектива. Карбонат Геол. 41, 167–178. DOI: 10.1002 / 9781444312065.ch21

CrossRef Полный текст | Google Scholar

Sanz-Montero, E., Arroyo, X., Cabestrero,., Calvo, J. P., Fernández Escalante, E., Fidalgo, C., et al. (2013). Procesos de sedimentación y biomineralización en la laguna alcalina de las Eras (Humedal Coca-Olmedo). Geogaceta 53, 97–100.

Санс-Монтеро, М. Э. (1996). Sedimentologıìa de las Formaciones Neógenas del Sur de la Cuenca de Madrid , ed. CEDEX (Мадрид), Vol. 52. Serie Monografías, 245.

Санс-Монтеро, М. Э., Кабестреро, О., и Родригес-Аранда, Дж. (2013). Осаждение гидромагнезита в микробных матах из сильно щелочного озера, Центральная Испания. Минеральная маг. 77: 2628.

Google Scholar

Санс-Монтеро, М. Э., и Родригес-Аранда, Х.П. (2012). Образование магнезита в результате микробной активности: данные из гиперсоленого озера миоцена. Осадок. Геол. 263, 6–15. DOI: 10.1016 / j.sedgeo.2011.08.004

CrossRef Полный текст | Google Scholar

Санс-Монтеро, М. Э., Родригес-Аранда, Дж. П. и Кальво, Дж. П. (2006). Посредничество эндоэвапоритовых микробных сообществ в раннем замещении гипса доломитом: пример из миоценовых озерных отложений Мадридского бассейна, Испания. J. Sediment. Res. 76, 1257–1266.DOI: 10.2110 / jsr.2006.122

CrossRef Полный текст | Google Scholar

Санс-Рубио, Э., Родригес-Аранда, Дж. П., и Кальво Сорандо, Дж. П. (2002). Petrología y geoquímica isotópica de los depósitos de magnesita de la cuenca de Calatayud (провинция Сарагоса). Interpretación paleoambiental. Rev. Soc. Геол. España 15, 113–127.

Широкова Л.С., Мавроматис В., Бунделева И.А., Покровский О.С., Бенезет П., Жерар Э. и др. (2013). Использование изотопов Mg для отслеживания осаждения карбоната магния, опосредованного цианобактериями, в щелочных озерах. Aquat. Геохим. 19, 1–24. DOI: 10.1007 / s10498-012-9174-3

CrossRef Полный текст | Google Scholar

Сильва-Кастро, Г. А., Уад, И., Гонсалес-Мартинес, А., Риваденейра, А., Гонсалес-Лопес, Дж., И Риваденейра, М. А. (2015). Биологическое осаждение кристаллов карбоната кальция бактериями, изолированными из солевых сред, выращенных в питательных средах с добавлением морской воды и настоящего рассола. Biomed. Res. Int. 2015: 816102. DOI: 10.1155 / 2015/816102

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Слотер, М.и Хилл Р. Дж. (1991). Влияние органических веществ на органогенную доломитизацию. J. Sediment. Бензин. 61, 296–303. DOI: 10.1306 / D42676f9-2b26-11d7-8648000102c1865d

CrossRef Полный текст | Google Scholar

Stackebrandt, E., Schumann, P., Swiderski, J., and Weiss, N. (1999). Реклассификация Brevibacterium incertum (порода 1953 г.) как Desemzia incerta gen. нов., гребешок. ноя Внутр. J. Syst. Evol. Microbiol. 49, 185–188. DOI: 10.1099 / 00207713-49-1-185

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Томпсон, Дж.Б. и Феррис Ф. Г. (1990). Осаждение цианобактериями гипса, кальцита и магнезита из природной щелочной воды озера. Геология 18, 995–998. DOI: 10.1130 / 0091-7613 (1990) 018 <0995: CPOGCA> 2.3.CO; 2

CrossRef Полный текст | Google Scholar

Трише, Дж., Дефарж, К., Триббл, Дж., Триббл, Г., и Сансон, Ф. (2001). Лагунные озера острова Рождества, модели отложений карбонатно-эвапорит-органических слоистых отложений. Осадок. Геол. 140, 177–189.DOI: 10.1016 / S0037-0738 (00) 00177-9

CrossRef Полный текст | Google Scholar

Васконселос, К., и Маккензи, Дж. А. (1997). Микробное посредничество в осаждении современного доломита и диагенезе в бескислородных условиях (Лагоа Вермелья, Рио-де-Жанейро, Бразилия). J. Sediment. Res. 67, 378–390.

Google Scholar

Васконселос, К., Маккензи, Дж. А., Бернаскони, С., Груич, Д., и Тиенс, А. Дж. (1995). Микробное посредничество как возможный механизм образования природного доломита при низких температурах. Природа 377, 220–222. DOI: 10.1038 / 377220a0

CrossRef Полный текст | Google Scholar

Райт, Д. Т. (1999). Роль сульфатредуцирующих бактерий и цианобактерий в образовании доломита в отдаленных эфемерных озерах региона Коронг, Южная Австралия. Осадок. Геол. 126, 147–157. DOI: 10.1016 / S0037-0738 (99) 00037-8

CrossRef Полный текст | Google Scholar

Ядав, А. Н., Сачан, С. Г., Верма, П., Тьяги, С. П., Каушик, Р., и Саксена, А.К. (2015). Культурное разнообразие и функциональная аннотация психротрофных бактерий из холодной пустыни Лех Ладакх (Индия). World J. Microbiol. Biotechnol. 31, 95–108. DOI: 10.1007 / s11274-014-1768-z

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Nanobac представляет новые улучшенные наборы для ИФА — MEDICA


Тампа, Флорида (26 октября 2005 г.) — Nanobac Life Sciences, Inc. (OTCBB: NNBP) («Nanobac» или «Компания») объявила сегодня о выпуске двух новых версий NANOCAPTURE ™ и NANO-SERO. ™ Тест-наборы ELISA для обнаружения кальцифицирующих наночастиц (CNP), также известных как нанобактерии, в сыворотке или плазме.Новые комплекты предлагают улучшенную чувствительность, более низкий фон и улучшенную стабильность по сравнению с предыдущими версиями. Nanobac добавила новые стандарты для повышения точности на нижнем уровне и сублимировала критически важные компоненты для повышения стабильности.
«Наш спрос на диагностические продукты CNP растет, поскольку CNP или нанобактерии вызывают все больше и больше хронических заболеваний», — заявил Грант Карлсон, президент и главный операционный директор Nanobac. «Компания Nanobac упорно работала над разработкой надежных, чувствительных и воспроизводимых наборов тестов ELISA для исследовательского сообщества CNP / нанобактерий.Эти комплекты имеют маркировку CE и готовы к немедленной отправке по всему Европейскому Союзу. В США наборы будут продаваться только для исследовательских целей (RUO) ».
NANOCAPTURE ELISA — это иммуноферментный анализ с двумя участками для количественного измерения CNP / нанобактериального антигена в сыворотке или плазме. NANO-SERO ELISA также представляет собой иммуноферментный анализ с двумя участками для количественного измерения антител против CNP в сыворотке или плазме. Nanobac представит наборы для тестирования NANOCAPTURE и NANO-SERO ELISA на медицинской выставке №1 в мире MEDICA в Дюссельдорфе, Германия, 16-19 ноября 2005 года.В прошлом году выставка привлекла 136 000 посетителей со всего мира. Nanobac намеревается встретиться с потенциальными клиентами и создать глобальную сеть дистрибьюторов для диагностики in vitro.
О компании Nanobac Life Sciences
Nanobac Life Sciences, Inc. — это крупная медико-биологическая компания, которая обнаруживает, разрабатывает, производит и продает ряд продуктов и услуг для улучшения здоровья людей за счет обнаружения и обработки кальцифицирующих наночастиц, иначе известные как «нанобактерии».Новаторские исследования компании устанавливают патогенную роль нанобактерий в кальцификации мягких тканей, особенно при ишемической болезни сердца, простатите и сосудистых заболеваниях.

Nanobac производит и продает наборы для диагностики in vitro (IVD) и реагенты для обнаружения кальцифицирующих наночастиц.

Добавить комментарий

Ваш адрес email не будет опубликован. Обязательные поля помечены *